- Email: [email protected]
Three novel polymorphic sequence variants in the type I collagen gene COL1A1, the main disease locus for Osteogenesis Imperfecta
Molecular and Cellular Probes (2000) 14, 329–332 doi:10.1006/mcpr.2000.0328, available online at http://www.idealibrary.com on
Three novel polymorphic sequence variants in the type I collagen gene COL1A1, the main disease locus for Osteogenesis Imperfecta S. Mirandola, P. F. Pignatti and M. Mottes∗ Dipartimento Materno Infantile e di Biologia e Genetica, Sezione di Biologia e Genetica, Universit di Verona, Strada le Grazie, 8, 37134 Verona, Italy (Received 1 February 2000, Accepted 29 February 2000) Three novel polymorphic variants were found within COL1A1 genomic sequence (accession number AF017178) while screening several patients in the search of OI causal mutations. The three polymorphisms, located in intron 12, exon 26, and intron 29, respectively, can be detected by PCR amplification and digestion with appropriate restriction enzymes (MboII, BstNI, PvuII, respectively). Allelic frequencies within the Italian population were calculated. 2000 Academic Press KEYWORDS: COL1A1, Osteogenesis Imperfecta, RFLP analysis.
INTRODUCTION COL1A1 (MIM 120150; 17q21.31–22.05) encodes pro1 chains of type I collagen. Mutations at this locus cause Osteogenesis Imperfecta (OI), a clinically heterogeneous heritable disorder of the connective tissue.1 The mildest and most common form of OI (type I, MIM 166200) is phenotypically highly homogeneous and is the result of a quantitative defect in the production of pro1 (I) chains. Various mutations such as frameshifts, splicing defects, nucleotide substitutions which lead to premature termination codons, within the COL1A1 sequence are the cause of type I OI.2,3 Several polymorphic variants detectable by restriction enzyme digestion (RFLP) have been reported and are employed in linkage analysis in familial OI;4 moreover, an intronic variant at the recognition site for transcription factor Sp1, has been found to be associated to reduced bone density and osteoporosis.5 Due to its importance as a disease locus, therefore, COL1A1 has been screened thoroughly for sequence variations. Here, we describe
three additional polymorphisms (located in intron 12, exon 26, intron 29, respectively). The detection assays, by restriction of amplified genomic DNA, as well as allelic frequencies in the Italian population are reported.
MATERIAL AND METHODS PCR conditions and polymorphism detection Genomic DNA was obtained from peripheral blood samples according to standard procedures. Oligonucleotide primers were chosen as follows: Variant T5362G. Primer F (IVS12): 5′ GAATGAATTTCTCACTCATTCT 3′ (the underlined nucleotide was specifically introduced in order to create a recognition site for MboII). Primer R (IVS15): 5 CCAAGAGCAGACACTGAGAC 3.
∗ Address to whom all correspondence should be addressed at: Sezione di Biologia e Genetica, Strada le Grazie, 8, 37134 Verona, Italy. Tel: +39 045 8027185; Fax: +39 045 8027180; Email: [email protected]
0890-8508/00/060329+04 $35.00
2000 Academic Press
330 Table 1.
S. Mirandola et al. Description of three polymorphic variants within COL1A1 gene
Location IVS12 Ex26 IVS29
Base substitution
Diagnostic RFLP
T5362G C8893T A9841G
MboII BstNI PvuII
A
B M
1
2
Allelic frequencies T=0·87 C=0·95 A=0·63
G=0·13 T=0·05 G=0·37
C M
1
2
M
1
2
3
Fig. 1. 12% (w/v) polyacrylamide gels showing the three polymorphic variants. (a) Lane 1: T/T genotype after MboII+BamHI digestion. Expected fragments: 263 bp, 198 bp, 12 bp (not visible). Lane 2: G/T genotype. Expected fragments: 275 bp, 263 bp, 12 bp. The double-digestion step was introduced in order to reduce the fragment sizes and therefore improve the electrophoretic separation between G and T alleles, which differ by 12 bp only. (b) Lane 1: C/C genotype evidenced by BstNI digestion. Fragments: 91 bp, 64 bp. Lane 2: C/T genotype. Fragments: 91 bp, 82 bp, 64 bp. Two additional fragments, of 28 and 9 bp, respectively, predicted by BstNI digestion in both genotypes, are not visible in the picture. (c) Lane 1: A/A genotype after PvuII digestion. The uncut PCR produt is 158 bp. Lane 2: G/G genotype. Expected fragments: 138 bp, 20 bp (not visible). Lane 3: A/G genotype. Expected fragments: 158 bp, 138 bp, (20 bp). M: the molecular weight standard used in all three gel runs was HaeIII/pBR322.
Variant C8893T. Primer F (IVS25); 5′ GTCCCACTCAGAGTAAATGAGAGGCC 3′ primer R (IVS26): 5′ GAAAGTGCCGGGGCAGCAATGG 3′.
95°C for 40 s, 57°C for 30 s, 72°C for 30 s, 0·5 to 1 g DNA were utilized for each reaction. Taq DNA polymerase was purchased from GIBCO-BRL, restriction enzymes and buffers were from New England Biolabs.
Variant A9841G. Primer F (IVS29): 5′ TTCCAGCAGAGTGGCCCCAGCT 3′ (the underlined nucleotide was specifically introduced in order to create a PvuII recognition site); primer R (IVS30): 5′ GGGCCAAGTACAACGCACCTTG 3′. Amplification conditions (30 to 32 cycles) were:
RESULTS We have been studying a group of type I OI patients who had shown a lack of expression of one COL1A1 allele (null allele phenotype) either by biochemical
Three polymorphic sequence variants in COL1A1
331
1 I A9841G-COL1A1 VNTR-COL1A2
G/A 2/4
1
2
3
4
5
6
7
G/A 3/4
A/A 2/3
A/A 3/4
A/A 1/2
G/A 2/2
G/G 2/4
A/A 1/4
1
2
II
III A/A 1/3
Fig. 2. Segregation of the A9841G COL1A1 and the COL1A2 VNTR polymorphic variants in a type IV OI pedigree. Discordance of segregation of A9841G allowed us to exclude COL1A1 as the disease locus: two affected sisters (II-3 and II-6) inherited allele A and allele G, respectively, from their affected mother (I-1). In this family the disease segregated with allele 4 of the COL1A2 VNTR.
quantitation of pro1 (I) chains or by molecular testing by the MnlI RFLP.6 The search for the causal mutations (either nonsense mutations or splicing mutations leading to aberrant splicing and premature termination codons; Mirandola et al., unpublished results) was achieved by amplifying genomic DNA fragments (average size= 260 bp) subsequently screened by heteroduplex analysis and single strand conformation polymorphism (SSCP). Along with unique abnormal migration patterns, suspected to be causal mutations, a few recurrent abnormally migrating bands were noted in unrelated subjects and were considered for sequence analysis as well. Three single nucleotide substitutions, reported in Table 1, were found to be polymorphic in a sample of 50 healthy unrelated Italian individuals. The genotypic distributions were in Hardy-Weinberg equilibrium. The T5362G substitution in intron 12 could be detected by restriction generating-PCR (RG-PCR) with a specifically designed forward primer which created an MboII recognition site; T/T homozygotes and G/T heterozygotes could be easily distinguished after a double MboII+BamHI digestion of the 473-bp product and electrophoresis on 12% (w/v) polyacrylamide gels (Fig. 1a). Examination of 50 normal individuals yielded 37 T/T homozygotes, 13 G/T heterozygotes, no G/G homozygote was detected. The C8893T substitution in exon 26 which creates a synonymous codon for Pro423 in the triple helical domain, could be detected by BstNI digestion of the 192-bp product (Fig. 1b). Among 50 subjects tested, 45 were C/C
homozygotes, five were C/T heterozygotes. Finally, for the detection of A9841G substitution a specific restriction-site generating primer for PvuII within the 158-bp PCR product was designed (Fig. 1c). The A9841G polymorphism, tested on 50 unrelated subjects, gave the following genotypes: 20 A/A homozygotes, seven G/G homozygotes, 23 A/G heterozygotes. The inferred allelic frequencies for the three dimorphisms are reported in Table 1. Due to the paucity of good polymorphic markers within the COL1A1 gene, we hypothesized that this newly found single nucleotide polymorphism (SNP) could be employed in linkage analysis. It indeed proved to be useful in demonstrating discordant segregation of the disease with the COL1A1 locus in a OI family, whereas two other markers tested had shown lack of informativity (Fig. 2). Segregation of the disease was then demonstrated in this family by the COL1A2 VNTR.7 These three novel variable sites, along with a TaqI RFLP previously described by Mirandola et al.,8 may be useful for disease locus identification; moreover, awareness of their presence and frequency within COL1A1 is important in order to discriminate promptly between causal mutations and non-pathogenic polymorphisms.
ACKNOWLEDGEMENTS This work was supported by M.U.R.S.T. 60%, by Italian CNR-P.F. Biotecnologie, and by the Italian OI Association.
332
S. Mirandola et al.
REFERENCES 1. Dalgleish, R. (1998). The human collagen mutation database 1998. Nucleic Acids Research 26, 253–5. 2. Willing, M. C., Deschenes, S. P., Slayton, R. L. & Roberts, E. J. (1996). Premature chain termination is a unifying mechanism for COL1A1 null alleles in Osteogenesis Imperfecta type I cell strains. American Journal of Human Genetics 59, 799–809. 3. Ko¨rkko¨, J., Ala-Kokko, L., De Paepe, A., Nuytinck, L., Earley, J. & Prockop, D. J. (1998). Analysis of the COL1A1 and COL1A2 genes by PCR amplification and scanning by conformation sensitive gel electrophoresis identified only COL1A1 mutations in 15 patients with Osteogenesis Imperfecta type I: identification of common sequences of null-allele mutations. American Journal of Human Genetics 62, 98–110. 4. Mottes, M., Sangalli, A. & Pignatti, P. F. (1993). Haplotype analysis of collagen type I genes in the general
5.
6.
7.
8.
population and in Osteogenesis Imperfecta. American Journal of Medical Genetics 45, 217–22. Grant, S. F. A., Reid, D. M., Blake, G., Herd, R., Fogelman, I. & Ralston, S. H. (1996). Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I1 gene. Nature Genetics 14, 203–5. Westerhausen, A. I., Constantinou, C. D. & Prockop, D. J. (1990). A sequence polymorphism in the 3 nontranslated region of the pro1 chain of type I procollagen. Nucleic Acids Research 18, 4968. Pepe, G. (1993). A highly polymorphic (ACT)n VNTR locus inside intron 12 of COL1A2, one of the two genes involved in dominant Osteogenesis Imperfecta. Human Mutation 2, 300–5. Mirandola, S., Pignatti, P. F. & Mottes, M. (1999). A novel intragenic polymorphism within the COL1A1 locus which can be detected by TaqI restriction of amplified genomic DNA. Molecular and Cellular Probes 13, 243–5.
Three novel polymorphic sequence variants in the type I collagen gene COL1A1, the main disease locus for Osteogenesis Imperfecta S. Mirandola, P. F. Pignatti and M. Mottes∗ Dipartimento Materno Infantile e di Biologia e Genetica, Sezione di Biologia e Genetica, Universit di Verona, Strada le Grazie, 8, 37134 Verona, Italy (Received 1 February 2000, Accepted 29 February 2000) Three novel polymorphic variants were found within COL1A1 genomic sequence (accession number AF017178) while screening several patients in the search of OI causal mutations. The three polymorphisms, located in intron 12, exon 26, and intron 29, respectively, can be detected by PCR amplification and digestion with appropriate restriction enzymes (MboII, BstNI, PvuII, respectively). Allelic frequencies within the Italian population were calculated. 2000 Academic Press KEYWORDS: COL1A1, Osteogenesis Imperfecta, RFLP analysis.
INTRODUCTION COL1A1 (MIM 120150; 17q21.31–22.05) encodes pro1 chains of type I collagen. Mutations at this locus cause Osteogenesis Imperfecta (OI), a clinically heterogeneous heritable disorder of the connective tissue.1 The mildest and most common form of OI (type I, MIM 166200) is phenotypically highly homogeneous and is the result of a quantitative defect in the production of pro1 (I) chains. Various mutations such as frameshifts, splicing defects, nucleotide substitutions which lead to premature termination codons, within the COL1A1 sequence are the cause of type I OI.2,3 Several polymorphic variants detectable by restriction enzyme digestion (RFLP) have been reported and are employed in linkage analysis in familial OI;4 moreover, an intronic variant at the recognition site for transcription factor Sp1, has been found to be associated to reduced bone density and osteoporosis.5 Due to its importance as a disease locus, therefore, COL1A1 has been screened thoroughly for sequence variations. Here, we describe
three additional polymorphisms (located in intron 12, exon 26, intron 29, respectively). The detection assays, by restriction of amplified genomic DNA, as well as allelic frequencies in the Italian population are reported.
MATERIAL AND METHODS PCR conditions and polymorphism detection Genomic DNA was obtained from peripheral blood samples according to standard procedures. Oligonucleotide primers were chosen as follows: Variant T5362G. Primer F (IVS12): 5′ GAATGAATTTCTCACTCATTCT 3′ (the underlined nucleotide was specifically introduced in order to create a recognition site for MboII). Primer R (IVS15): 5 CCAAGAGCAGACACTGAGAC 3.
∗ Address to whom all correspondence should be addressed at: Sezione di Biologia e Genetica, Strada le Grazie, 8, 37134 Verona, Italy. Tel: +39 045 8027185; Fax: +39 045 8027180; Email: [email protected]
0890-8508/00/060329+04 $35.00
2000 Academic Press
330 Table 1.
S. Mirandola et al. Description of three polymorphic variants within COL1A1 gene
Location IVS12 Ex26 IVS29
Base substitution
Diagnostic RFLP
T5362G C8893T A9841G
MboII BstNI PvuII
A
B M
1
2
Allelic frequencies T=0·87 C=0·95 A=0·63
G=0·13 T=0·05 G=0·37
C M
1
2
M
1
2
3
Fig. 1. 12% (w/v) polyacrylamide gels showing the three polymorphic variants. (a) Lane 1: T/T genotype after MboII+BamHI digestion. Expected fragments: 263 bp, 198 bp, 12 bp (not visible). Lane 2: G/T genotype. Expected fragments: 275 bp, 263 bp, 12 bp. The double-digestion step was introduced in order to reduce the fragment sizes and therefore improve the electrophoretic separation between G and T alleles, which differ by 12 bp only. (b) Lane 1: C/C genotype evidenced by BstNI digestion. Fragments: 91 bp, 64 bp. Lane 2: C/T genotype. Fragments: 91 bp, 82 bp, 64 bp. Two additional fragments, of 28 and 9 bp, respectively, predicted by BstNI digestion in both genotypes, are not visible in the picture. (c) Lane 1: A/A genotype after PvuII digestion. The uncut PCR produt is 158 bp. Lane 2: G/G genotype. Expected fragments: 138 bp, 20 bp (not visible). Lane 3: A/G genotype. Expected fragments: 158 bp, 138 bp, (20 bp). M: the molecular weight standard used in all three gel runs was HaeIII/pBR322.
Variant C8893T. Primer F (IVS25); 5′ GTCCCACTCAGAGTAAATGAGAGGCC 3′ primer R (IVS26): 5′ GAAAGTGCCGGGGCAGCAATGG 3′.
95°C for 40 s, 57°C for 30 s, 72°C for 30 s, 0·5 to 1 g DNA were utilized for each reaction. Taq DNA polymerase was purchased from GIBCO-BRL, restriction enzymes and buffers were from New England Biolabs.
Variant A9841G. Primer F (IVS29): 5′ TTCCAGCAGAGTGGCCCCAGCT 3′ (the underlined nucleotide was specifically introduced in order to create a PvuII recognition site); primer R (IVS30): 5′ GGGCCAAGTACAACGCACCTTG 3′. Amplification conditions (30 to 32 cycles) were:
RESULTS We have been studying a group of type I OI patients who had shown a lack of expression of one COL1A1 allele (null allele phenotype) either by biochemical
Three polymorphic sequence variants in COL1A1
331
1 I A9841G-COL1A1 VNTR-COL1A2
G/A 2/4
1
2
3
4
5
6
7
G/A 3/4
A/A 2/3
A/A 3/4
A/A 1/2
G/A 2/2
G/G 2/4
A/A 1/4
1
2
II
III A/A 1/3
Fig. 2. Segregation of the A9841G COL1A1 and the COL1A2 VNTR polymorphic variants in a type IV OI pedigree. Discordance of segregation of A9841G allowed us to exclude COL1A1 as the disease locus: two affected sisters (II-3 and II-6) inherited allele A and allele G, respectively, from their affected mother (I-1). In this family the disease segregated with allele 4 of the COL1A2 VNTR.
quantitation of pro1 (I) chains or by molecular testing by the MnlI RFLP.6 The search for the causal mutations (either nonsense mutations or splicing mutations leading to aberrant splicing and premature termination codons; Mirandola et al., unpublished results) was achieved by amplifying genomic DNA fragments (average size= 260 bp) subsequently screened by heteroduplex analysis and single strand conformation polymorphism (SSCP). Along with unique abnormal migration patterns, suspected to be causal mutations, a few recurrent abnormally migrating bands were noted in unrelated subjects and were considered for sequence analysis as well. Three single nucleotide substitutions, reported in Table 1, were found to be polymorphic in a sample of 50 healthy unrelated Italian individuals. The genotypic distributions were in Hardy-Weinberg equilibrium. The T5362G substitution in intron 12 could be detected by restriction generating-PCR (RG-PCR) with a specifically designed forward primer which created an MboII recognition site; T/T homozygotes and G/T heterozygotes could be easily distinguished after a double MboII+BamHI digestion of the 473-bp product and electrophoresis on 12% (w/v) polyacrylamide gels (Fig. 1a). Examination of 50 normal individuals yielded 37 T/T homozygotes, 13 G/T heterozygotes, no G/G homozygote was detected. The C8893T substitution in exon 26 which creates a synonymous codon for Pro423 in the triple helical domain, could be detected by BstNI digestion of the 192-bp product (Fig. 1b). Among 50 subjects tested, 45 were C/C
homozygotes, five were C/T heterozygotes. Finally, for the detection of A9841G substitution a specific restriction-site generating primer for PvuII within the 158-bp PCR product was designed (Fig. 1c). The A9841G polymorphism, tested on 50 unrelated subjects, gave the following genotypes: 20 A/A homozygotes, seven G/G homozygotes, 23 A/G heterozygotes. The inferred allelic frequencies for the three dimorphisms are reported in Table 1. Due to the paucity of good polymorphic markers within the COL1A1 gene, we hypothesized that this newly found single nucleotide polymorphism (SNP) could be employed in linkage analysis. It indeed proved to be useful in demonstrating discordant segregation of the disease with the COL1A1 locus in a OI family, whereas two other markers tested had shown lack of informativity (Fig. 2). Segregation of the disease was then demonstrated in this family by the COL1A2 VNTR.7 These three novel variable sites, along with a TaqI RFLP previously described by Mirandola et al.,8 may be useful for disease locus identification; moreover, awareness of their presence and frequency within COL1A1 is important in order to discriminate promptly between causal mutations and non-pathogenic polymorphisms.
ACKNOWLEDGEMENTS This work was supported by M.U.R.S.T. 60%, by Italian CNR-P.F. Biotecnologie, and by the Italian OI Association.
332
S. Mirandola et al.
REFERENCES 1. Dalgleish, R. (1998). The human collagen mutation database 1998. Nucleic Acids Research 26, 253–5. 2. Willing, M. C., Deschenes, S. P., Slayton, R. L. & Roberts, E. J. (1996). Premature chain termination is a unifying mechanism for COL1A1 null alleles in Osteogenesis Imperfecta type I cell strains. American Journal of Human Genetics 59, 799–809. 3. Ko¨rkko¨, J., Ala-Kokko, L., De Paepe, A., Nuytinck, L., Earley, J. & Prockop, D. J. (1998). Analysis of the COL1A1 and COL1A2 genes by PCR amplification and scanning by conformation sensitive gel electrophoresis identified only COL1A1 mutations in 15 patients with Osteogenesis Imperfecta type I: identification of common sequences of null-allele mutations. American Journal of Human Genetics 62, 98–110. 4. Mottes, M., Sangalli, A. & Pignatti, P. F. (1993). Haplotype analysis of collagen type I genes in the general
5.
6.
7.
8.
population and in Osteogenesis Imperfecta. American Journal of Medical Genetics 45, 217–22. Grant, S. F. A., Reid, D. M., Blake, G., Herd, R., Fogelman, I. & Ralston, S. H. (1996). Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I1 gene. Nature Genetics 14, 203–5. Westerhausen, A. I., Constantinou, C. D. & Prockop, D. J. (1990). A sequence polymorphism in the 3 nontranslated region of the pro1 chain of type I procollagen. Nucleic Acids Research 18, 4968. Pepe, G. (1993). A highly polymorphic (ACT)n VNTR locus inside intron 12 of COL1A2, one of the two genes involved in dominant Osteogenesis Imperfecta. Human Mutation 2, 300–5. Mirandola, S., Pignatti, P. F. & Mottes, M. (1999). A novel intragenic polymorphism within the COL1A1 locus which can be detected by TaqI restriction of amplified genomic DNA. Molecular and Cellular Probes 13, 243–5.