Three Novel Activating Mutations in the Calcium-Sensing Receptor Responsible for Autosomal Dominant Hypocalcemia

Molecular Genetics and Metabolism 71, 591–598 (2000) doi:10.1006/mgme.2000.3096, available online at http://www.idealibrary.com on

Three Novel Activating Mutations in the Calcium-Sensing Receptor Responsible for Autosomal Dominant Hypocalcemia Yvette P. Conley,* ,1 David N. Finegold,* ,† David G. Peters,* Jennifer S. Cook,‡ Daniel S. Oppenheim,§ and Robert E. Ferrell* *Department of Human Genetics, Graduate School of Public Health, and †Department of Pediatrics, School of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania; ‡Blank Children’s Hospital, Des Moines, Iowa; and §Maine Medical Center, Division of Endocrinology, Portland, Maine Received September 1, 2000

Autosomal dominant hypocalcemia (ADH) is an endocrine disorder characterized by varying levels of hypocalcemia and hyperphosphatemia with inappropriately low levels of parathyroid hormone (PTH). Clinically, a patient with ADH may be asymptomatic or experience neuromuscular symptoms ranging from mild parasthesias to convulsions with an age of onset ranging from early infancy into adulthood. In 1994, linkage of ADH to chromosome 3q13, which harbors the gene for the calcium ionsensing receptor (CASR), was demonstrated (1). Subsequently, missense-activating mutations in the CASR have been identified, N118K, T151M, A116T, Q681H, F806S, C851S, L773R, E127A, F788C, F612S, F128L, E191K, and K47N (2–7) and one large activating in-frame deletion in the cytoplasmic tail (8). The CASR was first characterized from bovine parathyroid cells (9). The structural homology it shares with other G-protein-coupled receptors includes an extracellular domain, a hydrophobic seven transmembrane domain, and an intracellular tail. The CASR shares the greatest level of homology with the metabotropic glutamate receptors. The extracellular domain participates in ligand binding where calcium ions most likely interact with clusters of negatively charged aspartate and glutamate residues. The intracellular loops are presumed to participate in G-protein interaction (2). We identified three families with similar phenotypes of ADH. Hypocalcemia was mild and persistent. Clinical symptoms were rare and members with ADH from each family showed no evidence of skeletal abnormalities. Prior to the identification of

We report three novel activating mutations in the calcium-sensing receptor (CASR) that are responsible for autosomal dominant hypocalcemia (ADH) in three unrelated families. Each mutation involves a missense substitution resulting in a nonconservative amino acid alteration, P221L, E228Q, and Q245R. These mutations were observed in affected family members, but not in unaffected family members or in unrelated control samples. All three mutations are clustered in the extracellular domain of the CASR in a region dominated by negatively charged amino acids. Each mutant and wild-type receptor was expressed in Cos-1 cells. A luciferase reporter gene assay was utilized to detect the level of receptor activity by utilizing a protein kinase C-activated promoter to drive the production of luciferin, the reporter gene product. All three mutant receptors exhibited an increased sensitivity to calcium at all concentrations tested when compared to the wild-type receptor, supporting the hypothesis that these are activating mutations and are responsible for the ADH phenotype in these families. The data presented in this study suggest the importance of this highly negatively charged region of the extracellular domain in normal CASR function. © 2000 Academic Press

Key Words: calcium-sensing receptor; CASR; autosomal dominant hypocalcemia.

1

To whom correspondence should be addressed at University of Pittsburgh, Department of Human Genetics, 130 Desoto Street, A300 Crabtree Hall; Pittsburgh, PA 15261. Fax: (412) 624-8521. E-mail: [email protected]. 591

1096-7192/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

592

CONLEY ET AL.

TABLE 1 Novel Primer Sequences Derived from Intronic Sequence Provided by NPS Pharmaceuticals and PCR Information for SSCP and CFLP Techniques Exon

Sequence (5⬘–3⬘)

1

FOR:AGCAGCGCGCTGTGGAGTCG REV:TACAAATCGCGTGCCCAAAC FOR:AGAGAAGAGATTGGCAGATTAGGCC REV:TCCCTTGCCCTGGAGAGACGGCAGA FOR:AGCTTCCCATTTTCTTCCACTTCTT REV:CCCGTCTGAGAAGGCTTGAGTACCT FOR:ACTCATTCACCATGTTCTTGGTTCT REV:GAATTCCCGGAAGCCTGGGATCTGC FOR:GCCATGCCTCAGTACTTCCACCTGG REV:CCCAACTCTGCTTTATTATACAGCA FOR:GGCTTGTACTCATTCTTTGCTCCTC REV:GACATCTGGTTTTCTGATGGACAGC FOR:CAAGGACCTCTGGACCTCCCTTTGC REV:GACCAAGCCCTGCACAGTCCCCAAG FOR:AAGTGCCCAGATGACTTCTGGTCCA REV:GGTAGGAGAGCTCTCGGTTGGTGGC FOR:GGATCCCGTGGAGCCTCCAAGGCTG REV:TTCCGCAACACACCCATTGTCAAGG FOR:CCATGGCGTTCTTCTGAGGCTCATC REV:GCAACGTCTCCGAAGCGGTCCAGCA FOR:CAGAAGGTCATCTTTGGCAGCGGCA REV:TCTTCCTCAGAGGAAAGGAGTCTGG

2 3 4a 4b 5 6 7a 7b 7c 7d

the etiology of the disorder, members of each family who demonstrated the ADH phenotype received treatment for hypocalcemia, which had no effect on plasma calcium. Knowledge that the etiology of their ADH was due to a CASR-activating mutation led to discontinuation of therapy. Mutation and functional studies were performed and the gain of function nature of the mutations was confirmed. SUBJECTS AND METHODS Collection of Samples Members from three unrelated families with ADH were recruited under protocols approved by the University of Pittsburgh Institutional Review Board and written informed consent was obtained from all participants or their guardians. The diagnosis of ADH was based on biochemical evidence of lower than normal serum calcium levels and PTH levels that were low given plasma calcium levels. Genomic DNA was isolated from peripheral blood (10). Mutation Detection and Sequencing Single-strand conformational polymorphism (SSCP) and the cleavase fragment length polymorphism

Size (bp)

Annealing Temperature (°C)

192

55

412

55

382

55

323

54

300

54

312

54

289

56

318

56

409

57

378

57

392

55

(CFLP) methods of mutation detection were used to screen exonic regions of the CASR in affected and unaffected family members. These are complementary methods, which detect sequence variation based on DNA secondary structure. Both are PCR based and the primers used for amplification, the expected fragment size, and the annealing temperature for each exon are summarized in Table 1. SSCP was performed as described by Orita et al. (11). The CFLP was performed using the CFLP powerscan kit (Life Technologies, Rockville, MD). Exons containing unique conformers were sequenced from three affected and three unaffected members from each family using the Dye Terminator cycle sequencing ready reaction kit (Perkin-Elmer, Foster City, CA) and analyzed using an ABI377 automated sequencer. In Vitro Functional Assays of Wild-Type and Mutant Receptors Site-directed mutagenesis using the Altered sites II system (Promega, Madison, WI) was employed to introduce each mutation into a wild-type CASR cDNA clone provided by NPS Pharmaceuticals, Inc. (Salt Lake City, UT). Each mutant receptor was verified by directly sequencing the region containing

ACTIVATING MUTATIONS IN THE CASR

the mutation. The mutant and wild-type cDNA were cloned into the pcDNA1.1 Amp vector (Invitrogen, Carlsbad, CA). Cos-1 cells used for the functional assays were obtained from American Type Culture Collection (Manassas, VA). The Transfectam system (Promega) was used for cotransfection of the expression, control, and reporter constructs. The reporter construct utilized in this project was a protein kinase C-responsive promoter linked to a firefly luciferase reporter (12) and luciferin proteins encoded by this reporter were detected in a luciferase assay. Dr. Marvin Gershengorn of Cornell University (New York, NY) (13) provided this construct. The control vector, pRL-SV40 (Promega), constitutively produces renilla luciferin protein in Cos-1 cells. The activity of the cotransfected control vector is used as an internal control to normalize the activity of the reporter to minimize experimental variability that can result from differences in cell viability or transfection efficiency. Six transfection experiments were performed for each of five calcium concentrations and the results averaged. The transfected cells were cultured for 48 h in DMEM with 10% FBS, washed, and then cultured for 6 h in SMEM, to reduce the amount of luciferin protein that accumulated due to chronic calcium exposure in the DMEM. The cells were exposed for 5 min to calcium chloride concentrations of 0.5, 1.0, 1.5, 2.0, and 5.0 mM and lysed. The amount of firefly and renilla luciferase activities was measured using the Dual Luciferase Assay (Promega) and a luminometer (Turner Design, Sunnyvale, CA). The mean values from six independent cultures for each calcium concentration were compared by a paired t test where a P ⬍ 0.05 was considered significant. RESULTS Clinical Data Three families composed of three generations of living affected family members with autosomal dominant hypocalcemia were identified for mutation analysis (Fig. 1). The mean values of biochemical parameters for affected family members from each family are summarized in Table 2. The proband in Family A presented at 2 months of age and was referred to the endocrine clinic at Children’s Hospital of Pittsburgh with a history of hypocalcemia since Day 1 of age. Physical exam noted no signs of neuromuscular irritability, tetany, seizures, or dysmorphic features. A remarkable family

593

history was noted. The proband’s mother had a history of hypocalcemia since early childhood, with hypocalcemic seizures at ages 3– 4 and 13–14 years during intercurrent illness. The proband in Family B presented at 6 years of age to the Pediatric Endocrinology Clinic at Blank Children’s Hospital with a history of hypocalcemia since 4.5 years of age. Initial serum calcium was determined due to the diagnosis of hypocalcemia in her mother. She had been treated with calcium glubionate for 6 months but has had no treatment for 1 year, having no symptoms of hypocalcemia. Physical exams noted no abnormalities. The proband in Family C presented to the endocrinology clinic at Maine Medical Center and was originally diagnosed with symptomatic hypocalcemia at age 20. Her two daughters were both found to be hypocalcemic at ages 6 and 5, respectively, with signs and symptoms of hypocalcemia. One daughter has had several episodes of nephrolithiasis while on high-dose calcium and vitamin D therapy. The proband’s mother and her niece both have had documented hypocalcemia and subsequently nephrolithiasis while being treated with calcium and vitamin D. Mutation Detection and Sequencing Using a combination of SSCP and CFLP analysis, unique conformers were observed in exon 4 for each of the three families. Representative SSCP and CFLP gels are shown in Fig. 2. Sequencing of exon 4 in affected and unaffected family members from each family revealed nucleotide changes at conserved sites predicted to result in missense mutations in the mature receptor. Family A contains an A to G transition at nucleotide 1106 (1106A ⬎ G) (Fig. 3) of the cDNA sequence (GenBank Accession Number NM000388). This mutation is predicted to result in a glutamine to arginine change at residue 245 (Q245R). This mutation was not seen in sequences from unaffected relatives. The base change created a MspI restriction site which facilitated screening of control samples. All affected family members demonstrated the presence of the MspI restriction site; however, no digestion was observed in unaffected family members or in an additional 96 unrelated control samples. In Family B, a C to T transition at nucleotide 1034 (1034C ⬎ T) (Fig. 4) of the cDNA sequence was observed, resulting in a predicted proline to leucine

594

CONLEY ET AL.

FIG. 1. Pedigree for Families A, B, and C. * Denotes members of pedigree with DNA available for study, arrow denotes proband.

substitution at residue 221 (P221L). This mutation occurred in the affected family members but not in the unaffected relatives. This mutation destroys an HpaII site. The HpaII site was absent in all affected family members, but was present in all unaffected family members and in 82 unrelated controls. In Family C, a G to C transversion at nucleotide 1054 (1054G ⬎ C) (Fig. 5) of the cDNA sequence was identified which is predicted to result in a glutamic acid to glutamine substitution at residue 228 (E228Q). This mutation was present only in the affected family members. This mutation destroys a

MnlI restriction site. No digestion occurred in the affected family members, but digestion was observed in the unaffected family members and in 83 unrelated controls. Thus, missense mutations predicted to lead to nonconservative amino acid substitutions in exon 4 of the CASR were observed in all three families. In Vitro Functional Assays Increased activity of the CASR translates into increased PKC activity. Activated PKC acts upon a PKC promoter that drives the production of lucife-

595

ACTIVATING MUTATIONS IN THE CASR

TABLE 2 Biochemical Data for Affected Family Members Expressed as Mean ⴞ Standard Deviation

Family A n⫽7 Family B n⫽4 Family C n⫽4 Normal ranges a

Total Ca (mm/L)

Ionized Ca (mm/L)

PO 4⫺ (mm/L)

Intact PTH (pg/ml)

1,25-OH-D (pm/L)

25-OH-D (nm/L)

1.85 ⫾ 0.05

0.89 ⫾ 0.01

2.15 ⫾ 0.57

11.4 ⫾ 7.05

65 ⫾ 10

95 ⫾ 17

1.98 ⫾ 0.33

NA a

NA

14.3 ⫾ 1.53

43 ⫾ 36

81 ⫾ 61

1.93 ⫾ 0.10

1.06 ⫾ 0.06

2.95 ⫾ 0.50

23 ⫾ 6.10

38 ⫾ 14

45 ⫾ 2

2.20–2.69

1.15–1.35

1.45–1.78

36–144

22–130

18–50

NA, not assayed.

rin, which is measured using the luciferase system, giving an indirect measurement of PKC activity. The luciferase activity was noticeably greater, at all calcium concentrations, in the extracts taken from the cells containing mutant CASR versus cells containing wild-type CASR (Fig. 6). Family A represents a mutant receptor 3.5 times more active (P ⬍ 0.011), Family B represents a mutant receptor 5.5 times more active (P ⬍ 0.017), and Family C represents a mutant receptor 13 times more active (P ⬍ 0.004) on average across all calcium concentrations than the wild-type receptor.

FIG. 2. (A) Representative SSCP and (B) CFLP gels for exon 4 of the CASR. The gels were loaded with alternating affecteds and unaffecteds. Note the unique conformers denoted by an arrow.

DISCUSSION The Q245R mutation in Family A represents a change from an uncharged glutamine to a positively charged arginine residue. This region is a putative calcium-binding domain rich in negatively charged residues and a change to a more positively charged residue could lead to a conformational change resembling bound calcium and therefore leading to an activating mutation. The P221L mutation in Family B results in the replacement of a large, rigid proline with a smaller and more flexible leucine residue, potentially changing the conformation of the calcium-binding region to resemble that of bound calcium or facilitating the binding of calcium ions, resulting in an activating mechanism. The E228Q mutation in Family C results in the replacement of a negatively charged glutamic acid with a hydrophobic and uncharged glutamine residue. As in Family A, the position of this mutation within the receptor may change the overall negative charge of this region potentially changing the shape of the calcium-binding region to resemble that of bound calcium, therefore resulting in an activating mechanism. Activation of the CASR leads to an increase in phospholipase C activity leading to the accumulation of 1,4,5-inositol triphosphate (IP3) and diacylglycerol (DAG). IP3 causes rapid release of calcium from intracellular stores and decreases uptake from extracellular fluid (14), while DAG accumulation results in protein kinase C activation (15). The activation of the CASR triggers this signal transduction pathway to elevate intracellular Ca 2⫹. The end result of CASR activation in parathyroid cells is the inhibition of PTH secretion. Functional assays dem-

596

CONLEY ET AL.

FIG. 3. Sequence results for Family A, sequence of antisense strand. Wild-type sequence on top, patient sequence on bottom. Arrow denotes A to G transition.

onstrated that for each calcium concentration tested each mutant receptor was more active than the wildtype receptor. The luciferase reporter gene assay utilized in this project was a sensitive assay that relied on measuring an amplified signal response instead of measuring proximal signal transduction events. The decision to utilize a PKC-responsive reporter gene assay was based on information that this assay is more sensitive than traditional methods used to determine G-protein-coupled receptor activity. The sensitivity of this assay was demonstrated by Jinsi-Parimoo and Gershengorn (13) when the thyrotropin-releasing hormone receptor, a G-protein-coupled receptor, was found to have ligand-independent activity using the luciferase reporter gene assay, but not with the measurement of inositol triphosphate second messenger molecules. They concluded that this is a more sensitive system for measuring G-protein-coupled receptor activity. These assays prove that the missense mutation in each family confers gain of function upon the receptor, resulting in a decrease in the receptor set point and a more active receptor at all calcium levels when compared to the wild-type receptor. The results of

FIG. 4. Sequence results for Family B. Wild-type sequence on top, patient sequence on bottom. Arrow denotes C to T transition.

these assays support the theory that the mutations in the affected members of these families are indeed activating and are responsible for the autosomal dominant hypocalcemia seen in these families. Activating and inactivating mutations are known for the CASR. Inactivating mutations result in loss or reduced function of the receptor. This translates into an increased set point for the receptor, and higher serum calcium ion levels due to failure to down regulate PTH. Inactivating mutations cause familial benign hypocalciuric hypercalcemia (FHH) and neonatal severe hyperparathyroidism (NSHPT) where hypercalcemia is a common laboratory finding. Activating mutations result in a gain of function for the receptor. A gain of function mutation at the molecular level causes a loss of function at the physiologic level. A CASR with an activating mutation has a decreased set point, allowing a lower calcium level to be maintained. Activating mutations have been demonstrated in ADH where hypocalcemia is a common laboratory finding. ADH is also characterized by hypoparathyroidism, in the face of hypocalcemia, because of the decreased set point, which down regulates PTH secretion, even at low calcium levels, as demonstrated in these three families. All three of these novel activating mutations are located in a region of the extracellular domain of the receptor that is predicted to be highly negatively charged, based on the amino acid composition of this

FIG. 5. Sequence results for Family C. Wild-type sequence on top, patient sequence on bottom. Arrow denotes G to C transversion.

597

ACTIVATING MUTATIONS IN THE CASR

region. Fifteen out of 37 amino acids, or 41%, in this region are negatively charged. The amino acid changes observed in these families and their activating nature support the speculation that this is a calcium-binding domain for the CASR, and is important to normal CASR function. REFERENCES

FIG. 6. Luciferase functional analysis results. (A) Control versus wild-type, the control has no receptor added, but was transfected with reporter constructs. Data were normalized to the maximal response of the wild-type receptor. (B–D) Data were normalized to the maximal response of the mutant receptor. Error bars are standard error of the mean (SEM) of six independent cultures. Significant activation of mutant receptor compared to wild-type is noted in all three families.

1.

Finegold DN, Armitage MM, Galiani M, Matise TC, Pandian MR, Perry YM, Deka R, Ferrell RE. Preliminary localization of a gene for autosomal dominant hypoparathyroidism to chromosome 3q13. Pediatr Res 36:1– 4, 1994.

2.

Pearce S, Brown EM. Calcium-sensing receptor mutations: Insights into a structurally and functionally novel receptor. J Clin Endocrinol Metab 81:1309 –1311, 1996.

3.

DeLuca F, Ray K, Mancilla EE, Fan GF, Winer KK, Gore P, Spiegel AM, Baron J. Sporadic hypoparathyroidism caused by de novo gain-of-function mutations of the Ca 2⫹ sensing receptor. J Clin Endocrinol Metab 82:2710 –2715, 1997.

4.

Baron J, Winer KK, Yanovski JA, Cunningham AW, Laue I, Zimmerman D, Cutler GB Jr. Mutations in the Ca 2⫹-sensing receptor gene cause autosomal dominant and sporadic hypoparathyroidism. Hum Mol Genet 5:601– 606, 1996.

5.

Pollak MR, Brown EM, Estep HL, McLaine PN, Kifor O, Park J, Hebert SC, Seidman CE, Seidman JG. Autosomal dominant hypocalcaemia caused by a Ca 2⫹-sensing receptor gene mutation. Nature Genet 8:303–307, 1994.

6.

Watanabe T, Bai M, Lane CR, Matsumoto S, Minamitani K, Minagawa M, Niimi H, Brown EM, Yasuda T. Familial hypoparathyroidism: Identification of a novel gain of function mutation in transmembrane domain 5 of the calciumsensing receptor. J Clin Endocrinol Metab 83:2497–2502, 1998.

7.

Okazaki R, Chikatsu N, Nakatsu M, Takeuchi Y, Ajima M, Miki J, Fugita T, Arai M, Totsuka Y, Tanaka K, Jukumoto S. A novel activating mutation in calcium-sensing receptor gene associated with a family of autosomal dominant hypocalcemia. J Clin Endocrinol Metab 84:363–366, 1999.

8.

Lienhardt A, Garabedian M, Bai M, Sinding C, Zhang Z, Lagarde JP, Boulesteix J, Rigaud M, Brown EM, Kittler ML. A large homozygous or heterozygous in-frame deletion within the calcium-sensing receptor’s carboxylterminal cytoplasmic tail that causes autosomal dominant hypocalcemia. J Clin Endocrinol Metab 85:1695–1702, 2000.

9.

Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert SC. Cloning and characterization of an extracellular Ca 2⫹ -sensing receptor from bovine parathyroid. Nature 366:575–580, 1993.

10.

Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16: 1215, 1988.

11.

Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms

598

CONLEY ET AL.

using the polymerase chain reaction. Genomics 5:874 – 879, 1989. 12. Schadlow V, Barzilai N, Deutsch P. Regulation of gene expression in PC12 cells via an activator of dual second messengers: Pituitary adenylate cyclase activating polypeptide. Mol Biol Cell 3:941–951, 1992. 13. Jinsi-Parimoo A, Gershengorn MC. Constitutive activity of

native thyrotropin-releasing hormone receptors revealed using a protein kinase C-responsive reporter gene. Endocrinology 138:1471–1475, 1997. 14. Berridge MJ. Inositol triphosphate and calcium signaling. Nature 361:315–325, 1993. 15. Clapham DE. Mutations in G protein-linked receptors: Novel insights on disease. Cell 75:1237–1239, 1993.