Three nucleus-encoded subunits of mitochondrial cytochrome c oxidase of the whiteleg shrimp Litopenaeus vannamei: cDNA characterization, phylogeny and mRNA expression during hypoxia and reoxygenation

Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Three nucleus-encoded subunits of mitochondrial cytochrome c oxidase of the whiteleg shrimp Litopenaeus vannamei: cDNA characterization, phylogeny and mRNA expression during hypoxia and reoxygenation L.R. Jimenez-Gutierrez a, J. Hernandez-Lopez b, M.A. Islas-Osuna c, A. Muhlia-Almazan a,⁎ a Laboratory of Bioenergetics and Molecular Genetics, Centro de Investigacion en Alimentacion y Desarrollo, A.C. (CIAD), Carretera a Ejido La Victoria, Km 0.6. PO Box, 1735, Hermosillo, Sonora, 83000, Mexico b Laboratory of Immunology, Centro de Investigacion en Alimentacion y Desarrollo, A.C., Carretera a Ejido La Victoria, Km 0.6. PO Box, 1735, Hermosillo, Sonora, 83000, Mexico c Laboratory of Genetics and Molecular Biology of Plants, Centro de Investigacion en Alimentacion y Desarrollo, A.C., Carretera a Ejido La Victoria, Km 0.6. PO Box, 1735, Hermosillo, Sonora, 83000, Mexico

a r t i c l e

i n f o

Article history: Received 28 February 2013 Received in revised form 14 June 2013 Accepted 26 June 2013 Available online 4 July 2013 Keywords: Cytochrome c oxidase Coordinated expression Hypoxia Transcriptional regulation

a b s t r a c t The mitochondrial cytochrome c oxidase (COX) catalyzes the reduction of oxygen to water playing a key role in the respiratory chain and ATP synthesis. The nucleus-encoded COX subunits do not participate in catalysis, but some are known to play a role in the expression, assembly and activity of the enzyme. Since hypoxia continuously affects the shrimp environment, it is important to study COX to understand their ability to deal with low oxygen levels. The goal of this research was to characterize the complementary DNA (cDNA) sequences of three nucleus-encoded subunits —coxIV, coxVa, and coxVb— and to evaluate the shrimp COX response to hypoxia by measuring their gene expression. The cDNA sequence of coxIV consisted of 532 bp, which encodes a 17.47 kDa protein, while coxVa cDNA consisted of 460 bp and coded a protein of 17.11 kDa, and the coxVb coding sequence consisted of 364 bp encoding a 13.74 kDa protein. Shrimp subunits do not have isoforms, and they are not differentially expressed during hypoxia, as observed in mammals. Coordinated changes were detected in the mRNA amounts of nuclear and mitochondrial subnits; these changes, at the transcriptional level, are suggested to be controlled through transcriptional factors Sp1 and NRF2. © 2013 Elsevier Inc. All rights reserved.

1. Introduction The electron transport chain is a spatially separated series of five enzymatic complexes that generate the vast majority of chemical energy (ATP) necessary to fulfill the cellular energy requirements (Mayevsky and Rogatsky, 2007; Dudkina et al., 2008). Cytochrome c oxidase (COX), the terminal enzyme in the electron transport chain catalyzes the reduction of dioxygen (O2) to water, and couples the free energy of the reaction to phosphorylate ADP to ATP (Verkhovsky et al., 2006). Besides the three catalytic subunits of the enzyme—COX I, COX II and COX III—that are encoded in the mitochondrial genome of most species including shrimp (Lenka et al., 1998; Shen et al., 2007), there are at least 8 further subunits encoded in the nucleus, which can vary in number among species (Khalimonchuk and Rödel, 2005). All nuclear subunits are cytoplasmically translated, and according to Boone et al. (1993), mammalian COX subunits may be designated as: 1) non-tissue⁎ Corresponding author at: Laboratory of Bioenergetics and Molecular Genetics, Carretera a Ejido La Victoria, Km 0.6. PO Box. 1735, Hermosillo, Sonora, 83000, Mexico. Tel.: +52 6622892400x504; fax: +52 6622800421. E-mail address: [email protected] (A. Muhlia-Almazan). 1096-4959/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cbpb.2013.06.008

specific expression subunits including COX IV, COX Va and Vb, COX VIb and VIc, COX VIIa, VIIb, and VIIc and finally COX VIII, and 2) tissue-specific expression subunits such as COX VIa L (liver type) and COX VIa H (heart/muscle type), COX VIIa L, and COXVIIa H. Subunits such as COX IV, COX Va and COX Vb, are known to play regulatory and stability roles (Chen and Pervaiz, 2009; Fornuskova et al., 2010). Recent reports state that the expression of COX nucleus-encoded isoforms is dependent on environmental oxygen concentrations. In species such as mammals, isoforms COX IV-1 and COX IV-2 are reported to be differentially expressed under hypoxic conditions (Diaz, 2010). To date, the three mitochondrial encoded COX subunits have been described for various crustaceans, but there are no studies about the structure and function of the nuclear subunits COX IV, COX Va, and COX Vb of shrimp, which may be part of the transcriptional response to hypoxia-reoxygenation as observed in other organisms. Therefore, the goal of the current study was to describe and characterize the complete complementary DNA (cDNA) nucleotide sequence of the nuclear subunits coxIV, coxVa and coxVb from the Pacific whiteleg shrimp Litopenaeus vannamei, which is one of the most cultured crustaceans worldwide (Paez-Osuna et al., 2003). Also, we determined changes in the mRNA relative amount of these subunits from shrimp

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

withdrawn. The hypoxia bioassay lasted 24 h and the tail muscle was dissected and individually stored in liquid nitrogen until use.

Table 1 Hypoxia assay and times of shrimp exposure. Treatment

Normoxia Hypoxia Hypoxia Hypoxia Re-oxygenation

31

Dissolved oxygen concentration (mg/L)

Elapsed time (h)

6.0 2.0 1.5 2.0 7.0

0 6 12 18 24

under hypoxia and re-oxygenation and compared them with those of the mitochondrial subunit coxI. 2. Materials and methods 2.1. Hypoxia assay Ninety adult L. vannamei shrimp (30 ± 1 g each) were obtained from aquaculture facilities at La Paz, B.C.S. Mexico. Shrimp were randomly distributed into six round plastic tanks (n = 15) filled with seawater (300 L). During acclimatization (8 days), shrimp were maintained at 28 °C, 35 ppt salinity, and a dissolved oxygen concentration of 6 mg/L (normoxia). Shrimp were fed twice daily with pelletized food (PIASA, 35% protein), uneaten food and feces were removed, and 70% of the total water volume was exchanged daily. After acclimatization shrimp were starved for 24 h, prior to the start of the assay. Three shrimp from 3 tanks were sampled at normoxia as controls, subsequently shrimp samples were taken from these tanks at normoxia at the same time that shrimp from tanks at hypoxia were sampled. The three tanks exposed to hypoxia were covered with a plastic sheet, the air supply was removed and the oxygen was gradually replaced by bubbling nitrogen gas into the water according to the methodology previously described by Martinez-Cruz et al. (2012). As oxygen decreased, its concentration was continuously monitored and carefully controlled during the experiment with a digital submersible oximeter. During the hypoxic phase of the assay, 3 shrimp were sampled at different oxygen concentrations from each tank (Table 1). The oxygen content of water was gradually reduced during 3 h until it reached 2.0 mg/L, then shrimp were exposed to this condition for 3 h and sampled. Subsequently, oxygen was reduced at 1.5 mg/L and shrimp were kept at this condition for 6 h and sampled. During re-oxygenation air stones were placed into the water, and once oxygen concentration reached 2.0 mg/L shrimp were maintained at this condition for 6 h and sampled. Finally, water was vigorously aereated and the oxygen concentration gradually increased during 3 h until it reached 7.0 mg/L, where shrimp were maintained during 3 h, after which samples were

2.2. Total RNA isolation and cDNA synthesis Total RNA was isolated from 150 mg of the tail muscle of each sampled shrimp. Tissue was homogenized in 1 mL Tri Reagent™ (SigmaAldrich, St. Louis, MO, USA) following the manufacturer's instructions. Total RNA concentration and purity were determined spectrophotometrically at 260/280 nm (NanoDrop, ND, USA). RNA integrity was evaluated by native electrophoresis in a 1% agarose gel as follows: 1 μg total RNA was added to 4 μL RNA-loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol FF, and 30% glycerol) and heated at 65 °C for 10 min before it was loaded into the agarose gel. DNA contamination was removed from RNA samples using DNase I (Roche Trade Mark, USA; 1 U/μg RNA) as follows: 6 μg total RNA and 2 U DNase were mixed with 1 μL 10X buffer (400 mM Tris HCl, 100 mM NaCl, 60 mM MgCl2, 10 mM CaCl2, pH 7.9). The mixture was incubated at 35 °C for 20 min and the reaction was stopped at 75 °C for 10 min and finally chilled on ice. cDNA was synthesized from total RNA using the First Strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). Reverse-transcription reactions included 5 μg total RNA, 1 μL oligo dT and 1 μL random hexamers following the manufacturer's instructions. cDNAs from shrimp samples were used as templates for PCR to sequence subunits coxIV, coxVa, and coxVb, and to evaluate mRNA relative amounts during hypoxia by qRT-PCR. 2.3. CoxIV, coxVa, and coxVb cDNA sequencing Various expressed sequence tags (ESTs) from L. vannamei tissues were found on the GenBank database for COX nuclear subunits. A multiple alignment analysis of each subunit was performed including ESTs and the mRNA sequences of COX subunits of various species to design oligonucleotides (Table 2). PCR amplification of cDNA fragments encoding COX subunits were carried out using the Taq PCR master mix kit (Qiagen Trade Mark, USA) as follows: 12.5 μL 2X Top Taq PCR master mix, 2.5 μL 10X coral dye, 1 μL each 20 μM forward and reverse oligonucleotides, cDNA as template (350 ng RNA equivalents), and water to a total volume of 25 μL. PCR conditions were: 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 3 min (1 cycle), 94 °C for 1 min, 42 °C for 1 min, 72 °C for 3 min (1 cycle), and 30 cycles of 94 °C for 1 min, and the annealing temperature of each set of oligonucleotides for 1 min, 72 °C for 1 min and a final extension of 72 °C for 10 min. PCR products were analyzed on a 1.5% agarose gel and stained with SYBR Safe (Invitrogen). In order to sequence the untranslated regions (UTRs) of each COX subunit, we used the oligonucleotides SMART IV and CDS III/3 from

Table 2 Specific oligonucleotides used for PCR amplification of shrimp mitochondrial and nuclear subunits of COX and the reference gene L8. Gene

Oligonucleotide name

Sequence (5´–3´)

cDNA position (nt)

Genbank accession number

COX COX COX COX COX COX COX COX COX COX COX COX L8 L8

a

GCTGTGACGATCTCGAGTGTG CTCGAGTTCCTTGATTTCC GGTTCAGATCCCCTATACAAA GACCAGCTGAGCGAAAG GATAAGGACACAACACTGG AGGTATTGCCCACTGATTCC CTGGTGGAAGGTTATGCTG CCTTGAAGCGGACACCTGGC GCCCAAGATCATTGTTGC GGTCATACACACTCTCTAGGG GTAACGAGAACCCCTTTG ACCTAAACCATGGGCTTG TAGGCAATGTCATCCCCATT TCCTGAAGGGAGCTTTACACG

−40 – −25 – 651 – −41 – 403 – 2630 – 2958 – 187 – 231 – 457 – 149 – 367 – 293 – 459 –

JQ828862 JQ839284

a

IV Va Va Vb Vb I I IV Va Va Vb Vb

COX4LvFw6 COX5aLvFw3 COX5aLvRv2 COX5bLvFw3 COX5bLvRv2 a COX1LvFw1 a COX1LvRv2 a COX4LvRv6 a COX5aLvFw2 a COX5aLvRv1 a COX5bLvFw1 a COX5bLvRv1 a L8Fw3 a L8Rv3

Oligonucleotides used for genes expression evaluation.

−20 −4 631 −25 385 2649 2941 168 248 437 166 351 312 439

JQ952564 NC_009626.1

DQ316258.1

32

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

the SMART™ cDNA Library Construction Kit (Clontech, USA) and the First Strand cDNA synthesis kit to synthesize cDNA as follows: 1 μg total RNA, 1 μL 12 μM oligo SMART IV, and 1 μL 12 μM oligo CDS III/3 and water to a total of 5 μL. The mixture was incubated at 72 °C for 2 min, and chilled on ice. Then we added 1.2 μL 25 mM MgCl2, 1 μL 10X First Strand buffer, 0.2 μL 0.1 M DTT, 1 μL 10 mM dNTPs mix, 1 μL Super Script II RT (50 U) and water to a total of 10 μL. The mixture was incubated at 42 °C for 1 h, and the cDNA was stored at −20 °C until use. To amplify the 3´ UTR from each subunit, PCR was performed in 25-μL total volume reactions that included cDNA (equivalent to 50 ng total RNA), 0.75 μL CDS III/3 oligonucleotide, 0.5 μL 20 µM forward specific oligonucleotide (Table 2), and 2X Top Taq PCR master mix (Qiagen, USA). The PCR conditions were: 95 °C for 1 min (1 cycle), 95 °C for 1 min and 68 °C for 6 min (24 cycles). The PCR product was used as the template in a reamplification reaction in the same conditions, then PCR products were analyzed by electrophoresis in agarose gels. PCR products were purified using the GFX PCR DNA purification kit (GE HealthCare, USA) according to the manufacturer's instructions, and sequenced by the DNA Synthesis and Sequencing Service at the Biotechnology Institute (UNAM, Mexico). Results were analyzed using BLASTn and BLASTx algorithms at NCBI. Protein translation and predicted molecular weight and isoelectric point were obtained using the EXPASY translate and ProtParam tool (http:// expasy.org/). Sequences were aligned to calculate the percentage of identity of different species using clustalW and BioEdit 7.0.9.0 software (Thompson et al., 1994; Hall, 1999).

with various EST sequences from GenBank encoding putative COX IV subunits from crustaceans, such as Penaeus monodon, Callinectes sapidus, Euphausia superba, Daphnia pulex and Artemia franciscana. The phylogenetic analysis was inferred using the Neighbor-Joining method with pairwise deletion (Saitou and Nei, 1987). The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the taxa. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Felsenstein, 1985). Each tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965), and are in the units of the number of amino acid substitutions per site. All positions containing alignment gaps and missing data were eliminated only in pairwise sequence comparisons (pairwise deletion option). Phylogenetic analyses were conducted in MEGA4 (Tamura et al., 2007). 2.6. Statistical analysis Each treatment/control group consisted of three replicates, and in total, nine individuals were respectively pseudoreplicates (n = 9) and all analysis were performed in triplicates. Data were analyzed for normality and variance homogeneity. Statistical significance was evaluated by one way-ANOVA (P b 0.05), and differences among treatments were determined by Fisher's LSD and Tukey–Kramer multiple-comparison tests using the NCSS 2007 software.

2.4. Cox subunit mRNA levels by qRT-PCR 3. Results The mRNA amount of three nucleus- (coxIV, coxVa, and coxVb) and one mitochondria- (coxI) encoded subunits from the COX complex was evaluated from shrimp muscle at normoxia, hypoxia and reoxygenation conditions. Specific oligonucleotides were designed for real-time PCR amplification (Table 2). The mitochondria-encoded subunit CoxI (GenBank accession no. NC_009626.1) was included in the analysis to compare its expression with those of nucleus-encoded subunits. The PCR fragments sizes were 292, 188, 189, 185, and 127 bp for cox1, coxIV, coxVa, coxVb, and L8, respectively. Real-time PCR reactions included cDNA as template (equivalent to 250 ng of total RNA for subunits cox1, coxVa, coxVb, and 350 ng for coxIV), 12.5 μL of 2X SYBR green supermix (Bio-Rad, USA), 0.9 μL of each 5 μM specific oligonucleotide, and water to a final volume of 25 μL. The ribosomal protein L8 was used as reference gene for data normalization (GenBank accession no. DQ316258.1). The real-time PCR conditions were: one cycle of 95 °C for 5 min, 38 cycles of 95 °C for 30 s, the specific temperature for each set of primers for 35 s, and 72 °C for 55 s. The relative expression of each COX subunit was evaluated using the 2−ΔΔCt method (Schmittgen and Livak, 2008). 2.5. Phylogenetic analysis of COX subunits A multiple alignment analysis including the deduced amino acid sequences from selected taxa and L. vannamei was performed for COX IV subunit. Sequences of vertebrates, yeast, echinoderms, hemichordates, and arthropods (mainly insects) were included together

3.1. CoxIV cDNA sequence The complete cDNA for coxIV (GenBank accession no. JQ828862.1; Fig. 1A) was sequenced. The nucleotide sequence encoding shrimp coxIV shares high identities with coxIV from other invertebrates, such as insects (44–48%); when compared to vertebrates, shrimp coxIV cDNA showed a 38% identity with that reported for the bovine coxIV isoform 2 coding sequence (NM_001193186.1). The shrimp coxIV cDNA includes two putative transcription factor binding sites: A Specificity protein 1 (Sp1) binding site TGGCCGGGGC at positions −48 to −39, and a putative GGAA-binding site at position −19 to −16 which represents the core sequence reported as a recognition target for the family of ETs domain proteins that binds to the nuclear respiratory factor NRF2 (Virbasius and Scarpulla, 1991; Fig. 1A). The shrimp COX IV deduced-protein (AFY10818.1) shows higher identity with that of other crustaceans and insects. Interestingly, among the bovine COX IV the identity is higher with isoform 2 than with that of isoform 1 (Fig. 1B; Table 3). This protein includes a 27-residues trans-membrane region in the middle of two extramembrane domains at both ends; and it also contains the two main ATP-binding sites recognized in the bovine protein. The first site involves 5 residues in the bovine sequence (Arg20, Arg73, Ser75, Glu77, Trp78), while in the shrimp sequence only three conserved residues were found (Arg51, Ala104, Thr106, Glu108, Trp109). The second ATP binding site is located at the C-end as part of the extra-membrane domain, which involves a unique residue Gly, conserved in shrimp at

Fig. 1. Shrimp COX IV A) cDNA and deduced amino acid sequences. Black letters indicate start, and stop codons. At 5′-UTR open framed nucleotides indicate a putative Sp1 binding site; white letters in black frame GGAA indicate an Ets-NRF2 binding site. Underlined residues indicate the predicted signal peptide. Doble underlined nucleotides indicate the poly A signal, and poly A tail. B) Protein multiple alignment. L.salmonis: Lepeophtheirus salmonis, C. rogercresseyi: Caligus rogercresseyi, D.simulans: Drosophila simulans, L.vannamei: Litopenaeus vannamei, T.castaneum: Tribolium castaneum, C.floridanus: Camponotus floridanus, U.caupo: Urechis caupo, I.scapularis: Ixodes scapularis, H.sapiens_2: Homo sapiens isoform 2, B.taurus_2: Bos taurus isoform 2, M.musculus_2: Mus musculus isoform 2. Scientific names in bold indicate crustaceans; framed sequence represents the transmembrane region according to Tsukihara et al. (1996); black-highlighted residues indicate putative ATP/ADP-binding sites; residues marked with + are conserved among invertebrates; (*) identical residues; (:) conservative substitutions, and (.) semiconservative substitutions.

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

A

B

33

34

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

position Gly164 and in all analyzed species (Fig. 1B; Das et al., 2004). The shrimp putative protein also shows some specific residues as Glu86, which is important in maintaining the helix-turn-helix structure in all known COX IV proteins. 3.2. CoxV shrimp sequences The shrimp COX V subunit showed two different transcripts and proteins in L. vannamei. The full-length sequences of the subunits, coxVa and coxVb, from L. vannamei do not share identity between them, and could not be considered isoforms. 3.2.1. CoxVa cDNA sequence The shrimp coxVa cDNA coding region (JQ839283.1; Fig. 2A) showed high identities with coxVa from insects (48–51%), and it shares lower identities with those reported on vertebrates including Bos taurus (45%; BC109608.1) and Mus musculus (42%; NM_007747.2). Among the three deduced proteins of shrimp, COX Va (AFW19996.1; Table 3) shared higher identities with other species, than the COX IV and COX Vb subunits. As no reports of other crustaceans COX Va proteins were found, a deduced COX Va-like protein from Artemia franciscana was included in the analysis (Fig. 2B). 3.2.2. CoxVb cDNA sequence The coxVb subunit of L. vannamei cDNA sequence (JQ952564.1) shares an identity percentage of 56% with a putative coxVb sequence found in the crayfish C. quadricarinatus (GQ286149.1). This cDNA sequence includes a putative NRF2 -binding site GCTCTTCGCC at positions −10 to −1 in the 5´-UTR (Virbasius and Scarpulla, 1991; Fig. 3A). According to the Marchler-Bauer et al. (2013) predicting tools, shrimp COX Vb (AFV69126.1; Table 3) has four conserved cystein residues forming a zinc-binding site (Cys84, Cys86, Cys106 and Cys108; Tsukihara et al., 1996). In the bovine COX Vb the COOH-terminal domain contains the residues Val49, Val58, Tyr89 which forms a β-barrel structure implicated in the efficiency and structural stability of the COX complex (Khalimonchuk and Rödel, 2005), while the shrimp protein contains the residues Val73, Val82 and Phe112 which may resemble such structure (Fig. 3B). Some conserved residues were detected among invertebrates (insects and crustaceans) in the three nuclear COX sequences; some others were unique to shrimp, and others were predicted as putative interface sites among COX shrimp subunits. Each of these residues should be analyzed and a predictive model of each subunit, and the interactions among them, should confirm whether these substitutions may have an implication in the enzyme conformation/activity. 3.3. Phylogenetic relationships of shrimp nuclear COX subunits The phylogenetic tree from the COX IV subunit consists of four main clusters: cluster A, was defined by invertebrates sequences; cluster B by hemichordates and echinoderms sequences; cluster C by vertebrates sequences, and cluster D by a yeast sequence, rooting the tree. Interestingly, species with a single isoform of COX IV were grouped in the same cluster, while vertebrate species with isoforms 1 and 2 were grouped together (Fig. 4). It is worth mentioning that the L. vannamei COX IV, which is grouped with malacostracan crustaceans such as P. monodon and C. sapidus, seems to be more closely related to insects as A. mellifera (Hymenoptera) and T. castaneum (Coleoptera), than to entomostracan crustaceans such as D. pulex and A. franciscana (Fig. 4). Clustering of insects with crustaceans is in agreement with an extensive literature on arthropod phylogenetics supporting both as sister groups sharing a common ancestor (Andrew, 2011). Similar results were obtained on the phylogenetic analysis of the COX Va and COX Vb subunits of L. vannamei (data not shown).

Table 3 Deduced protein characteristics of shrimp COX subunits COX IV, COX Va, and COX Vb, and identity percentages (GenBank accession numbers). COX subunit

COX IV

COX Va

COX Vb

Protein size (aa) Signal peptide lengtha Mol. mass (kDa)b Isolectric pointb Identity (%)c Crustaceans

177 36

149 37

121 16

19.47 9.37

17.11 5.26

13.74 7.64

Scylla paramamosain 41% (ACY66416.1) Lepeophtheirus salmonis 42% (ADD3839.1) Drosophila simulans 48% (AAP88303.1) Tribolium castaneum 58% (NP001164085.1)

Artemia franciscana 58% (ACT31598.1) L. salmonis 58% (ACO12855.1)

C. quadricarinatus 55% (GQ286149.1)

Insects

Vertebrates

Bos taurus-1 32% (NP001001439.1) Bos taurus-2 35% (NP001180115.1)

L. salmonis 40% (ACO12623.1)

Ixodes scapularis 56% (XP002408597.1) Tribolium castaneum 57% (XP968221.1) Mus musculus 54% Mus musculus 32% (CAA34085.1) (NP_034072.2) Bos taurus 50% Bos taurus 32% (NP_001002891.1) (NP001029218.1) Anopheles gambiae 66% (XP309490.3) Ixodes pacificus 64% (AAT92214.1)

a

Signal peptide determined according to MITOPROT (Claros and Vincens, 1996). Molecular mass and isoelectric point were calculated according to ProtParam tools (Gasteiger et al., 2005). c Identity percentages were calculated according to BioEdit Sequence Alignment Editor 7.2.0 (Hall, 1999). b

3.4. mRNA levels of nuclear and mitochondrial COX subunits during hypoxia Significant changes were detected in this study in response to the effect of hypoxia and during re-oxygenation when compared to normoxia (P b 0.05). Equal quantities of total RNA were used to compare the mitochondrial encoded subunit coxI (Fig. 5A) with the nucleus-encoded subunits coxVa and coxVb (Fig. 5C and D); however, to detect coxIV larger amounts of template were required, and the results confirmed remarkably low levels of this transcript even during normoxia (Fig. 5B). The effect of hypoxia and re-oxygenation on the mRNA amounts of all analyzed subunits was similar, since all of them decreased after the first 6 h during hypoxia (2 mg/L), but statistical differences were detected only in subunit coxVa (P b 0.05). The mRNAs increased at 1.5 mg/L, reaching their maximum level after 12 h at hypoxia as observed in coxI, coxIV, and coxVb (P b 0.05). Finally, all of them decreased when oxygen concentration slightly increased to 2.0 mg/L, and during re-oxygenation (7 mg/L) to less than previous levels observed during normoxia (P b 0.05; Fig. 5). Hypoxia promoted coordinated changes in the mRNA amounts of the mitochondrial- and nucleus-encoded COX subunits, which were over-expressed at the lowest oxygen concentration and sharply decreased during re-oxygenation. 4. Discussion The role of the three mitochondrial subunits has been largely studied since these subunits form the catalytic core of the enzyme. In the bovine COX model, even though the protein structure of the 10 nucleus-encoded subunits has been solved, their specific roles in regulating the enzyme function have not been fully understood (Tsukihara et al., 1996; Li et al., 2006; Pierron et al., 2012; Yoshikawa et al., 2012). Due to the scarce information about COX nuclear subunits from invertebrates, as insects and other crustaceans, the shrimp sequences were compared with those of mammals and the bovine model was used to establish differences. In this study, shrimp COX subunits were named according to their similarity with mammalian proteins, and

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

35

A

B

Fig. 2. Shrimp COX Va A) cDNA and deduced amino acid sequences. Black letters indicate start, and stop codons. Underlined residues indicate the predicted signal peptide. Double underlined nucleotides indicate the poly A signal, and poly A tail. B) COX Va Protein multiple alignment. T. castaneum: Tribolium castaneum, G. atropunctata: Graphocephala atropunctata, A. gambiae: Anopheles gambiae, L. vannamei: Litopenaeus vannamei, A. franciscana: Artemia franciscana, I. pacificus: Ixodes pacificus, B. taurus: Bos taurus, H. sapiens: Homo sapiens, M.musculus: Mus musculus, S.purpuratus: Strongylocentrotus purpuratus. Scientific names in bold indicate crustacean species. Residues marked with + are conserved among invertebrates. (*) identical residues; (:) conservative substitutions; and (.) semiconservative substitutions.

36

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

A

B

Fig. 3. Shrimp COX Vb A) cDNA and deduced amino acid sequences. Black letters indicate start, and stop codons. At 5′-UTR white letters in black frame indicate a putative NRF2-binding site. Underlined residues indicate the predicted signal peptide. Double underlined nucleotides indicate the poly A signal, and poly A tail. B) COX Vb protein multiple alignment. L.vannamei: Litopenaeus vannamei, C.quadricarinatus: Cherax quadricarinatus, I.scapularis: Ixodes scapularis, T.castaneum: Tribolium castaneum, A.aegypti: Aedes aegypti, H.saltator: Harpegnathos saltator, L.salmonis: Lepeophtheirus salmonis, S.kowalevskii: Saccoglossus kowalevskii, H.magnipapillata: Hydra magnipapillata, M.musculus: Mus musculus, B.taurus: Bos taurus, H.sapiens: Homo sapiens. Scientific names in bold indicate crustacean species. C residues in an open frame indicate putative zinc-binding sites; residues marked with + are conserved among invertebrates. (*) identical residues; (:) conservative substitutions; and (.) semiconservative substitutions.

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

37

L.vannameiC4

100 83

P.monodonC4

34

C.sapidusC4 E.superbaC4 B.moriC4

13 6

A.melliferaC4 30

T.castaneumC4 D.pulexC4

31 33

A.franciscanaC4 C.elegansC4

52

A

D.melanogasterC4A 57

A.gambiaeC4

10

A.aegyptiC4

98 88

C.quinquefasciatusC4 I.scapularisC4

0 77

U.caupoC4 S.kowalevskiiC4

92

B

S.purpuratusC4 55 100

52

B.taurusC4 2 H.sapiensC4 2 M.musculsC4 2 S.salarC4 2

80

S.salarC4 1

52

C

H.sapiensC4 1

76 97 82

B.taurusC4 1 M.musculusC4 1 S.cerevisiaeC4

D

0.2

Fig. 4. COX IV phylogenetic tree topology using neighbor-joining method with pairwise deletion from amino acid sequences. Numbers above/below the nodes indicate nonparametric bootstrap values (1000 replicates). Nucleotidic sequences which were translated to complete the crustaceans species of the phylogenetic tree were malacostracan crustaceans as P. monodon (GenBank accession no. coxIV GE615964.1), C. sapidus (GenBank accession nos. coxIV CV031258.1) and E. superba (GenBank accession nos. coxIV GW423569.1), and entomostracan crustaceans as A. franciscana (GenBank accession nos. coxIV ES495068.1).

their identities were confirmed by the conserved elements shared with bovine subunits (Grossman and Lomax, 1997; Lenka et al., 1998). According to Grossman and Lomax (1997), the number of COX nucleus-encoded subunits is known to increase as the evolutionary complexity of the organism, or may be correlated with the regulatory complexity of the enzyme (Ludwig et al., 2001; Das et al., 2004). Besides the three studied subunits (COX IV, COX Va and COX Vb), there is evidence of the existence of shrimp subunits COX VIa, COX VIb, COX VIc, COX VIIa, COX VIIc, but no about any COX VIIb, or COX VIII (data not shown). According to previous data, these last two mammalian subunits have no homologues in insects or nematodes (Szuplewski and Terracol, 2001; Das et al., 2004), then it is suggested that the shrimp COX may include up to 8 nuclear subunits; nevertheless, to date the total number of nuclear subunits that are part of shrimp COX is unknown, since its genome has not been sequenced. Although, two isoforms of the subunit COX IV have been described in mammals, COX IV-1 and COX IV-2, no evidence of another cox IV cDNA isoform was found in various shrimp tissues (data not shown). Furthermore, the phylogenetic analysis grouped the shrimp COX IV in a cluster including COX IV proteins from insects containing a single COX IV subunit in their genome (Fig. 4). According to Das et al. (2004), the existence of subunit homologues among vertebrates and invertebrates suggests that the emergence of

COX nuclear subunits occurred before the radiation of the major eukaryote lineages; furthermore, the lack of duplicated forms of COX genes in both sister groups, Insecta and Crustacea, may indicate that the genes duplication event that produced the isoforms in vertebrates occurred once the vertebrates primitive ancestor diverged from Arthropoda ancestor. Recent reports state that COX IV-2 is expressed in vertebrate tissues under hypoxic conditions thus increasing COX activity as an adaptive response; also, an optimal efficiency of mitochondrial respiration is reached at this condition (Vijayasarathy et al., 2003; Fukuda et al., 2007). Vertebrate isozymes that include COX IV-2 are found in tissues with high energy demand, as lungs, trachea, and gills in fish; the existence of COX IV isoforms in vertebrates, as another strategy to regulate the enzyme function due to the oxygen lack, may be associated with the absence of an alternative oxidase (AOX; Pierron et al., 2012). To date in crustaceans, there is no evidence of the existence of an AOX (McDonald et al., 2009), but the shrimp COX IV is significantly affected by hypoxia, just as the COX IV-2 isoform from vertebrates (Fukuda et al., 2007). Shrimp COX IV deduced protein includes conserved elements, as the main ATP-binding sites, which allow the enzyme activity to be allosterically inhibited by high ATP amounts (Hüttemann, 2000). Thus, our findings suggest that the shrimp COX IV protein resembles

38

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

Fig. 5. Relative expression of subunits A) coxI, B) coxIV, C) coxVa, and D) coxVb from the muscle of shrimp during normoxia, hypoxia and re-oxygenation. Data represent mean ± standard error (representative experiment n = 9). Different letters indicate statistical significant differences (P b 0.05).

the vertebrate isoform 2, conferring to the enzyme the ability to face hypoxia in a highly efficient manner (Hüttemann et al., 2012a). The coxIV, cox Va, and coxVb genes from various animal species are known to include, in their upstream sequences, GC-rich elements identified as specific binding sites to transcription factors as Sp1 and NRF2. These sites are observed in the three human nuclear subunits, and in rodent cox IV and cox Vb subunits (Carter and Avadhani, 1991; Virbasius and Scarpulla, 1991; Grossman and Lomax, 1997; Ongwijitwat and Wong-Riley, 2005; Ongwijitwat et al., 2006; Bruni et al., 2012). The finding of putative Sp1- and NRF2-binding sites in shrimp cox IV and cox Vb sequences indicates the existence of transcriptional regulatory mechanisms coordinating shrimp COX nuclear subunits. According to the analysis of Ongwijitwat and Wong-Riley (2005), specific sites NRF2 and Sp1 indicate transcriptional control in the bovine coxVa; however, these sites were not found in the shrimp coxVa transcript since they are known to be located far upstream. Nevertheless, coxVa mRNA levels responded in a coordinated manner with all other COX subunits evaluated in their response to hypoxia. In vertebrates, this subunit participates on the regulation of COX by binding the thyroid hormone T2, which reverses allosteric inhibition of COX caused by ATP binding (Arnold et al., 1998). It is difficult to infer the shrimp COX Va function since no thyroid hormones are known in crustacean species, and further studies may be addressed to find whether this protein may act reversing the allosteric ATP inhibition of shrimp COX. Several studies have demonstrated COX as a key regulator of the oxidative phosphorylation system, which is known to contain tissuespecific isoforms of nuclear encoded subunits as observed in mammals (Hüttemann et al., 2012b). Our results show that the differential expression of isoforms is not the shrimp response to regulate COX function during hypoxia; however, the total number of nuclear subunits that

are part of the shrimp COX complex is unknown, so the existence, characterization and genes expression of putative subunits VI and VII and their isoforms should be confirmed and studied at this condition. The observed changes in the mRNA amounts of COX subunits showed significant differences by several orders of magnitude between the mitochondrial-encoded subunit coxI, which is expressed in larger quantities, and the three nucleus-encoded subunits coxVa, coxVb, and coxIV. These differences were also observed in shrimp when evaluating mitochondrial and nuclear subunits of the mitochondrial ATP-synthase, and this could be explained by the difference in the number of mitochondrial genome copies in a cell with a single nuclear genome (Muhlia-Almazan et al., 2008). The shrimp coxIV was the subunit with the lowest level of transcripts, which may explain the necessity to increase the total RNA concentration to detect these transcripts in such a minimal amount. It is worth mentioning that coxIV may be a limiting component in the assembly of the shrimp COX complex since it is known to be integrated in stoichiometric amounts (Fontanesi et al., 2008). The increased transcripts levels of the various COX subunits observed in this study indicate that the mRNA accumulates during hypoxia as a response at the transcriptional level in agreement with studies of oxidases from plants and mammals (Szal et al., 2003; Fukuda et al., 2007). When the system was re-oxygenated, the abundant amount of mRNAs decreased abruptly, indicating that mRNA has been degraded. Preliminar results in shrimp COX suggest that enzyme activity increases, but protein COX levels are not affected by hypoxia (data not shown); this may indicate a post-transcriptional regulation and agrees with the results of AOX and COX in plants and insects, respectively (Szal et al., 2003; Zhang et al., 2013). Our observations imply that the shrimp COX complex does not fit exactly to any of the previously described COX animal enzymes since shrimp resemble insects as they lack the COX IV isoforms found in

L.R. Jimenez-Gutierrez et al. / Comparative Biochemistry and Physiology, Part B 166 (2013) 30–39

mammals. Furthermore, similar to the observations reported in several other arthropods and chordates, no AOX has been found in shrimp to date (McDonald et al., 2009). Finally, the shrimp COX genes (coxI, coxIV, coxVa and coxVb) responded to hypoxia in a coordinated manner, which may be controlled at the transcriptional level through transcriptional factors as Sp1 and NRF2, as observed in mammals genes. Acknowledgments We thank Sandra Araujo-Bernal, Analia V. Fernandez-Gimenez, and Alexel J. Burgara-Estrella for technical support, and Consejo Nacional de Ciencia y Tecnologia (CONACyT, National Council for Research and Technology, Mexico) for grant 133174 to AMA and for a graduate scholarship to LRJG. References Andrew, D.R., 2011. A new view of insect-crustacean relationships II: inferences from expressed sequence tags and comparison with neural cladistics. Arthropod Struct. Dev. 40, 289–302. Arnold, S., Goglia, F., Kadenbach, B., 1998. 3,5-Diiodothyronine bind to subunit Va of cytochrome c oxidase and abolishes the allosteric inhibition of respiration by ATP. Eur. J. Biochem. 252, 325–330. Boone, G., Seibel, P., Possekel, S., Marsac, C., Kadenbach, B., 1993. Expression of human cytochrome c oxidase subunits during fetal development. Eur. J. Biochem. 217, 1099–1107. Bruni, F., Polosa, P.L., Gadaleta, M.N., Cantatore, P., Roberti, M., 2012. Nuclear respiratory factor 2 induces the expression of many but not all human proteins acting in mitochondrial DNA transcription and replication. J. Biol. Chem. 285, 3939–3948. Carter, R.S., Avadhani, N.G., 1991. Cloning and characterization of the mouse cytochrome c oxidase subunit IV gene. Arch. Biochem. Biophys. 288, 97–106. Chen, Z.X., Pervaiz, S., 2009. Involvement of cytochrome c oxidase subunits Va and Vb in the regulation of cancer cell metabolism by Bcl-2. Cell Death Differ. 17, 408–420. Claros, M.G., Vincens, P., 1996. Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur. J. Biochem. 241, 779–786. Das, J., Miller, S.T., Stern, D.L., 2004. Comparison of diverse protein sequences of the nuclear-encoded subunits of cytochrome c oxidase suggests conservation of structure underlies evolving functional sites. Mol. Biol. Evol. 21 (8), 1572–1582. Diaz, F., 2010. Cytochrome c oxidase deficiency: patients and animal models. Biochim. Biophys. Acta 1802, 100–110. Dudkina, N.V., Sunderhaus, S., Boekema, E.J., Braun, H.P., 2008. The higher level of organization of the oxidative phosphorylation system: mitochondrial supercomplexes. J. Bioenerg. Biomembr. 40 (5), 419–424. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39 (4), 783–791. Fontanesi, F., Soto, I.C., Barrientos, A., 2008. Cytochrome c oxidase biogenesis: new levels of regulation. IUBMB Life 60 (9), 557–568. Fornuskova, D., Stiburek, L., Wenchich, L., Vinsova, K., Hansikova, H., Zeman, J., 2010. Novel insights into the assembly and function of human nuclear-encoded cytochrome c oxidase subunits 4, 5a, 6a, 7a and 7b. Biochem. J. 428, 363–374. Fukuda, R., Zhang, H., Kim, J.W., Shimoda, L., Dang, C.V., Semenza, G.L., 2007. HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells. Cell 129, 111–122. Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M.R., Appel, R.D., Bairoch, A., 2005. Protein identification and analysis tools on the ExPASy Server. In: Walker, J.M. (Ed.), The Proteomics Protocols Handbook. Humana Press, pp. 571–607. Grossman, L.I., Lomax, M.I., 1997. Nuclear genes for cytochrome c oxidase. Biochim. Biophys. Acta 1352, 171–192. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hüttemann, M., 2000. New isoforms of cytochrome c oxidase subunit IV in tuna fish. Biochim. Biophys. Acta 1492, 242–246. Hüttemann, M., Lee, I., Gao, X., Pecina, P., Pecinova, A., Liu, J., Aras, S., Sommer, N., Sanderson, T.H., Tost, M., Neff, F., Aguilar-Pimentel, J.A., Becker, L., Naton, B., Rathkolb, B., Rozman, J., Favor, J., Hans, W., Prehn, C., Puk, O., Schrewe, A., Sun, M., Höfler, H., Adamski, J., Bekeredjian, R., Graw, J., Adler, T., Busch, D.H., Klingenspor, M., Klopstock, T., Ollert, M., Wolf, E., Fuchs, H., Gailus-Durner, V., Hrabě de Angelis, M., Weissmann, N., Doan, J.W., Bassett, D.J., Grossman, L.I., 2012a. Cytochrome c oxidase subunit 4 isoform 2-knockout mice show reduced enzyme activity, airway hyporeactivity, and lung pathology. FASEB J. 26 (9), 3916–3930. Hüttemann, M., Helling, S., Sanderson, T.H., Sinkler, C., Samavati, L., Mahapatra, G., Varughese, A., Lu, G., Liu, J., Ramzan, R., Vogt, S., Grossman, L.I., Doan, J.W., Marcus, K., Lee, I., 2012b. Regulation of mitochondrial respiration and apoptosis through cell signalling: cytochrome c oxidase and cytochrome c in ischemia/reperfusion injury and inflammation. Biochim. Biophys. Acta 1817, 598–609.

39

Khalimonchuk, O., Rödel, G., 2005. Biogenesis of cytochrome c oxidase. Mitochondrion 5, 363–388. Lenka, N., Vijayasarathy, C., Mullick, J., Avadhani, N.G., 1998. Structural organization and transcription regulation of nuclear genes encoding the mammalian cytochrome c oxidase complex. Prog. Nucleic Acid Res. Mol. Biol. 61, 309–344. Li, Y., Park, J.S., Deng, J.H., Bai, Y., 2006. Cytochrome c oxidase subunit IV is essential for assembly and respiratory function of the enzyme complex. J. Bioenerg. Biomembr. 38, 283–291. Ludwig, B., Bender, E., Arnold, S., Hüttemann, M., Lee, I., Kadenbach, B., 2001. Cytochrome c oxidase and the regulation of oxidative phosphorylation. Chem. Biochem. 2, 392–403. Marchler-Bauer, A., Zheng, C., Chitsaz, F., Derbyshire, M.K., Geer, L.Y., Geer, R.C., Gonzales, N.R., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Lu, S., Marchler, G.H., Song, J.S., Thanki, N., Yamashita, R., Zhang, D., Bryant, S.H., 2013. CDD: conserved domains and protein three-dimensional structure. Nucleic Acids Res. 41, D348–D352. Martinez-Cruz, O., Calderon de la Barca, A.M., Uribe-Carvajal, S., Muhlia-Almazan, A., 2012. The mitocondrial FoF1 ATP-synthase function from the whiteleg shrimp Litopenaeus vannamei during hypoxia. Comp. Biochem. Physiol. B 162, 107–112. Mayevsky, A., Rogatsky, G.G., 2007. Mitochondrial function in vivo evaluated by NADH fluorescence: from animal models to human studies. Am. J. Physiol. Cell Physiol. 292, C615–C640. McDonald, A.E., Vanlerberghe, G.C., Staples, J.F., 2009. Alternative oxidase in animals: unique characteristics and taxonomic distribution. J. Exp. Biol. 212 (16), 2627–2634. Muhlia-Almazan, A., Martinez-Cruz, O., Navarrete del Toro, M.A., Garcia-Carreño, F.L., Arreola, R., Sotelo-Mundo, R., Yepiz-Plascencia, G., 2008. Nuclear and mitochondrial subunits from the white shrimp Litopenaeus vannamei FoF1 ATP-synthase complex: cDNA sequence, molecular modeling, and mRNA quantification of atp9 and atp6. J. Bioenerg. Biomembr. 40, 359–369. Ongwijitwat, S., Wong-Riley, M.T.T., 2005. Is nuclear respiratory factor 2 a master transcriptional coordinator for all ten-nuclear encoded cytochrome c oxidase subunits in neurons? Gene 360, 65–77. Ongwijitwat, S., Liang, H.L., Graboyes, E.M., Wong-Riley, M.T.T., 2006. Nuclear respiratory factor 2 senses changing cellular energy demands and its silencing downregulates cytochrome oxidase and other target mRNAs. Gene 374, 39–49. Paez-Osuna, F., Gracia, A., Flores-Verdugo, F., Lyle-Fritch, L.P., Alonso-Rodriguez, R., Roque, A., Ruiz-Fernandez, A.C., 2003. Shrimp aquaculture development and the environment in the Gulf of California ecoregion. Mar. Pollut. Bull. 46, 806–815. Pierron, D., Wildman, D.E., Hüttemann, M., Markondapatnaikuni, G.C., Aras, S., Grossman, L.I., 2012. Cytochrome c oxidase: evolution of control via nuclear subunit addition. Biochim. Biophys. Acta 1817 (4), 590–597. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3 (6), 1101–1108. Shen, X., Ren, J., Cui, Z., Sha, Z., Wang, B., Xiang, J., Liu, B., 2007. The complete mitochondrial genomes of two common shrimps (Litopenaeus vannamei and Fenneropenaeus chinensis) and their phylogenomic considerations. Gene 403, 98–109. Szal, B., Jolivet, Y., Hasenfratz-Sauder, M.P., Dizengremel, P., Rychter, A.M., 2003. Oxygen concentration regulates altenative oxidase expression in barley roots during hypoxia and post-hypoxia. Physiol. Plant. 119, 494–502. Szuplewski, S., Terracol, R., 2001. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit Vic homolog. Genetics 158, 1629–1643. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22 (22), 4673–4680. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R., Yoshikawa, S., 1996. The whole structure of the 13subunit oxidized cytochrome c oxidase at 2.8 A. Science 272, 1136–1144. Verkhovsky, M.I., Belevich, I., Bloch, D.A., Wikström, M., 2006. Elementary steps of proton translocation in the catalytic cycle of cytochrome oxidase. Biochim. Biophys. Acta 1757, 401–407. Vijayasarathy, C., Damle, S., Prabu, S.K., Otto, C.M., Avadhani, N.G., 2003. Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia. Eur. J. Biochem. 270, 871–879. Virbasius, J.V., Scarpulla, R.C., 1991. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene. Mol. Cell. Biol. 11 (11), 5631–5638. Yoshikawa, S., Muramoto, K., Shinzawa-I, K., Mochisuki, M., 2012. Structural studies on bovine heart cytochrome c oxidase. Biochim. Biophys. Acta 1817, 579–589. Zhang, Z.Y., Chen, B., Zhao, D.J., Kang, L., 2013. Functional modulation of mitochondrial cytochrome c oxidase underlies adaptation to high-altitude hypoxia in a Tibetan migratory locust. Proc. Biol. Sci. 280 (1756). Zuckerkandl, E., Pauling, L., 1965. Evolutionary divergence and convergence in proteins. In: Bryson, B., Vogel, H. (Eds.), Evolving Genes and Proteins. Academic Press, New York, pp. 97–166 (New York).