- Email: [email protected]
Three highly polymorphic microsatellites at the human myelin oligodendrocyte glycoprotein locus, 100 kb telomeric to HLA-F
ELSEVIER
Three Highly Polymorphic Microsatellites the Human Myelin Oligodendrocyte Glycoprotein Locus, 100 kb Telomeric to HLA-F Characterization and Relation to HLA Haplotypes
at
Marie-Paule Roth, Laurence Dolbois, Nicolas Borot, Claire Amadou, Michel Clanet, Pierre Pontarotti, and HUne Coppin ABSTRACT:
The MOG locus, located on chromosomal bands 6~2 1.3-p22 and mapped about 100 kb telomeric to HLA-F, was isolated from cosmid ICRFc109A2434 and shown to contain three microsatellites. These CArepeat polymorphic markers were characterized in a sample of 173 healthy unrelated individuals and 84 DNAs from the HLA Workshop reference panel, by a method combining fluorescence labeling of PCR products and use of an automated DNA sequencer. For the three markers, frequencies of heterozygotes are well predicted from allele frequencies by the Hardy-Weinberg rule, which suggests that problems of allele nonamplification are unlikely.
Typing of cell lines homozygous in the HLA region allowed unambiguous definition of 81 HLA-MOG haplotypes and showed that several HLA ancestral haplotypes extended to the MOG region. The high degree of polymorphism (59%, 51%, and 81% at the three loci, respectively, and 87% at the haplotype level) makes these new markers informative for association or linkage studies with diseases such as hemochromatosis or multiple sclerosis, and for studies aimed at precisely delineating the site of crossover in chromosomes in which recombination occurred in the distal part of the HLA class I region. Human Immunology 43, 276-282 (1995)
ABBREVIATIONS myelin MOG
PCR
oligodendrocyte
glycoprotein
polymerase
chain reaction
INTRODUCTION The myelin oligodendrocyte glycoprotein (MOG) locus, encoding a component involved in the completion and maintenance of the myelin sheath [l-3}, has been mapped to chromosomal region 6~2 1.3-p22 [41 and shown to be about 100 kb telomeric to HLA-F [5]. The N-terminal extracellular domain of MOG has significant sequence homologies with two nonmyelin proteins: bo-
From the Federatiw Institute of Reward, INSERMICNRSIUPS, CHU Pnrpan, Todouse, France. Addrers reprint requests to Dr. M.-P. Roth, CIGH, CNRS VPR 8291, CHU Purpan, 31300 Toulouse, France. Received Dew&r I, 1994; accepted Fehuuty 27, 1995. Human Immunology 43, 276-282 (1995) 0 American Society for Histocompatibility
vine butyrophilin, expressed in the mammary gland during lactation and facilitating the interaction between cytoplasmic lipid droplets and the apical membrane 161, and chicken B-G antigen, encoded by a gene mapping to the major histocompatibility complex and associated with an adjuvant effect on the immune response E7-j. MOG, butyrophilin, and the B-G antigen share an immunoglobulin-like domain characteristic of members of the immunoglobulin superfamily 181. As suggested by Steinman [9] and based on the observation of a MOGspecific cytotoxic T-cell clone without self-restriction [lo], MOG may have an unforeseen immunologic status within the central nervous system, providing, for in0 198~8859/95/$9.50
and Immunogenetics,
1995
SSDI 019%8859(95)0039-7
Polymorphisms
277
at the MOG Locus, Telomeric to HLA-F
stance, a rudimentary molecular framework for presentation of pathogens to the immune system. A majority of patients with multiple sclerosis have antibodies against MOG in their sera and cerebrospinal fluid I1 11 and a predominant T-cell reactivity to this antigen [ 121; MOG may, therefore, be implicated in the pathogenesis of this inflammatory disease of the central nervous system characterized by localized myelin destruction. Simple repetitive elements, or microsatellites, located in the proximity of candidate genes for disease susceptibility are informative markers for association or linkage studies 1137. However, such informative markers telomerit to HLA-F, i.e., in the distal part of the major histocompatibility complex, are lacking. The closest microsatellite identified to date, DbS105 [14], has been localized at more than 1000 kb from HLA-F 151. There is an urgent need for such markers to be identified in order to examine the potential role of the MOG gene in susceptibility to multiple sclerosis. These markers would also help in the refining of the location of the gene for hemochromatosis, a common disorder of iron metabolism inherited as an autosomal recessive trait and characterized by progressive iron storage in parenchymal cells of major organs, primarily the liver, pancreas, and heart. The hemochromatosis gene is known to be linked to HLA-A 1151. It seems now more telomeric than the HLA-A locus {16], but its precise location has not been determined because of a lack of highly informative markers for this region. Finally, these markers would be essential for studies aimed at precisely delineating the site of crossover in chromosomes in which recombination occurred in the distal part of the HLA class I region. The aim of the present study was therefore to isolate microsatellites within the MOG region, and to characterize these markers in a sample of 173 unrelated individuals and 84 DNAs from the HLA Workshop reference panel of B-lymphoblastoid cell lines.
30 minutes at 50°C. Three X&Z fragments of 1.3, 2, and 5.6 kb, respectively, hybridized to the (CA),, probe. The relevant fragments were subcloned into pGEM-3Z Vector (Promega) and sequenced on an ABI 373 DNA Sequencing System using the Taq polymerase dye terminator sequencing chemistry. The sequences flanking the repeats were used to design PCR primers.
MATERIALS
GmATATAAATATATATGTGTGTGTGTGTGTGTGTGTGTAC~GA~~CATCCAGTCT
PCR conditions and automated product analysis. In each case, 200 ng of genomic DNA were amplified in a total volume of 20 ~1 using 0.5 U Taq DNA polymerase (Promega). Oligonucleotide primer sequences are given in Fig. 1. Each reaction contained 10 mM Tris-HCI pH 9, 50 mM KCI, 1.5 mM MgCl,, 0.2 mM each dNTP, and 0.5 p,M each primer. Oligonucleotides MOGll, MOG2 1, and MOG3 1 were labeled with the fluorescent dyes “JOE, ” “TAMRA,” and “FAM” (Applied Biosys1 Nucleotide sequences of the three (CA), microsatellite-containing regions. Arrows show the polarity and position of the six primers used for PCR amplification. Primer sequences are MOG 11 (5 ‘GTACAGCCAAAAGGTGACATC-3’), MOG12 (5’-ACCCTGTATTTGTGAGCGC-J)), MOG2 1 (5’FIGURE
TTCACTGCCACATCCTCA-3’), MOG22 (5’-ATGGTTTTATCTTTCTCTTAG-3’), MOG3 1 (5’-GAAATGTGAGAATAAAGGAGA-37, and MOG32 (5’-GATAAAGGGGAACTACTACA-3’). MOGa
GTACAGCCAAAAGGTGACATCTCCmCTATAT~~ATA~AGACA~GA~AC~GCT + MOGI 1 TATTCACTAGGACCAAGCACAGGTGTGTGTGTGTGTGTGTGTGTGTG~CGCTCAC~ < MOG12 TACAGGGT
MOGb
MOG21
AND
METHODS
isolation of the microsatellites. Cosmid clone ICRFc109A2434, containing a 45-kb insert which includes the entire MOG gene, was isolated from a chromosome 6 library constructed in Lawrist 4 [17} by hybridization with a 187-bp probe specific from the MOG immunoglobulin-like domain. This probe was obtained by polymerase chain reaction (PCR) amplification of human genomic DNA with primers designed upon the rat cDNA sequence 181. The cosmid was digested with different restriction enzymes and screened for simple repeat sequences with two (CA),, and (CT),, oligonucleotides. Transfers and hybridizations were performed with standard techniques 1183. Filters were washed in 2 X SSC; 0.1% SDS for 30 minutes at room temperature, and for
CAAGATTCAGAGAATTAAAACCTAAGAGAAAGATAAAACCAT < MOG22
MOGc
GAAATGTGAGAATAAAGGAGACACTCTCTAAGATCTCTTCAT > MOG31
CATGTAGTAGTTCCCCTTTATC MOG32
M.-P. Roth et al.
278
terns), respectively. PCR was carried out in a GeneAmp PCR System 9600 (Perkin-Elmer). Samples were initially denaturated at 94°C for 1 minute 30 seconds, before undergoing 25 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 30 seconds. Amplification products were loaded onto 6% denaturing polyacrylamide gels with an internal lane standard labeled with the “ROX” dye (Applied Biosystems), and analyzed on an ABI 373 DNA Sequencing System 1191. Sizing of the products was performed automatically by 672 GENESCAN Analysis software using the Southern Local method to establish a curve of best fit through the fragments of the internal standard in each lane. DNA samples. The length variability of the three microsatellites was ascertained in 173 unrelated healthy Caucasian individuals. Sizing of the three microsatellites was also performed in 50 members of 10 families to follow inheritance patterns, and on 84 DNAs from the largely available HLA Workshop reference panel of B-lymphoblastoid cell lines f201 to provide typing references. at each locus were Statistic analysis. Allele frequencies obtained by gene counting, assuming two alleles per locus. Observed numbers of heterozygotes were compared to their expectations under Hardy-Weinberg equilibrium by a goodness-of-fit chi square. Without family studies, haplotypes formed by the three polymorphisms can only be inferred from phenotypic data when individuals are heterozygous at one locus or none at all. In most cases, some probabilistic interpretation is required. Maximum likelihood estimates of the frequencies and support limits for all possible haplotypes were therefore computed 12 1, 221.
n n
Lane 21: MOGc:
132 bp/146
bp haterozygote
Lane 21: MOGb:
160 bp/l60
bp heterozygote
n n
RESULTS The region surrounding the human MOG locus was isolated from cosmid ICRFc109A2434 and shown to contain three microsatellites, which we designated MOGa, MOGb, and MOGc. These microsatellites consist of 13, 11, and 15 repeats of the CA/GT dinucleotide, respectively. MOGa was located in the second intron of the gene, at position 898 relative to exon 2/intron 2 splicing site, whereas MOGb and MOGc were both upstream of the MOG transcription start site. The sequences of the three sets of primers designed to measure variations in the number of CA repeats are given in Fig. 1. Amplification of the cosmid DNA by these primers yielded PCR products of 128, 160, and 132 bp, respectively. An example of the electrophoregrams generated by the automated scanning system is shown in Fig. 2. Allelic distributions for each polymorphism are given in Fig. 3. In the sample of 346 chromosomes from healthy unrelated individuals, six alleles were identified at the MOGa locus, 10 at MOGb, and 11 at MOGc. Examination of the frequency distributions of MOGb and MOGc indicates that they are multimodal, with a gap between alleles of 166 and 178 bp at the MOGb locus, and between alleles of 122 and 130 bp at MOGc. The presence of different modes, each presenting different degrees of variability, may be the result of the mechanisms by which new alleles were produced and may suggest that more than one molecular mechanism is acting. The exact repeat numbers of the CA/GT sequence corresponding to most of these alleles was determined by sequencing. It was noticed that alleles of size greater than 166 bp at locus MOGb carried some minor sequence variation in the region adjacent to the repeat on
Lane 21: MOGa: Lane 21: GS-2500
126 bp1128 bp heterozygote size standard
FIGURE 2 Electrophoregram generated by an individual heterotygote at the three MOG loci. Lengths of the GS-2500 standard fragments are 94, 109, 116, 172, and 186 bp.
size
Polymorphisms
279
at the MOG Locus, Telomeric to HLA-F
MOG a
MOG b
MOG c
MOGc are positively associated (Spearman rank correlation coefficient r = 0.77; p < 0.001); that is, large alleles at MOGb aggregate with large-sized alleles at MOGc, and so do small-sized alleles. This does not appear to be the case for alleles at loci MOGa and MOGb (Y = 0.13; N.S.). The positive size association of alleles at loci MOGb and MOGc may indicate that recombination between these loci is either absent or occurs at a low rate. Results of the typing of the 84 DNAs from the HLA Workshop reference panel of B-lymphoblastoid cell lines are given in Table 2. Because most of these cell lines were homotygous in the HLA region, they were rarely heterozygous at more than one MOG locus. A total of 8 1 haplotypes could therefore be unambiguously defined, 23 of which were distinct. These haplotypes included the same alleles as those detected in the sample of 173 unrelated individuals. Several cell lines sharing at least the telomeric part of well-defined HLA ancestral haplotypes [231 also share the MOG haplotype. For instance, cells 9013,9017, 9033, 9034, 9065,9081,9082, and 9083 are HLA A3-C7-B7 and MOG128- 160- 130; cells 9022, 9023, 9086, 9087, and 9088 are HLA Al-C7-B8 and MOG126-180148; and cells 9038 and 9061 are HLA A2-C7-B 18 and MOG126- 160-122. Except for cells 9022 and 9033, they are also identical for the tumor necrosis factor (TNF) microsatellite markers which map centomeric to HLA-B 1241. This is in favor of the extension of HLA ancestral haplotypes to the MOG region.
DISCUSSION FIGURE 3 Allelic distributions of the three microsatellites in 173 unrelated healthy individuals. The sizes of the PCR
products are indicated on the x-axis, and the observed frequencies on the y-axis. the GT strand (ATATATGT to ATGTGTGT), resulting in two additional GT repeats on the longer alleles. Observed numbers of heterotygotes at the three loci (59%, 51%, and 81%) were compared to their expectations under Hardy-Weinberg equilibrium (59.6%) 5 1.2%, and 83.8%) by goodness-of-fit chi squares; no significant departures were detected. The MOG alleles at the three loci segregated in a codominant manner in each of the 10 families studied (data not shown). Alleles at the three markers form haplotypes and can be used in combination to increase the informativeness of the MOG region. Out of the 173 healthy individuals tested, only 13% were homotygous at the three loci. Maximum likelihood estimates and their support intervals, a likelihood equivalent of a confidence interval, are given in Table 1 for the 16 most frequent haplotypes, which account for more than 90% of the total frequency. It is interesting to note that alleles at loci MOGb and
Three new markers have been detected at the human MOG locus and characterized by a method combining fluorescence labeling of PCR products and use of an automated DNA sequencer. This nonradioactive method is very sensitive and efficient for typing large numbers of individuals, which is required, for example, for application in gene mapping and parentage controls. In addition, by incorporating a dye-labeled DNA size standard in each line, it allows accurate sizing of PCR products and eliminates the problem of band-shift artifacts and gel-to-gel variations f 191. All these markers were highly polymorphic, with an heterotygosity rate of 87% at the three-locus genotype level. They are specific for a chromosomal region located less than 100 kb telomeric to HLA-F 151, and will be useful for association or linkage studies with diseases for which candidate genes lie in this region. All tests presume that individuals who exhibit only one allele product at a locus are truly homozygous. This may not necessarily be correct because in PCR-based methods, “null” alleles may not be detected because of differential amplification or nonamplification caused by
280
TABLE 1.
M.-P. Roth et al.
Maximum-likelihood haplotype frequencies
estimates of the at the MOG locus
MOGa-MOGb-MOGc haplotype
Frequency (%)
interval”
126-160-122 126- 160- 130 126-160-132 126-180-144 126-180-148 126-182- 148 128-160-130 128-160-132 128-160-134 128-160-138 128-182-136 128-186-136 130-160-130 130-162-138 130-182-136 134- 160- 122
25.72 2.63 4.27 4.34 3.47 2.30 11.34 12.78 2.18 4.62 4.34 1.14 1.06 7.80 2.89 1.16
20.7-30.7 1.1-5.0 2.3-6.9 2.4-6.9 1.8-5.9 0.8-4.4 7.3-15.3 8.7-16.7 0.9-4.2 2.7-7.3 2.4-7.2 0.1-2.8 0.2-2.7 4.8-l 1.8 1.4-5.1 0.3-2.8
SUPpofi
TABLE
2.
MOG haplotypes in 84 DNAs from the HLA Workshop reference panel
MOGa-MOGb-MOGc
haplotype 126-160-122
126-160-132 126-178-136 126-178-144 126-178-148 126-180-144 126-180-148 126-182-134 126-182-136 126-182-144 126-182-148 126-184-148 128-160-130
a Supportintervals aredefined,for each haplotype frequency, as the range of that frequency in which the maximum likelihood achievable by varying one, ot all, of the other frequencies has a value greater than ee2 of the overall maximum [221.
sequence polymorphisms within the priming sequence. Such possibilities have been empirically shown to occur at the dinucleotide repeat loci due to, for instance, a single base substitution at the 3’-most position of the binding site for the primer [25], a 8-bp deletion within the priming sequence for PCR amplification {26], or preferential amplification of the smaller alleles 127). At the three loci described, frequencies of heterozygotes are well predicted from allele frequencies by the HardyWeinberg rule, which suggests that problems of allele nonamplification with these primers are unlikely. Interestingly, two primers initially designed to amplify locus MOGc (5 ‘-TTGGTTTCATCAGAAATGTGAG-3 ’ and 5 ’ GAAAGCAAMCCATGATAAAGG-3’) and to yield a PCR product of 158 bp were shown to fail to amplify the alleles with the higher molecular weights. This problem was detected by an excess of homotygotes, compared to the expectations of Hardy-Weinberg, and by instances of vertical transmission of null alleles through false homotygotes within a pedigree, being apparently inconsistent with classical Mendelian inheritance. According to the theory that the age of an allele is proportional to its frequency [28], the 126-bp allele at MOGa locus, 160-bp allele at MOGb, and 122-bp allele at MOGc are likely ancestral. It can thus be speculated that the 180-bp allele at MOGb has been generated from the 160-bp allele, and the 130-, 13%, 144-, and 148-bp alleles at MOGc generated from the 122-bp allele, or from each other by mechanisms leading to new alleles with large size differences. Similar changes, for which recombination events are one possible mechanism [29],
128-160-132
128-160-134 128-160-138 128-182-134 128-186-136 130-160-130 130-162-122 130-162-138 130-182-136 134-160-122 126-160/182-130/148 126/128-160-122/132 126/128-160-130/132 126/128-160/180-132/148 126/128-182-134/136 126/130-160/182-130/148 128/130-160-130/138 128/134-160-122/130
Cell line numbers 9008, 9020, 9026, 9031, 9038, 9050, 9051, 9052, 9057, 9061, 9092, 9093 9067 9066 9009 9086 9011, 9040,9043, 9095, 9105 9016, 9022, 9023, 9086, 9087, 9088, 9089 9025, 9030 9066 9060, 9095 9028, 9059 9028 9005, 9013, 9017, 9033, 9034, 9047, 9055, 9063, 9065, 9080, 9081, 9082, 9083, 9106 9021, 9032, 9039, 9054, 9056, 9058, 9062, 9064, 9068, 9069, 9070, 9091, 9099 9004, 9021, 9036, 9048, 9104 9003, 9042, 9075 9072, 9101 9006 9047, 9080 9010, 9037 9019 9029 9079 9002” 9007” 9045”, 9094” 9076” 907 1” 9097” 9018” 9078”
a These cell lines being heteroxygous at mote than one locus, the two haplotypes could not be determined unambiguously.
have been observed in other genomic regions 1301. Alleles in the different modes may have been generated by a different mechanism, producing small shifts of allele size through slipped-stand mispairing {3 11, and consistent with observed mutations in the CEPH pedigrees 1321. Despite the limits imposed by the small number of HLA Workshop cell lines typed, several ancestral HLA haplotypes seemed to extend to the MOG region, and more of such cases could probably be described with a larger sample size. Relationships between MOG haplotypes can be constructed under the assumption that single mutations gave rise to haplotypes that differ at just one site. Ancestral haplotypes are thus likely to be more
Polymorphisms
at the MOG Locus, Telomeric to HLA-F
281
frequent in the population than are derivative haplotypes. Haplotypes that appear to have derivative haplotypes radiating out from themselves are also more likely to be ancestral than are derivative haplotypes (331. Interestingly, MOG haplotypes carried on HLA ancestral haplotypes have these characteristics and could also represent ancestral haplotypes. The polymorphisms in the MOG region described for the first time in the present study will be useful for association and/or linkage studies with multiple sclerosis, for which the MOG gene is a candidate gene. They will also help in refining the location of the gene for hemochromatosis, which very likely lies telomeric to the HLA-A locus 1161. In addition, attempts to precisely delineate the site of crossover in chromosomes in which recombination occurred in the distal part of the HLA class I region will very likely take advantage of these newly described polymorphic markers.
ACKNOWLEDGMENTS
The authors thank the Reference Library, ICRF, London, for being the source of the ICRFc 109A2434 clone, and J. Clayton for useful discussion. They also would like to acknowledge the technical assistance of G. Enault, C. Offer, and M. T. Ribouchon. This work was supported by grants from the “Association pour la recherche sur la s&rose en plaques” (ARSEP) and from INSERM (CRE 91 10 11).
the evolution
of mammalian
genomes.
Genomics
into 26:9,
1995.
6. Jack LJW, Mather IH: Cloning and analysis of cDNA encoding bovine butyrophilin, and apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane Biol Chem 265: 14481, 1990.
during
lactation.
J
7. Kaufman J, Salomonsen
J: B-G: we know what it is, but what does it do? Immunol Today 13: 1, 1992.
8. Gardinier
MV, Amiguet P, Linington C, Matthieu JM: Myelin/oligodendrocyte glycoprotein is a unique member of the immunoglobulin superfamily. J Neurosci Res 33: 177, 1992.
9. Steinman
L: Connections and the nervous system. 7912, 1993.
between the immune system Proc Nat1 Acad Sci USA 90:
V, Lebar R, Bach MA: Oligodendrocyte10. Jewtoukoff specific autoreactive T cells using alpha/beta T cell receptor kill their target without self restriction. Proc Nat1 Acad Sci USA 86:2824, 1989. 11. Sun J, Link H, Olsson T, Xiao BG, Andersson G, Ekre HP, Linington C, Diener P: T and B cell responses to myelin-oligodendrocyte glycoprotein in multiple sclerosis. J Immunol 146:1490, 1991. 12. Kerlero de Rosbo N, Milo R, Lees MB, Burger D, Bernard CCA, Ben-Nun A: Reactivity to myelin antigens in multiple sclerosis: peripheral blood lymphocytes respond predominantly to myelin oligodendrocyte glycoprotein. J Clin Invest 92:2602, 1993.
13. Hearne CM, Ghosh S, Todd JA: Microsatellites for linkage analysis of genetic traits. TIG 8:288, 1992.
REFERENCES 1. Liningcon C, Webb M, Woodhams PL: A novel myelinassociated glycoprotein defined by a mouse monoclonal antibody. J Neuroimmunol 6:387, 1984.
2. Brunner C, Lassmann H, Waehneldt TV, Matthieu JM, Linington C: Differential ultrastructural localization of myelin basic protein, myelin/oligodendroglial glycoprotein, and 2’,3’-cyclic nucleotide 3’-phosphodiesterase the CNS of adult rats. J Neurochem 52:296, 1989.
gion and comparison with the mouse: new insights
in
3. Scolding NJ, Frith S, Linington C, Morgan BP, Campbell AK, Compston DAS: Myelin-oligodendrocyte glycoprotein (MOG) is a surface marker of oligodendrocyte maturation. J Neuroimmunol 22: 169, 1989. 4. Pham-Dinh D, Mattei MG, Nussbaum JL, Roussel G, Pontarotti P, Roeckel N, Mather IH, Artz K, Fisher Lindahl K, Dautigny A: Myelin/oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex. Proc Nat1 Acad Sci USA 90:7990, 1993. 5. Amadou C, Ribouchon MT, Mattei MG, Jenkins NA, Gilbert DJ, Copeland NG, Avoustin P, Pontarotti P: Localization of new genes and markers to the distal Part of the human major histocompatibility complex (MHC) re-
14. Weber JL, Kwited
AE, May PE, Zoghbi HY: Dinucleotide repeat polymorphism at the D6S 105 locus. Nucleic Acids Res 19:968, 1991.
15. Simon M, Le Mignon L, Fauchet R, Yaouanq J, David V, Edan G, Bourel M: A study of 609 HLA haplotypes marking for the hemochromatosis gene: (1) mapping of the gene near the HLA-A locus and characters required to define a heterozygous population and (2) hypothesis concerning the underlying cause of hemochromatosis-HLA association. Am J Hum Genet 41:89, 1987.
16. Jazwinska
EC, Lee SC, Weeb SI, Halliday JW, Powell LW: Localization of the hemochromatosis gene close to D6S105. Am J Hum Gener 53:347, 1993.
17. Lehrach H: In Davies KE, Tilghman
SM (eds): Genome Analysis, vol 1: Genetic and Physical Mapping. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, 1990.
18. Sambrook J, Fritsch EF, Maniatis
T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989.
19. Ziegle N, Diehl SR: Application ing technology for genotyping nomics 14: 1026, 1992.
of automated microsatellite
DNA sizloci. Ge-
M.-P.
282
20. Yang SY, Milford E, Hammerling U, DuPont B: Description of the reference panel of B-lymphoblastoid cell lines for factors of the HLA system: the B-cell line panel designed for the Tenth International Histocompatibility Workshop. In Dupont B (ed): Immunobiology of HLA. New York, Springer-Verlag, 1989. 21.
Edwards AWF: Likelihood. versity Press, 1984.
Cambridge,
Cambridge
Uni-
B, Briant L, Bouissou C, Stavropoulos C, 22. Crouau-Roy Pociot F, Cambon-Thomsen A, Clayton J: Tumor necrosis factor microsatellites in four European populations. Hum Immunol 38:213, 1993. 23.
Degli-Esposti MA, Leaver AL, Christiansen FT, Witt CS, Abraham LJ, Dawkins RL: Ancestral haplotypes: conserved population MHC haplotypes. Hum Immunol 34: 242, 1992.
24.
Udalova IA, Nedospasov SA, Webb GC, Chaplin DD, Turetskaya RL: Highly informative typing of the human TNF locus using six adjacent polymorphic markers. Genomics 16: 180, 1993.
25.
Koorey DJ, Bishop GA, McCaughan GW: Allele nonamplification: a source of confusion in linkage studies employing microsatellite polymorphisms. Hum Mol Genet 2:289, 1993.
26.
Callen DF, Thompson AD, Shen Y, Phillips HA, Richards RI, Mulley JC, Sutherland GR: Incidence and origin
of “null” alleles in the (AC)n microsatellite J Hum Genet 52:922, 1993.
Roth et al.
markers.
Am
27. Tully G, Sullivan KM, Gill P: Analysis of 6 VNTR loci by ‘multiplex’ PCR and automated fluorescent detection. Hum Genet 92:554, 1992. 28. Watterson GA, Guess HA: Is the most frequent the oldest? Theor Popul Biol 11: 141, 1977.
allele the
29. Wolff RK, Nakamura Y, White R: Molecular characterization of spontaneously generated new allele at a VNTR locus: no exchange of flanking DNA sequence. Genomics 3:347, 1988. 30. Fornage M, Chan L, Siest G, Boerwinkle E: Allele frequency distribution of the (TG)n(AG)m microsatellite in the apolipoprotein C-II gene. Genomics 12:63, 1992. mispairing: a 31. Levinson G, Gutman GA: Slipped-strand major mechanism for DNA sequence evolution. Mol Biol Evol 4:203, 1987. 32. Weber JL, Wong C: Mutation of human repeats. Hum Mol Genet 2:1123, 1993.
short
tandem
33. Yu CE, Oshima J, Goddard KAB, Miki T, Nakura J, Ogihara T, Poot M, Hoehn H, Fraccaro M, Piussan C, Martin GM, Schellenberg GD, Wijsman EM: Linkage disequilibrium and haplotype studies of chromosome 8p 11.1-2 1.1 markers and Werner syndrome. Am J Hum Genet 551356, 1994.
Three Highly Polymorphic Microsatellites the Human Myelin Oligodendrocyte Glycoprotein Locus, 100 kb Telomeric to HLA-F Characterization and Relation to HLA Haplotypes
at
Marie-Paule Roth, Laurence Dolbois, Nicolas Borot, Claire Amadou, Michel Clanet, Pierre Pontarotti, and HUne Coppin ABSTRACT:
The MOG locus, located on chromosomal bands 6~2 1.3-p22 and mapped about 100 kb telomeric to HLA-F, was isolated from cosmid ICRFc109A2434 and shown to contain three microsatellites. These CArepeat polymorphic markers were characterized in a sample of 173 healthy unrelated individuals and 84 DNAs from the HLA Workshop reference panel, by a method combining fluorescence labeling of PCR products and use of an automated DNA sequencer. For the three markers, frequencies of heterozygotes are well predicted from allele frequencies by the Hardy-Weinberg rule, which suggests that problems of allele nonamplification are unlikely.
Typing of cell lines homozygous in the HLA region allowed unambiguous definition of 81 HLA-MOG haplotypes and showed that several HLA ancestral haplotypes extended to the MOG region. The high degree of polymorphism (59%, 51%, and 81% at the three loci, respectively, and 87% at the haplotype level) makes these new markers informative for association or linkage studies with diseases such as hemochromatosis or multiple sclerosis, and for studies aimed at precisely delineating the site of crossover in chromosomes in which recombination occurred in the distal part of the HLA class I region. Human Immunology 43, 276-282 (1995)
ABBREVIATIONS myelin MOG
PCR
oligodendrocyte
glycoprotein
polymerase
chain reaction
INTRODUCTION The myelin oligodendrocyte glycoprotein (MOG) locus, encoding a component involved in the completion and maintenance of the myelin sheath [l-3}, has been mapped to chromosomal region 6~2 1.3-p22 [41 and shown to be about 100 kb telomeric to HLA-F [5]. The N-terminal extracellular domain of MOG has significant sequence homologies with two nonmyelin proteins: bo-
From the Federatiw Institute of Reward, INSERMICNRSIUPS, CHU Pnrpan, Todouse, France. Addrers reprint requests to Dr. M.-P. Roth, CIGH, CNRS VPR 8291, CHU Purpan, 31300 Toulouse, France. Received Dew&r I, 1994; accepted Fehuuty 27, 1995. Human Immunology 43, 276-282 (1995) 0 American Society for Histocompatibility
vine butyrophilin, expressed in the mammary gland during lactation and facilitating the interaction between cytoplasmic lipid droplets and the apical membrane 161, and chicken B-G antigen, encoded by a gene mapping to the major histocompatibility complex and associated with an adjuvant effect on the immune response E7-j. MOG, butyrophilin, and the B-G antigen share an immunoglobulin-like domain characteristic of members of the immunoglobulin superfamily 181. As suggested by Steinman [9] and based on the observation of a MOGspecific cytotoxic T-cell clone without self-restriction [lo], MOG may have an unforeseen immunologic status within the central nervous system, providing, for in0 198~8859/95/$9.50
and Immunogenetics,
1995
SSDI 019%8859(95)0039-7
Polymorphisms
277
at the MOG Locus, Telomeric to HLA-F
stance, a rudimentary molecular framework for presentation of pathogens to the immune system. A majority of patients with multiple sclerosis have antibodies against MOG in their sera and cerebrospinal fluid I1 11 and a predominant T-cell reactivity to this antigen [ 121; MOG may, therefore, be implicated in the pathogenesis of this inflammatory disease of the central nervous system characterized by localized myelin destruction. Simple repetitive elements, or microsatellites, located in the proximity of candidate genes for disease susceptibility are informative markers for association or linkage studies 1137. However, such informative markers telomerit to HLA-F, i.e., in the distal part of the major histocompatibility complex, are lacking. The closest microsatellite identified to date, DbS105 [14], has been localized at more than 1000 kb from HLA-F 151. There is an urgent need for such markers to be identified in order to examine the potential role of the MOG gene in susceptibility to multiple sclerosis. These markers would also help in the refining of the location of the gene for hemochromatosis, a common disorder of iron metabolism inherited as an autosomal recessive trait and characterized by progressive iron storage in parenchymal cells of major organs, primarily the liver, pancreas, and heart. The hemochromatosis gene is known to be linked to HLA-A 1151. It seems now more telomeric than the HLA-A locus {16], but its precise location has not been determined because of a lack of highly informative markers for this region. Finally, these markers would be essential for studies aimed at precisely delineating the site of crossover in chromosomes in which recombination occurred in the distal part of the HLA class I region. The aim of the present study was therefore to isolate microsatellites within the MOG region, and to characterize these markers in a sample of 173 unrelated individuals and 84 DNAs from the HLA Workshop reference panel of B-lymphoblastoid cell lines.
30 minutes at 50°C. Three X&Z fragments of 1.3, 2, and 5.6 kb, respectively, hybridized to the (CA),, probe. The relevant fragments were subcloned into pGEM-3Z Vector (Promega) and sequenced on an ABI 373 DNA Sequencing System using the Taq polymerase dye terminator sequencing chemistry. The sequences flanking the repeats were used to design PCR primers.
MATERIALS
GmATATAAATATATATGTGTGTGTGTGTGTGTGTGTGTAC~GA~~CATCCAGTCT
PCR conditions and automated product analysis. In each case, 200 ng of genomic DNA were amplified in a total volume of 20 ~1 using 0.5 U Taq DNA polymerase (Promega). Oligonucleotide primer sequences are given in Fig. 1. Each reaction contained 10 mM Tris-HCI pH 9, 50 mM KCI, 1.5 mM MgCl,, 0.2 mM each dNTP, and 0.5 p,M each primer. Oligonucleotides MOGll, MOG2 1, and MOG3 1 were labeled with the fluorescent dyes “JOE, ” “TAMRA,” and “FAM” (Applied Biosys1 Nucleotide sequences of the three (CA), microsatellite-containing regions. Arrows show the polarity and position of the six primers used for PCR amplification. Primer sequences are MOG 11 (5 ‘GTACAGCCAAAAGGTGACATC-3’), MOG12 (5’-ACCCTGTATTTGTGAGCGC-J)), MOG2 1 (5’FIGURE
TTCACTGCCACATCCTCA-3’), MOG22 (5’-ATGGTTTTATCTTTCTCTTAG-3’), MOG3 1 (5’-GAAATGTGAGAATAAAGGAGA-37, and MOG32 (5’-GATAAAGGGGAACTACTACA-3’). MOGa
GTACAGCCAAAAGGTGACATCTCCmCTATAT~~ATA~AGACA~GA~AC~GCT + MOGI 1 TATTCACTAGGACCAAGCACAGGTGTGTGTGTGTGTGTGTGTGTGTG~CGCTCAC~ < MOG12 TACAGGGT
MOGb
MOG21
AND
METHODS
isolation of the microsatellites. Cosmid clone ICRFc109A2434, containing a 45-kb insert which includes the entire MOG gene, was isolated from a chromosome 6 library constructed in Lawrist 4 [17} by hybridization with a 187-bp probe specific from the MOG immunoglobulin-like domain. This probe was obtained by polymerase chain reaction (PCR) amplification of human genomic DNA with primers designed upon the rat cDNA sequence 181. The cosmid was digested with different restriction enzymes and screened for simple repeat sequences with two (CA),, and (CT),, oligonucleotides. Transfers and hybridizations were performed with standard techniques 1183. Filters were washed in 2 X SSC; 0.1% SDS for 30 minutes at room temperature, and for
CAAGATTCAGAGAATTAAAACCTAAGAGAAAGATAAAACCAT < MOG22
MOGc
GAAATGTGAGAATAAAGGAGACACTCTCTAAGATCTCTTCAT > MOG31
CATGTAGTAGTTCCCCTTTATC MOG32
M.-P. Roth et al.
278
terns), respectively. PCR was carried out in a GeneAmp PCR System 9600 (Perkin-Elmer). Samples were initially denaturated at 94°C for 1 minute 30 seconds, before undergoing 25 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 30 seconds. Amplification products were loaded onto 6% denaturing polyacrylamide gels with an internal lane standard labeled with the “ROX” dye (Applied Biosystems), and analyzed on an ABI 373 DNA Sequencing System 1191. Sizing of the products was performed automatically by 672 GENESCAN Analysis software using the Southern Local method to establish a curve of best fit through the fragments of the internal standard in each lane. DNA samples. The length variability of the three microsatellites was ascertained in 173 unrelated healthy Caucasian individuals. Sizing of the three microsatellites was also performed in 50 members of 10 families to follow inheritance patterns, and on 84 DNAs from the largely available HLA Workshop reference panel of B-lymphoblastoid cell lines f201 to provide typing references. at each locus were Statistic analysis. Allele frequencies obtained by gene counting, assuming two alleles per locus. Observed numbers of heterozygotes were compared to their expectations under Hardy-Weinberg equilibrium by a goodness-of-fit chi square. Without family studies, haplotypes formed by the three polymorphisms can only be inferred from phenotypic data when individuals are heterozygous at one locus or none at all. In most cases, some probabilistic interpretation is required. Maximum likelihood estimates of the frequencies and support limits for all possible haplotypes were therefore computed 12 1, 221.
n n
Lane 21: MOGc:
132 bp/146
bp haterozygote
Lane 21: MOGb:
160 bp/l60
bp heterozygote
n n
RESULTS The region surrounding the human MOG locus was isolated from cosmid ICRFc109A2434 and shown to contain three microsatellites, which we designated MOGa, MOGb, and MOGc. These microsatellites consist of 13, 11, and 15 repeats of the CA/GT dinucleotide, respectively. MOGa was located in the second intron of the gene, at position 898 relative to exon 2/intron 2 splicing site, whereas MOGb and MOGc were both upstream of the MOG transcription start site. The sequences of the three sets of primers designed to measure variations in the number of CA repeats are given in Fig. 1. Amplification of the cosmid DNA by these primers yielded PCR products of 128, 160, and 132 bp, respectively. An example of the electrophoregrams generated by the automated scanning system is shown in Fig. 2. Allelic distributions for each polymorphism are given in Fig. 3. In the sample of 346 chromosomes from healthy unrelated individuals, six alleles were identified at the MOGa locus, 10 at MOGb, and 11 at MOGc. Examination of the frequency distributions of MOGb and MOGc indicates that they are multimodal, with a gap between alleles of 166 and 178 bp at the MOGb locus, and between alleles of 122 and 130 bp at MOGc. The presence of different modes, each presenting different degrees of variability, may be the result of the mechanisms by which new alleles were produced and may suggest that more than one molecular mechanism is acting. The exact repeat numbers of the CA/GT sequence corresponding to most of these alleles was determined by sequencing. It was noticed that alleles of size greater than 166 bp at locus MOGb carried some minor sequence variation in the region adjacent to the repeat on
Lane 21: MOGa: Lane 21: GS-2500
126 bp1128 bp heterozygote size standard
FIGURE 2 Electrophoregram generated by an individual heterotygote at the three MOG loci. Lengths of the GS-2500 standard fragments are 94, 109, 116, 172, and 186 bp.
size
Polymorphisms
279
at the MOG Locus, Telomeric to HLA-F
MOG a
MOG b
MOG c
MOGc are positively associated (Spearman rank correlation coefficient r = 0.77; p < 0.001); that is, large alleles at MOGb aggregate with large-sized alleles at MOGc, and so do small-sized alleles. This does not appear to be the case for alleles at loci MOGa and MOGb (Y = 0.13; N.S.). The positive size association of alleles at loci MOGb and MOGc may indicate that recombination between these loci is either absent or occurs at a low rate. Results of the typing of the 84 DNAs from the HLA Workshop reference panel of B-lymphoblastoid cell lines are given in Table 2. Because most of these cell lines were homotygous in the HLA region, they were rarely heterozygous at more than one MOG locus. A total of 8 1 haplotypes could therefore be unambiguously defined, 23 of which were distinct. These haplotypes included the same alleles as those detected in the sample of 173 unrelated individuals. Several cell lines sharing at least the telomeric part of well-defined HLA ancestral haplotypes [231 also share the MOG haplotype. For instance, cells 9013,9017, 9033, 9034, 9065,9081,9082, and 9083 are HLA A3-C7-B7 and MOG128- 160- 130; cells 9022, 9023, 9086, 9087, and 9088 are HLA Al-C7-B8 and MOG126-180148; and cells 9038 and 9061 are HLA A2-C7-B 18 and MOG126- 160-122. Except for cells 9022 and 9033, they are also identical for the tumor necrosis factor (TNF) microsatellite markers which map centomeric to HLA-B 1241. This is in favor of the extension of HLA ancestral haplotypes to the MOG region.
DISCUSSION FIGURE 3 Allelic distributions of the three microsatellites in 173 unrelated healthy individuals. The sizes of the PCR
products are indicated on the x-axis, and the observed frequencies on the y-axis. the GT strand (ATATATGT to ATGTGTGT), resulting in two additional GT repeats on the longer alleles. Observed numbers of heterotygotes at the three loci (59%, 51%, and 81%) were compared to their expectations under Hardy-Weinberg equilibrium (59.6%) 5 1.2%, and 83.8%) by goodness-of-fit chi squares; no significant departures were detected. The MOG alleles at the three loci segregated in a codominant manner in each of the 10 families studied (data not shown). Alleles at the three markers form haplotypes and can be used in combination to increase the informativeness of the MOG region. Out of the 173 healthy individuals tested, only 13% were homotygous at the three loci. Maximum likelihood estimates and their support intervals, a likelihood equivalent of a confidence interval, are given in Table 1 for the 16 most frequent haplotypes, which account for more than 90% of the total frequency. It is interesting to note that alleles at loci MOGb and
Three new markers have been detected at the human MOG locus and characterized by a method combining fluorescence labeling of PCR products and use of an automated DNA sequencer. This nonradioactive method is very sensitive and efficient for typing large numbers of individuals, which is required, for example, for application in gene mapping and parentage controls. In addition, by incorporating a dye-labeled DNA size standard in each line, it allows accurate sizing of PCR products and eliminates the problem of band-shift artifacts and gel-to-gel variations f 191. All these markers were highly polymorphic, with an heterotygosity rate of 87% at the three-locus genotype level. They are specific for a chromosomal region located less than 100 kb telomeric to HLA-F 151, and will be useful for association or linkage studies with diseases for which candidate genes lie in this region. All tests presume that individuals who exhibit only one allele product at a locus are truly homozygous. This may not necessarily be correct because in PCR-based methods, “null” alleles may not be detected because of differential amplification or nonamplification caused by
280
TABLE 1.
M.-P. Roth et al.
Maximum-likelihood haplotype frequencies
estimates of the at the MOG locus
MOGa-MOGb-MOGc haplotype
Frequency (%)
interval”
126-160-122 126- 160- 130 126-160-132 126-180-144 126-180-148 126-182- 148 128-160-130 128-160-132 128-160-134 128-160-138 128-182-136 128-186-136 130-160-130 130-162-138 130-182-136 134- 160- 122
25.72 2.63 4.27 4.34 3.47 2.30 11.34 12.78 2.18 4.62 4.34 1.14 1.06 7.80 2.89 1.16
20.7-30.7 1.1-5.0 2.3-6.9 2.4-6.9 1.8-5.9 0.8-4.4 7.3-15.3 8.7-16.7 0.9-4.2 2.7-7.3 2.4-7.2 0.1-2.8 0.2-2.7 4.8-l 1.8 1.4-5.1 0.3-2.8
SUPpofi
TABLE
2.
MOG haplotypes in 84 DNAs from the HLA Workshop reference panel
MOGa-MOGb-MOGc
haplotype 126-160-122
126-160-132 126-178-136 126-178-144 126-178-148 126-180-144 126-180-148 126-182-134 126-182-136 126-182-144 126-182-148 126-184-148 128-160-130
a Supportintervals aredefined,for each haplotype frequency, as the range of that frequency in which the maximum likelihood achievable by varying one, ot all, of the other frequencies has a value greater than ee2 of the overall maximum [221.
sequence polymorphisms within the priming sequence. Such possibilities have been empirically shown to occur at the dinucleotide repeat loci due to, for instance, a single base substitution at the 3’-most position of the binding site for the primer [25], a 8-bp deletion within the priming sequence for PCR amplification {26], or preferential amplification of the smaller alleles 127). At the three loci described, frequencies of heterozygotes are well predicted from allele frequencies by the HardyWeinberg rule, which suggests that problems of allele nonamplification with these primers are unlikely. Interestingly, two primers initially designed to amplify locus MOGc (5 ‘-TTGGTTTCATCAGAAATGTGAG-3 ’ and 5 ’ GAAAGCAAMCCATGATAAAGG-3’) and to yield a PCR product of 158 bp were shown to fail to amplify the alleles with the higher molecular weights. This problem was detected by an excess of homotygotes, compared to the expectations of Hardy-Weinberg, and by instances of vertical transmission of null alleles through false homotygotes within a pedigree, being apparently inconsistent with classical Mendelian inheritance. According to the theory that the age of an allele is proportional to its frequency [28], the 126-bp allele at MOGa locus, 160-bp allele at MOGb, and 122-bp allele at MOGc are likely ancestral. It can thus be speculated that the 180-bp allele at MOGb has been generated from the 160-bp allele, and the 130-, 13%, 144-, and 148-bp alleles at MOGc generated from the 122-bp allele, or from each other by mechanisms leading to new alleles with large size differences. Similar changes, for which recombination events are one possible mechanism [29],
128-160-132
128-160-134 128-160-138 128-182-134 128-186-136 130-160-130 130-162-122 130-162-138 130-182-136 134-160-122 126-160/182-130/148 126/128-160-122/132 126/128-160-130/132 126/128-160/180-132/148 126/128-182-134/136 126/130-160/182-130/148 128/130-160-130/138 128/134-160-122/130
Cell line numbers 9008, 9020, 9026, 9031, 9038, 9050, 9051, 9052, 9057, 9061, 9092, 9093 9067 9066 9009 9086 9011, 9040,9043, 9095, 9105 9016, 9022, 9023, 9086, 9087, 9088, 9089 9025, 9030 9066 9060, 9095 9028, 9059 9028 9005, 9013, 9017, 9033, 9034, 9047, 9055, 9063, 9065, 9080, 9081, 9082, 9083, 9106 9021, 9032, 9039, 9054, 9056, 9058, 9062, 9064, 9068, 9069, 9070, 9091, 9099 9004, 9021, 9036, 9048, 9104 9003, 9042, 9075 9072, 9101 9006 9047, 9080 9010, 9037 9019 9029 9079 9002” 9007” 9045”, 9094” 9076” 907 1” 9097” 9018” 9078”
a These cell lines being heteroxygous at mote than one locus, the two haplotypes could not be determined unambiguously.
have been observed in other genomic regions 1301. Alleles in the different modes may have been generated by a different mechanism, producing small shifts of allele size through slipped-stand mispairing {3 11, and consistent with observed mutations in the CEPH pedigrees 1321. Despite the limits imposed by the small number of HLA Workshop cell lines typed, several ancestral HLA haplotypes seemed to extend to the MOG region, and more of such cases could probably be described with a larger sample size. Relationships between MOG haplotypes can be constructed under the assumption that single mutations gave rise to haplotypes that differ at just one site. Ancestral haplotypes are thus likely to be more
Polymorphisms
at the MOG Locus, Telomeric to HLA-F
281
frequent in the population than are derivative haplotypes. Haplotypes that appear to have derivative haplotypes radiating out from themselves are also more likely to be ancestral than are derivative haplotypes (331. Interestingly, MOG haplotypes carried on HLA ancestral haplotypes have these characteristics and could also represent ancestral haplotypes. The polymorphisms in the MOG region described for the first time in the present study will be useful for association and/or linkage studies with multiple sclerosis, for which the MOG gene is a candidate gene. They will also help in refining the location of the gene for hemochromatosis, which very likely lies telomeric to the HLA-A locus 1161. In addition, attempts to precisely delineate the site of crossover in chromosomes in which recombination occurred in the distal part of the HLA class I region will very likely take advantage of these newly described polymorphic markers.
ACKNOWLEDGMENTS
The authors thank the Reference Library, ICRF, London, for being the source of the ICRFc 109A2434 clone, and J. Clayton for useful discussion. They also would like to acknowledge the technical assistance of G. Enault, C. Offer, and M. T. Ribouchon. This work was supported by grants from the “Association pour la recherche sur la s&rose en plaques” (ARSEP) and from INSERM (CRE 91 10 11).
the evolution
of mammalian
genomes.
Genomics
into 26:9,
1995.
6. Jack LJW, Mather IH: Cloning and analysis of cDNA encoding bovine butyrophilin, and apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane Biol Chem 265: 14481, 1990.
during
lactation.
J
7. Kaufman J, Salomonsen
J: B-G: we know what it is, but what does it do? Immunol Today 13: 1, 1992.
8. Gardinier
MV, Amiguet P, Linington C, Matthieu JM: Myelin/oligodendrocyte glycoprotein is a unique member of the immunoglobulin superfamily. J Neurosci Res 33: 177, 1992.
9. Steinman
L: Connections and the nervous system. 7912, 1993.
between the immune system Proc Nat1 Acad Sci USA 90:
V, Lebar R, Bach MA: Oligodendrocyte10. Jewtoukoff specific autoreactive T cells using alpha/beta T cell receptor kill their target without self restriction. Proc Nat1 Acad Sci USA 86:2824, 1989. 11. Sun J, Link H, Olsson T, Xiao BG, Andersson G, Ekre HP, Linington C, Diener P: T and B cell responses to myelin-oligodendrocyte glycoprotein in multiple sclerosis. J Immunol 146:1490, 1991. 12. Kerlero de Rosbo N, Milo R, Lees MB, Burger D, Bernard CCA, Ben-Nun A: Reactivity to myelin antigens in multiple sclerosis: peripheral blood lymphocytes respond predominantly to myelin oligodendrocyte glycoprotein. J Clin Invest 92:2602, 1993.
13. Hearne CM, Ghosh S, Todd JA: Microsatellites for linkage analysis of genetic traits. TIG 8:288, 1992.
REFERENCES 1. Liningcon C, Webb M, Woodhams PL: A novel myelinassociated glycoprotein defined by a mouse monoclonal antibody. J Neuroimmunol 6:387, 1984.
2. Brunner C, Lassmann H, Waehneldt TV, Matthieu JM, Linington C: Differential ultrastructural localization of myelin basic protein, myelin/oligodendroglial glycoprotein, and 2’,3’-cyclic nucleotide 3’-phosphodiesterase the CNS of adult rats. J Neurochem 52:296, 1989.
gion and comparison with the mouse: new insights
in
3. Scolding NJ, Frith S, Linington C, Morgan BP, Campbell AK, Compston DAS: Myelin-oligodendrocyte glycoprotein (MOG) is a surface marker of oligodendrocyte maturation. J Neuroimmunol 22: 169, 1989. 4. Pham-Dinh D, Mattei MG, Nussbaum JL, Roussel G, Pontarotti P, Roeckel N, Mather IH, Artz K, Fisher Lindahl K, Dautigny A: Myelin/oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex. Proc Nat1 Acad Sci USA 90:7990, 1993. 5. Amadou C, Ribouchon MT, Mattei MG, Jenkins NA, Gilbert DJ, Copeland NG, Avoustin P, Pontarotti P: Localization of new genes and markers to the distal Part of the human major histocompatibility complex (MHC) re-
14. Weber JL, Kwited
AE, May PE, Zoghbi HY: Dinucleotide repeat polymorphism at the D6S 105 locus. Nucleic Acids Res 19:968, 1991.
15. Simon M, Le Mignon L, Fauchet R, Yaouanq J, David V, Edan G, Bourel M: A study of 609 HLA haplotypes marking for the hemochromatosis gene: (1) mapping of the gene near the HLA-A locus and characters required to define a heterozygous population and (2) hypothesis concerning the underlying cause of hemochromatosis-HLA association. Am J Hum Genet 41:89, 1987.
16. Jazwinska
EC, Lee SC, Weeb SI, Halliday JW, Powell LW: Localization of the hemochromatosis gene close to D6S105. Am J Hum Gener 53:347, 1993.
17. Lehrach H: In Davies KE, Tilghman
SM (eds): Genome Analysis, vol 1: Genetic and Physical Mapping. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, 1990.
18. Sambrook J, Fritsch EF, Maniatis
T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989.
19. Ziegle N, Diehl SR: Application ing technology for genotyping nomics 14: 1026, 1992.
of automated microsatellite
DNA sizloci. Ge-
M.-P.
282
20. Yang SY, Milford E, Hammerling U, DuPont B: Description of the reference panel of B-lymphoblastoid cell lines for factors of the HLA system: the B-cell line panel designed for the Tenth International Histocompatibility Workshop. In Dupont B (ed): Immunobiology of HLA. New York, Springer-Verlag, 1989. 21.
Edwards AWF: Likelihood. versity Press, 1984.
Cambridge,
Cambridge
Uni-
B, Briant L, Bouissou C, Stavropoulos C, 22. Crouau-Roy Pociot F, Cambon-Thomsen A, Clayton J: Tumor necrosis factor microsatellites in four European populations. Hum Immunol 38:213, 1993. 23.
Degli-Esposti MA, Leaver AL, Christiansen FT, Witt CS, Abraham LJ, Dawkins RL: Ancestral haplotypes: conserved population MHC haplotypes. Hum Immunol 34: 242, 1992.
24.
Udalova IA, Nedospasov SA, Webb GC, Chaplin DD, Turetskaya RL: Highly informative typing of the human TNF locus using six adjacent polymorphic markers. Genomics 16: 180, 1993.
25.
Koorey DJ, Bishop GA, McCaughan GW: Allele nonamplification: a source of confusion in linkage studies employing microsatellite polymorphisms. Hum Mol Genet 2:289, 1993.
26.
Callen DF, Thompson AD, Shen Y, Phillips HA, Richards RI, Mulley JC, Sutherland GR: Incidence and origin
of “null” alleles in the (AC)n microsatellite J Hum Genet 52:922, 1993.
Roth et al.
markers.
Am
27. Tully G, Sullivan KM, Gill P: Analysis of 6 VNTR loci by ‘multiplex’ PCR and automated fluorescent detection. Hum Genet 92:554, 1992. 28. Watterson GA, Guess HA: Is the most frequent the oldest? Theor Popul Biol 11: 141, 1977.
allele the
29. Wolff RK, Nakamura Y, White R: Molecular characterization of spontaneously generated new allele at a VNTR locus: no exchange of flanking DNA sequence. Genomics 3:347, 1988. 30. Fornage M, Chan L, Siest G, Boerwinkle E: Allele frequency distribution of the (TG)n(AG)m microsatellite in the apolipoprotein C-II gene. Genomics 12:63, 1992. mispairing: a 31. Levinson G, Gutman GA: Slipped-strand major mechanism for DNA sequence evolution. Mol Biol Evol 4:203, 1987. 32. Weber JL, Wong C: Mutation of human repeats. Hum Mol Genet 2:1123, 1993.
short
tandem
33. Yu CE, Oshima J, Goddard KAB, Miki T, Nakura J, Ogihara T, Poot M, Hoehn H, Fraccaro M, Piussan C, Martin GM, Schellenberg GD, Wijsman EM: Linkage disequilibrium and haplotype studies of chromosome 8p 11.1-2 1.1 markers and Werner syndrome. Am J Hum Genet 551356, 1994.