- Email: [email protected]
Three-step purification of gp96 from human liver tumor tissues suitable for isolation of gp96-bound peptides
Journal of Immunological Methods 264 (2002) 29 – 35 www.elsevier.com/locate/jim
Three-step purification of gp96 from human liver tumor tissues suitable for isolation of gp96-bound peptides Song-Dong Meng a, Jian Song a, Zihe Rao b, Po Tien a,*, George F. Gao a,c,d,* a Department of Molecular Virology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, PR China Laboratory of Structural Biology, Department of Biological Sciences and Biotechnology, MOE Protein Science Laboratory, Tsinghua University, Beijing 100084, PR China c Laboratory of Molecular Medicine, Children’s Hospital, Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 320 Longwood Avenue, Boston, MA 02115, USA d Department of Molecular and Cellular Biology, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138, USA b
Received 17 August 2001; received in revised form 29 October 2001; accepted 27 February 2002
Abstract Glycoprotein 96 (gp96), a member of heat shock protein (HSP) family, plays important roles in both innate immunity by itself and in T cell adaptive immunity in complex with antigenic-specific peptides. Using ammonium sulfate precipitation, ConA-Sepharose affinity chromatography and anion exchange chromatography, we have successfully purified gp96 from human liver tumor tissues. Subsequently, the gp96-associated peptides were successfully isolated from the gp96 preparation in quantities sufficient for micro-sequencing and identification of the peptides [Lancet 357 (2001) 528]. This three-step purification method might be used as a universal technique for the easy and reproducible isolation of antigenic heat shock protein gp96 from liver tissue or even other tissues of different sources. This will inevitably trigger the search for antigenicspecific peptides bound to gp96. Here, we report the method in detail. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Purification; gp96; Peptide isolation; Tumor tissues
1. Introduction Heat shock protein (HSP) gp96 (glycoprotein 96), also known as glucose-regulated protein 94 (grp94), is Abbreviations: HSP, heat shock protein; gp96, glycoprotein 96; ER, endoplasmic reticulum; HBV, hepatitis B virus. * Corresponding authors. George F. Gao and Po Tien, Present address (G.F.G.): Room 7508, Nuffield Department of Clinical Medicine, John Radcliffe Hospital, University of Oxford, Headington, Oxford OX3 9DU, UK. Tel.: +44-1865-221-335; fax: +441865-220-993. E-mail addresses: [email protected] (P. Tien), [email protected] (G.F. Gao).
an endoplasmic reticulum (ER) counterpart of the cytosolic HSP 90 family member of molecular chaperones that are important for protein folding and transportation. The protein exists as a transmembrane molecule, containing a carboxyl terminal ER retention motif sequence (KDEL) which gives a feedback signal to the ER. It is also expressed on the surface of certain tumor cells (Li, 1997; Robert et al., 1999). Moreover, in recent years, it has been observed that gp96 molecules purified from tumor tissues or virusinfected cells elicit rejection and immunotherapeutic immunogenicity against tumors or viral infections (Udono et al., 1994; Tamura et al., 1997; Chandawar-
0022-1759/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 0 2 2 - 1 7 5 9 ( 0 2 ) 0 0 0 9 3 - 5
30
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
kar et al., 1999; Janetzki et al., 2000; Srivastava and Amato, 2001). Further study has indicated that gp96 can chaperone the endogenous repertoire of peptides generated within the cell, including the antigenic peptides (Srivastava, 2000). The gp96 molecules may present peptides associated with them to major histocompatibility complex (MHC, or HLA in human) class I molecules for recognition by cytotoxic T lymphocytes (CTL) and thereby elicit cellular immune responses (Suto and Srivastava, 1995; Janetzki et al., 1998). Recently, it has been shown that the gp96 molecule can be taken up by macrophages and dendritic cells through its CD91 receptor pathway (Binder et al., 2000b; Basu et al., 2001). In addition to the immune effects in tumors and viral infections, gp96peptide preparations from mice infected with intracellular bacteria have been shown to exhibit potent protection against subsequent challenge and elicit cytotoxic T lymphocyte (CTL) responses to bacterial pathogens (Zugel et al., 2001). Moreover, in the absence of the antigenic peptides associated with it, gp96 itself can activate macrophages and T cells to secrete cytokines such as IFN-g, TNF-a and IL-12, inducing the maturation and migration of dendritic cells for subsequent CD8 + cell activation (Li, 1997; Binder et al., 2000a). Therefore, gp96-peptide preparations represent a novel strategy for prophylactic and therapeutic vaccines against cancers, and both viral and bacterial infections. It will be important to obtain quantities of the purified gp96-peptide preparation from patient tissues for determination of the identity of the bound peptides and in vitro gp96-peptide assembly usage for vaccines in the future. Srivastava and colleagues have pioneered the field and developed the methods for preparation of the divergent HSPs (Srivastava, 1997; Srivastava and Jaikaria, 2001). Based on Srivastava’s methods, we have developed a rapid and efficient protocol for the isolation and purification of gp96 from liver tumor tissues. The preparation is pure and recoveries are sufficient enough for micro-sequencing of the bound peptides. This permitted us to identify a hepatitis B virus (HBV) specific peptide bound to gp96 prepared from livers of HBV-positive hepatic carcinoma patients (Meng et al., 2001). Here, we describe the detailed method we have used for gp96 preparation and bound peptide isolation from human liver tissues.
2. Materials and methods 2.1. Liver tissues Three more patients, in addition to our previously reported three patients (Meng et al., 2001), who were seropositive for HBsAg, anti-HBe and anti-HBc, were clinically diagnosed as having HBV-induced hepatocellular carcinoma (see Table 1 for details). Tumor tissue samples measuring about 10 cm in diameter, weighing about 100 g, were resected from each patient. Liver tissues from three uninfected healthy individuals, who died from traffic accidents, were used as control tissue. Approval from the institutional bioethics committee and informed consent from all patients and the relatives of the healthy accident victims were obtained. All of the samples were frozen at 70 jC before use. 2.2. Step 1 of gp96 purification: ammonium sulfate precipitation Liver tissues were suspended in four volumes of 30 mM sodium bicarbonate, pH 7.0, containing 1 mM PMSF, and homogenized until > 95% cells were lysed. The lysate was centrifuged for 30 min at 5000 g, and then at 100,000 g for 90 min to remove nuclei and other debris. The supernatant was precipitated with ammonium sulfate (50 –70%) and solubilized in 20 mM Tris – HCl (pH 7.4) containing 500 mM NaCl, 2 mM each of Ca2 + and Mg2 + , 1 mM PMSF. 2.3. Step 2 of gp96 purification: ConA-Sepharose affinity chromatography The above solubilized protein was applied to a ConA-Sepharose column (Pharmacia Biotech, Uppsala, Sweden). The column was washed with fourTable 1 Characteristics of the patients studied Patient
Sex/race
Age
HLA type
1 2 3 4 5 6
Male/Asian Male/Asian Male/Asian Male/Asian Female/Asian Male/Asian
58 64 39 50 49 31
A1, A2 A3, A26 A11, A31 A2, A11 A2, A26 A25, A31
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
column volumes of the same Tris –HCl buffer as in step 1 and the bound proteins were eluted with three-column volumes of Tris – HCl buffer containing 10% a-methylmannopyrannoside. The eluted material was transferred to Tris – HCl buffer (20 mM Tris, pH 7.4) containing 200 mM NaCl by buffer exchange on Sephadex G25 (Pharmacia Biotech). 2.4. Step 3 of gp96 purification: anion exchange chromatography The buffer-exchanged sample was applied to POROS 20QE column (4.6 100 mm, PE Biosystem, Foster City, CA, USA) on a BioCAD Workstation for perfusion chromatography (Perkin-Elmer, Wellesley, MA, USA) and eluted first with a one-step elution using 300 mM NaCl until the absorbance at 280 nm was stable, then with a 300 to 1000 mM NaCl gradient. Fractions (1.3 ml) were collected and analyzed by 10% SDS-polyacrylamide gel (SDS-PAGE) and silver-staining. The identity of the gp96 was confirmed by immunoblotting using anti-gp96/grp94 monoclonal antibody (NeoMarkers, Fremont, USA). Fractions containing a single gp96 band on silverstained gels were used in subsequent experiments. The quantities of gp96 were estimated by the following formula: c = 1.45A280 0.74A260, where c is the concentration of total protein, and A280 and A260 represent absorbance at 280 and 260 nm, respectively. 2.5. Identification of antigenic peptides associated with gp96 The gp96 collections were pooled and washed several times with distilled water by ultrafiltration to remove any peptides loosely associated with it. The material was concentrated by ultrafiltration and trifluoroacetic acid (TFA) was added to obtain a final concentration of 0.2% TFA (usually pH 2.0). Then, it was incubated for 15 min at 4 jC. The bound peptides were separated from gp96 by Centricon centrifugation (molecular mass cutoff 10 kDa; Pall Filtron, Northborough, MA). The separated peptides were analyzed by MALDI mass spectrometry on the Voyager-DE system (PE Biosystems). Bulk peptide fraction isolated from gp96 was dried by vacuum centrifugation, redissolved in solution A (0.065% TFA in 2% acetonitrile), and applied to a C18
31
reverse-phase column (Sephasil Peptide C18; 5 Am particles; 4.6 250 mm, Pharmacia Biotech) using PE Biosystem BioCAD Workstation (PE Biosystems) with absorbance monitored at 214 nm. The gradient was generated using a linear increase from 0 to 65% buffer B (0.05% TFA in 100% acetonitrile) with a flow rate of 1 ml/min within 110 min. One peak specific to the preparations from the tumors was manually collected and subjected to mass spectrometric analysis. When the peptide collections were revealed to be impure, they were re-run on the HPLC column with a less steep gradient (15 – 25% acetonitrile in 100 ml). The amino acid sequencing of the purified material was then performed on a Procisek 491 Protein Sequence System (PE Applied Biosystems, Foster City, CA, USA) based on Edman N-terminal degradation. 2.6. Detection of the HBV DNA covering the specific peptide region in liver tissues Total DNA was extracted from tumor tissues using a standard phenol – chloroform extraction method. PCR was performed using 5Vprimer (5V G G G G G AT C C G C A C T C A G G C A A G C A AT TCTTTGC 3V, nt 2060 – 2083 in the HBV core gene sequence) and 3Vprimer (5V GGGGAGCTCCGAGGGAGTTCTTCTTCTAGG 3V, nt 2386 – 2366 in the HBV core gene sequence) for 30 cycles (94 jC, 40 s; 58 jC, 40 s; 72 jC, 40 s). The primers were designed according to the HBV core gene sequence from the GenBank, accession number AF121242. Then the PCR product was inserted into pBluescript KS (M13 ) within predesigned BamHI and SacI site in the primers for DNA sequencing. This was done using the ABI system, which is based on Sanger’s method.
3. Results 3.1. Purification of gp96 from liver tissues The flowchart diagram of the whole purification process is shown in Fig. 1. Approximately 20 – 30 Ag of apparently homogeneous preparations of gp96 were obtained from each gram of wet weight of the three control tissues by this method, while 50 –80 Ag of gp96 were obtained from tumor tissues. In the last step of the purification on the POROS 20QE column,
32
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
preparation, which initially shows only a single band on SDS-PAGE, may develop several higher and even lower molecular weight bands after some time of storage even frozen at 20 jC in Tris – HCl buffer. 3.2. Extraction of noncovalently associated peptides from gp96 Low molecular weight material associated with gp96 from six tumor tissue samples and three nontumor tissue control samples were isolated by acid treatment. The total peptide mixtures were first analyzed by mass spectrometry (Fig. 4A). The results showed that a large number of peptides were obtained, and the molecular masses of most of them ranged from 600 to 1100 Da, indicating that peptides associated with gp96 in liver tissues were heterogeneous in length. About 80 g of liver tissue of each tumor sample were used for gp96 purification. The present purification protocol yielded approximately 50 –80 Ag (equivalent to 520– 830 pmol) of gp96 protein from 1 g of liver tissue. We assume that each gp96 molecule associates with one peptide (Sastry and Linderoth, 1999), half of the gp96 molecules bind peptides, and the efficiency of peptide extraction using the acid elution is about 80%. As the peptide repertoire associated with gp96 is very complex and could exceed 50
Fig. 1. Flowchart diagram of gp96 isolation from liver tissue.
gp96 eluted within a wide range of salt concentration (500 – 800 mM NaCl) (Fig. 2). However, all peak fractions in the wide range contained apparently homogeneous gp96 as judged by silver-stained gels (Fig. 3A). The purity of the gp96 preparations was determined by a silver-stained SDS-polyacrylamide gel (Fig. 3A) and its identity was confirmed by immunoblotting (Fig. 3B). Clearly, a single band was detected in gp96 preparations from both control and tumor tissues. Using the purification procedures mentioned above, we routinely obtained gp96 of over 95% purity as judged by SDS-PAGE silver-staining and reverse-phase HPLC. It should be noted that purified gp96 preparation must be used immediately for acid extraction. A
Fig. 2. POROS 20QE column chromatography. Samples were applied to 20QE column (4.6 100 mm) and were first eluted with 300 mM NaCl and then with a linear 300 – 1000 mM NaCl gradient in 30 ml. The flow rate was 3 ml/min. Fractions of 1.3 ml were collected. The gp96 was eluted within 500 – 800 mM NaCl as indicated by the arrows on the chromatographic profile.
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
33
The filtrates were applied to a C18 reverse-phase column and separated by HPLC. Sequencing of the specific peptides from the tumor samples revealed its amino acid sequence as YVNTNMG. The sequences from all the six tumor samples were exactly the same. The deduced mass of the 7-mer peptide was 797.94, which differs no more than 1 Da from the one detected by mass spectrometry (Fig. 4B). The 7-mer peptide was identified as a core antigen derived from amino acid residues 88– 94 in core protein of HBV. 3.4. DNA sequencing of the specific region covering the identified peptide region We also sequenced the sequence corresponding to codon 88 –94 in the core gene of HBV from one of the HBV-infected tumor tissues and this yielded a sequence of ‘‘TATGTCAATACTAATATGGGC’’. The
Fig. 3. Homogeneous elutions of gp96 from 500 to 800 mM NaCl detected by SDS-PAGE and immunoblot. The gp96 preparations were collected as 1.3 ml fractions and a total of 10 individual fractions (lanes 1 – 10) were run on the SDS-PAGE gel with silverstaining (A). The corresponding fractions (lanes 1 – 10) were immunoblotted with anti-gp96/grp94 monoclonal antibody (B).
different peptides (as shown in Fig. 4A), the bulk peptide must be divided by this number to obtain the average molar amount of individual peptide. From the HPLC profile, we also estimated the specific peptide peak consisted of about 2% of the total peptides associated with gp96. If the recovery of HPLC is around 90%, the amount of peptide specific to tumor tissues can be calculated as follows: 80 (520 – 830) 1/2 0.8 0.02 0.9 = 300 – 478 pmol. 3.3. Amino acid sequencing of the specific peptide from purified gp96 The purified gp96 preparation was extracted with TFA and the low molecular weight material isolated by Centricon centrifugation (Centricon-10, which allows passage of molecules of less than 10 kDa).
Fig. 4. MALDI-TOF mass spectra of the isolated peptides. Bulk peptides (A) associated with gp96 and the isolated peptide (B) specific for HBV-induced hepatocellular carcinoma from tumor tissue (from patient 1) are presented here. In mass spectrum B, a single peptide of about 798 Da was detected without obvious contamination, and the identical molecular mass was also identified in A as indicated by the arrow with a molecular mass of 798 Da.
34
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
Fig. 5. Direct sequencing of HBV-DNA gene segment encoding the specific peptide from HBV-infected tumor tissue. This clearly shows the existence of the coding sequence of the isolated peptide, YVNTNMG.
deduced amino acid sequence was identical to the one obtained by Edman sequencing of the peptide (Fig. 5). These data supported the notion that the specific 7mer peptide isolated from gp96 was actually derived from HBV core protein.
4. Discussion Using a three-step purification consisting of ammonium sulfate precipitation, ConA-Sepharose affinity chromatography and anion exchange chromatography, we have successfully purified gp96 from human liver tissues. We routinely obtained about 20– 30 Ag/g of gp96 (over 95% purity) from normal tissue and 50 – 80 Ag/g from tumor tissues. The total recovery of gp96 by this method was estimated to be between 20 – 30% (Srivastava, 1997; Srivastava and Jaikaria, 2001). We also evaluated the addition of an extra step of DEAE-Sepharose chromatography in our purification steps as described by Srivastava (Srivastava, 1997; Srivastava and Jaikaria, 2001), but it did not give any obvious improvements. Therefore, our threestep purification method does not include this weak anion exchange chromatography step. It should be noted that although the ammonium sulfate precipitation step does not increase the purity of the final gp96 preparation as observed in our laboratory; it is necessary since it can effectively dilapidate samples. Experience suggests that lipids in liver tissues may cause irreversible fouling of the columns. One problem we encountered in gp96 purification was its instability and tendency to aggregate, which has also been observed by Srivastava et al. (Srivastava, 1997; Srivastava and Jaikaria, 2001). Therefore, in our experi-
ments, the purified gp96 preparations were usually used for acid peptide extraction on the same day of purification. gp96 may be among the ‘‘stickiest’’ proteins in the cell (Csermely et al., 1998). It is not recommended to store gp96 at concentrations of more than 1 mg/ml. At concentrations of 10 mg/ml, gp96 preparations will resemble a ‘‘molecular glue’’ due to oligomerization after a week, even when stored at 70 jC. Lyophilization cannot be used for long-term gp96 storage as this will cause it to become irreversibly insoluble (unpublished observation). Recently, the basis of this aggregation has been partly elucidated (Sastry and Linderoth, 1999). It was suggested that the gp96 molecule contains a dimerization domain (amino acid residues 692 – 709) in the C-terminal region, and can form a dimer or higher ordered oligomers which reach a molecular mass of hundreds of kilodaltons. In gp96 oligomers, the peptide-binding site may be concealed or less accessible, which will inevitably affect the efficiency of using gp96 for peptide extractions or as a tumor vaccine. This should be addressed in more detail in future studies. We routinely obtain apparently homogeneous gp96 within a wide range of salt concentrations in the last purification step. However, in two liver tumor samples, several other bands could be detected on the silver-stained SDS-PAGE in some eluted fractions that were not used for peptide extractions. The impurities are likely to be proteins bound to gp96, which cannot be separated by our current methods. gp96 associates with numerous other proteins, such as protein kinase, actin filaments, as well as other molecular chaperones of the ER where there are extremely high protein concentrations (estimated to be around 100 mg/ml) (Csermely et al., 1998). Therefore, it is
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
conceivable that strong binding can occur between gp96 and other proteins. To verify the efficiency and validity of the purification method, we extracted and identified the peptides associated with gp96. Mass spectrometry analysis showed that the purified gp96 chaperoned various peptides generated within the cell, with lengths ranging from a 6-mer to more than a 10-mer, supporting the notion that the mean molecular weight of amino acid residues is 110 Da. Furthermore, one 7-mer peptide associated with gp96 was identified to be derived from HBV core protein (Meng et al., 2001). Our results do show that the gp96 preparations purified by this method were associated with the endogenous repertoire of peptides, including the antigenic ones derived from HBV. We recently found that the 7-mer peptide and its 9-mer homologues (Tsai et al., 1996) could be assembled with HLA-A * 1101 and h2 m into HLA – peptide complex in vitro (Rao and Gao, unpublished data). The three-step purification method might be used as a universal technique for the easy and reproducible isolation of heat shock protein gp96 for vaccine development, especially for the identification of the associated peptides from liver tissue or even other tissues of different sources. This will facilitate in vitro assembly of the defined antigenic peptides and the use of gp96 vaccines, especially therapeutic vaccines, against HBV-induced hepatic carcinoma. Acknowledgements This work was supported by a grant from China National Frontier Research Program (Grant No. G1999075602) and ‘‘one-to-one’’ Program of National 863 Project (to SDM and GFG). GFG is a Wellcome Trust (UK) International Research Fellow at Harvard. We thank Prof. Wei-Feng Chen (Peking Medical School, Peking University) for his help. References Basu, S., Binder, R.J., Ramalingam, T., Srivastava, P.K., 2001. CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 14, 303 – 313. Binder, R.J., Anderson, K.M., Basu, S., Srivastava, P.K., 2000a. Cutting edge: heat shock protein gp96 induces maturation and migration of CD11c+ cells in vivo. J. Immunol. 165, 6029 – 6035.
35
Binder, R.J., Han, D.K., Srivastava, P.K., 2000b. CD91: a receptor for heat shock protein gp96. Nat. Immunol. 1, 151 – 155. Chandawarkar, R.Y., Wagh, M.S., Srivastava, P.K., 1999. The dual nature of specific immunological activity of tumor-derived gp96 preparations. J. Exp. Med. 189, 1437 – 1442. Csermely, P., Schnaider, T., Soti, C., Prohaszka, Z., Nardai, G., 1998. The 90-kDa molecular chaperone family: structure, function, and clinical applications. A comprehensive review. Pharmacol. Ther. 79, 129 – 168. Janetzki, S., Blachere, N.E., Srivastava, P.K., 1998. Generation of tumor-specific cytotoxic T lymphocytes and memory T cells by immunization with tumor-derived heat shock protein gp96. J. Immunother. 21, 269 – 276. Janetzki, S., Palla, D., Rosenhauer, V., Lochs, H., Lewis, J.J., Srivastava, P.K., 2000. Immunization of cancer patients with autologous cancer-derived heat shock protein gp96 preparations: a pilot study. Int. J. Cancer 88, 232 – 238. Li, Z., 1997. Priming of T cells by heat shock protein – peptide complexes as the basis of tumor vaccines. Semin. Immunol. 9, 315 – 322. Meng, S.D., Gao, T., Gao, G.F., Tien, P., 2001. HBV-specific peptide associated with heat-shock protein gp96. Lancet 357, 528 – 529. Robert, J., Menoret, A., Cohen, N., 1999. Cell surface expression of the endoplasmic reticular heat shock protein gp96 is phylogenetically conserved. J. Immunol. 163, 4133 – 4139. Sastry, S., Linderoth, N., 1999. Molecular mechanisms of peptide loading by the tumor rejection antigen/heat shock chaperone gp96 (GRP94). J. Biol. Chem. 274, 12023 – 12035. Srivastava, P.K., 1997. Purification of heat shock protein – peptide complexes for use in vaccination against cancers and intracellular pathogens. Methods 12, 165 – 171. Srivastava, P.K., 2000. Immunotherapy of human cancer: lessons from mice. Nat. Immunol. 1, 363 – 366. Srivastava, P.K., Amato, R.J., 2001. Heat shock proteins: the ‘Swiss Army Knife’ vaccines against cancers and infectious agents. Vaccine 19, 2590 – 2597. Srivastava, P.K., Jaikaria, N.S., 2001. Methods of purification of heat shock protein – peptide complexes for use as vaccines against cancers and infectious diseases. Methods Mol. Biol. 156, 175 – 186. Suto, R., Srivastava, P.K., 1995. A mechanism for the specific immunogenicity of heat shock protein-chaperoned peptides. Science 269, 1585 – 1588. Tamura, Y., Peng, P., Liu, K., Daou, M., Srivastava, P.K., 1997. Immunotherapy of tumors with autologous tumor-derived heat shock protein preparations. Science 278, 117 – 120. Tsai, S.L., Chen, M.H., Yeh, C.T., Chu, C.M., Lin, A.N., Chiou, F.H., Chang, T.H., Liaw, Y.F., 1996. Purification and characterization of a naturally processed hepatitis B virus peptide recognized by CD8+ cytotoxic T lymphocytes. J. Clin. Invest. 97, 577 – 584. Udono, H., Levey, D.L., Srivastava, P.K., 1994. Cellular requirements for tumor-specific immunity elicited by heat shock proteins: tumor rejection antigen gp96 primes CD8+ T cells in vivo. Proc. Natl. Acad. Sci. U. S. A. 91, 3077 – 3081. Zugel, U., Sponaas, A.M., Neckermann, J., Schoel, B., Kaufmann, S.H., 2001. gp96-peptide vaccination of mice against intracellular bacteria. Infect. Immun. 69, 4164 – 4167.
Three-step purification of gp96 from human liver tumor tissues suitable for isolation of gp96-bound peptides Song-Dong Meng a, Jian Song a, Zihe Rao b, Po Tien a,*, George F. Gao a,c,d,* a Department of Molecular Virology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, PR China Laboratory of Structural Biology, Department of Biological Sciences and Biotechnology, MOE Protein Science Laboratory, Tsinghua University, Beijing 100084, PR China c Laboratory of Molecular Medicine, Children’s Hospital, Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 320 Longwood Avenue, Boston, MA 02115, USA d Department of Molecular and Cellular Biology, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138, USA b
Received 17 August 2001; received in revised form 29 October 2001; accepted 27 February 2002
Abstract Glycoprotein 96 (gp96), a member of heat shock protein (HSP) family, plays important roles in both innate immunity by itself and in T cell adaptive immunity in complex with antigenic-specific peptides. Using ammonium sulfate precipitation, ConA-Sepharose affinity chromatography and anion exchange chromatography, we have successfully purified gp96 from human liver tumor tissues. Subsequently, the gp96-associated peptides were successfully isolated from the gp96 preparation in quantities sufficient for micro-sequencing and identification of the peptides [Lancet 357 (2001) 528]. This three-step purification method might be used as a universal technique for the easy and reproducible isolation of antigenic heat shock protein gp96 from liver tissue or even other tissues of different sources. This will inevitably trigger the search for antigenicspecific peptides bound to gp96. Here, we report the method in detail. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Purification; gp96; Peptide isolation; Tumor tissues
1. Introduction Heat shock protein (HSP) gp96 (glycoprotein 96), also known as glucose-regulated protein 94 (grp94), is Abbreviations: HSP, heat shock protein; gp96, glycoprotein 96; ER, endoplasmic reticulum; HBV, hepatitis B virus. * Corresponding authors. George F. Gao and Po Tien, Present address (G.F.G.): Room 7508, Nuffield Department of Clinical Medicine, John Radcliffe Hospital, University of Oxford, Headington, Oxford OX3 9DU, UK. Tel.: +44-1865-221-335; fax: +441865-220-993. E-mail addresses: [email protected] (P. Tien), [email protected] (G.F. Gao).
an endoplasmic reticulum (ER) counterpart of the cytosolic HSP 90 family member of molecular chaperones that are important for protein folding and transportation. The protein exists as a transmembrane molecule, containing a carboxyl terminal ER retention motif sequence (KDEL) which gives a feedback signal to the ER. It is also expressed on the surface of certain tumor cells (Li, 1997; Robert et al., 1999). Moreover, in recent years, it has been observed that gp96 molecules purified from tumor tissues or virusinfected cells elicit rejection and immunotherapeutic immunogenicity against tumors or viral infections (Udono et al., 1994; Tamura et al., 1997; Chandawar-
0022-1759/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 0 2 2 - 1 7 5 9 ( 0 2 ) 0 0 0 9 3 - 5
30
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
kar et al., 1999; Janetzki et al., 2000; Srivastava and Amato, 2001). Further study has indicated that gp96 can chaperone the endogenous repertoire of peptides generated within the cell, including the antigenic peptides (Srivastava, 2000). The gp96 molecules may present peptides associated with them to major histocompatibility complex (MHC, or HLA in human) class I molecules for recognition by cytotoxic T lymphocytes (CTL) and thereby elicit cellular immune responses (Suto and Srivastava, 1995; Janetzki et al., 1998). Recently, it has been shown that the gp96 molecule can be taken up by macrophages and dendritic cells through its CD91 receptor pathway (Binder et al., 2000b; Basu et al., 2001). In addition to the immune effects in tumors and viral infections, gp96peptide preparations from mice infected with intracellular bacteria have been shown to exhibit potent protection against subsequent challenge and elicit cytotoxic T lymphocyte (CTL) responses to bacterial pathogens (Zugel et al., 2001). Moreover, in the absence of the antigenic peptides associated with it, gp96 itself can activate macrophages and T cells to secrete cytokines such as IFN-g, TNF-a and IL-12, inducing the maturation and migration of dendritic cells for subsequent CD8 + cell activation (Li, 1997; Binder et al., 2000a). Therefore, gp96-peptide preparations represent a novel strategy for prophylactic and therapeutic vaccines against cancers, and both viral and bacterial infections. It will be important to obtain quantities of the purified gp96-peptide preparation from patient tissues for determination of the identity of the bound peptides and in vitro gp96-peptide assembly usage for vaccines in the future. Srivastava and colleagues have pioneered the field and developed the methods for preparation of the divergent HSPs (Srivastava, 1997; Srivastava and Jaikaria, 2001). Based on Srivastava’s methods, we have developed a rapid and efficient protocol for the isolation and purification of gp96 from liver tumor tissues. The preparation is pure and recoveries are sufficient enough for micro-sequencing of the bound peptides. This permitted us to identify a hepatitis B virus (HBV) specific peptide bound to gp96 prepared from livers of HBV-positive hepatic carcinoma patients (Meng et al., 2001). Here, we describe the detailed method we have used for gp96 preparation and bound peptide isolation from human liver tissues.
2. Materials and methods 2.1. Liver tissues Three more patients, in addition to our previously reported three patients (Meng et al., 2001), who were seropositive for HBsAg, anti-HBe and anti-HBc, were clinically diagnosed as having HBV-induced hepatocellular carcinoma (see Table 1 for details). Tumor tissue samples measuring about 10 cm in diameter, weighing about 100 g, were resected from each patient. Liver tissues from three uninfected healthy individuals, who died from traffic accidents, were used as control tissue. Approval from the institutional bioethics committee and informed consent from all patients and the relatives of the healthy accident victims were obtained. All of the samples were frozen at 70 jC before use. 2.2. Step 1 of gp96 purification: ammonium sulfate precipitation Liver tissues were suspended in four volumes of 30 mM sodium bicarbonate, pH 7.0, containing 1 mM PMSF, and homogenized until > 95% cells were lysed. The lysate was centrifuged for 30 min at 5000 g, and then at 100,000 g for 90 min to remove nuclei and other debris. The supernatant was precipitated with ammonium sulfate (50 –70%) and solubilized in 20 mM Tris – HCl (pH 7.4) containing 500 mM NaCl, 2 mM each of Ca2 + and Mg2 + , 1 mM PMSF. 2.3. Step 2 of gp96 purification: ConA-Sepharose affinity chromatography The above solubilized protein was applied to a ConA-Sepharose column (Pharmacia Biotech, Uppsala, Sweden). The column was washed with fourTable 1 Characteristics of the patients studied Patient
Sex/race
Age
HLA type
1 2 3 4 5 6
Male/Asian Male/Asian Male/Asian Male/Asian Female/Asian Male/Asian
58 64 39 50 49 31
A1, A2 A3, A26 A11, A31 A2, A11 A2, A26 A25, A31
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
column volumes of the same Tris –HCl buffer as in step 1 and the bound proteins were eluted with three-column volumes of Tris – HCl buffer containing 10% a-methylmannopyrannoside. The eluted material was transferred to Tris – HCl buffer (20 mM Tris, pH 7.4) containing 200 mM NaCl by buffer exchange on Sephadex G25 (Pharmacia Biotech). 2.4. Step 3 of gp96 purification: anion exchange chromatography The buffer-exchanged sample was applied to POROS 20QE column (4.6 100 mm, PE Biosystem, Foster City, CA, USA) on a BioCAD Workstation for perfusion chromatography (Perkin-Elmer, Wellesley, MA, USA) and eluted first with a one-step elution using 300 mM NaCl until the absorbance at 280 nm was stable, then with a 300 to 1000 mM NaCl gradient. Fractions (1.3 ml) were collected and analyzed by 10% SDS-polyacrylamide gel (SDS-PAGE) and silver-staining. The identity of the gp96 was confirmed by immunoblotting using anti-gp96/grp94 monoclonal antibody (NeoMarkers, Fremont, USA). Fractions containing a single gp96 band on silverstained gels were used in subsequent experiments. The quantities of gp96 were estimated by the following formula: c = 1.45A280 0.74A260, where c is the concentration of total protein, and A280 and A260 represent absorbance at 280 and 260 nm, respectively. 2.5. Identification of antigenic peptides associated with gp96 The gp96 collections were pooled and washed several times with distilled water by ultrafiltration to remove any peptides loosely associated with it. The material was concentrated by ultrafiltration and trifluoroacetic acid (TFA) was added to obtain a final concentration of 0.2% TFA (usually pH 2.0). Then, it was incubated for 15 min at 4 jC. The bound peptides were separated from gp96 by Centricon centrifugation (molecular mass cutoff 10 kDa; Pall Filtron, Northborough, MA). The separated peptides were analyzed by MALDI mass spectrometry on the Voyager-DE system (PE Biosystems). Bulk peptide fraction isolated from gp96 was dried by vacuum centrifugation, redissolved in solution A (0.065% TFA in 2% acetonitrile), and applied to a C18
31
reverse-phase column (Sephasil Peptide C18; 5 Am particles; 4.6 250 mm, Pharmacia Biotech) using PE Biosystem BioCAD Workstation (PE Biosystems) with absorbance monitored at 214 nm. The gradient was generated using a linear increase from 0 to 65% buffer B (0.05% TFA in 100% acetonitrile) with a flow rate of 1 ml/min within 110 min. One peak specific to the preparations from the tumors was manually collected and subjected to mass spectrometric analysis. When the peptide collections were revealed to be impure, they were re-run on the HPLC column with a less steep gradient (15 – 25% acetonitrile in 100 ml). The amino acid sequencing of the purified material was then performed on a Procisek 491 Protein Sequence System (PE Applied Biosystems, Foster City, CA, USA) based on Edman N-terminal degradation. 2.6. Detection of the HBV DNA covering the specific peptide region in liver tissues Total DNA was extracted from tumor tissues using a standard phenol – chloroform extraction method. PCR was performed using 5Vprimer (5V G G G G G AT C C G C A C T C A G G C A A G C A AT TCTTTGC 3V, nt 2060 – 2083 in the HBV core gene sequence) and 3Vprimer (5V GGGGAGCTCCGAGGGAGTTCTTCTTCTAGG 3V, nt 2386 – 2366 in the HBV core gene sequence) for 30 cycles (94 jC, 40 s; 58 jC, 40 s; 72 jC, 40 s). The primers were designed according to the HBV core gene sequence from the GenBank, accession number AF121242. Then the PCR product was inserted into pBluescript KS (M13 ) within predesigned BamHI and SacI site in the primers for DNA sequencing. This was done using the ABI system, which is based on Sanger’s method.
3. Results 3.1. Purification of gp96 from liver tissues The flowchart diagram of the whole purification process is shown in Fig. 1. Approximately 20 – 30 Ag of apparently homogeneous preparations of gp96 were obtained from each gram of wet weight of the three control tissues by this method, while 50 –80 Ag of gp96 were obtained from tumor tissues. In the last step of the purification on the POROS 20QE column,
32
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
preparation, which initially shows only a single band on SDS-PAGE, may develop several higher and even lower molecular weight bands after some time of storage even frozen at 20 jC in Tris – HCl buffer. 3.2. Extraction of noncovalently associated peptides from gp96 Low molecular weight material associated with gp96 from six tumor tissue samples and three nontumor tissue control samples were isolated by acid treatment. The total peptide mixtures were first analyzed by mass spectrometry (Fig. 4A). The results showed that a large number of peptides were obtained, and the molecular masses of most of them ranged from 600 to 1100 Da, indicating that peptides associated with gp96 in liver tissues were heterogeneous in length. About 80 g of liver tissue of each tumor sample were used for gp96 purification. The present purification protocol yielded approximately 50 –80 Ag (equivalent to 520– 830 pmol) of gp96 protein from 1 g of liver tissue. We assume that each gp96 molecule associates with one peptide (Sastry and Linderoth, 1999), half of the gp96 molecules bind peptides, and the efficiency of peptide extraction using the acid elution is about 80%. As the peptide repertoire associated with gp96 is very complex and could exceed 50
Fig. 1. Flowchart diagram of gp96 isolation from liver tissue.
gp96 eluted within a wide range of salt concentration (500 – 800 mM NaCl) (Fig. 2). However, all peak fractions in the wide range contained apparently homogeneous gp96 as judged by silver-stained gels (Fig. 3A). The purity of the gp96 preparations was determined by a silver-stained SDS-polyacrylamide gel (Fig. 3A) and its identity was confirmed by immunoblotting (Fig. 3B). Clearly, a single band was detected in gp96 preparations from both control and tumor tissues. Using the purification procedures mentioned above, we routinely obtained gp96 of over 95% purity as judged by SDS-PAGE silver-staining and reverse-phase HPLC. It should be noted that purified gp96 preparation must be used immediately for acid extraction. A
Fig. 2. POROS 20QE column chromatography. Samples were applied to 20QE column (4.6 100 mm) and were first eluted with 300 mM NaCl and then with a linear 300 – 1000 mM NaCl gradient in 30 ml. The flow rate was 3 ml/min. Fractions of 1.3 ml were collected. The gp96 was eluted within 500 – 800 mM NaCl as indicated by the arrows on the chromatographic profile.
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
33
The filtrates were applied to a C18 reverse-phase column and separated by HPLC. Sequencing of the specific peptides from the tumor samples revealed its amino acid sequence as YVNTNMG. The sequences from all the six tumor samples were exactly the same. The deduced mass of the 7-mer peptide was 797.94, which differs no more than 1 Da from the one detected by mass spectrometry (Fig. 4B). The 7-mer peptide was identified as a core antigen derived from amino acid residues 88– 94 in core protein of HBV. 3.4. DNA sequencing of the specific region covering the identified peptide region We also sequenced the sequence corresponding to codon 88 –94 in the core gene of HBV from one of the HBV-infected tumor tissues and this yielded a sequence of ‘‘TATGTCAATACTAATATGGGC’’. The
Fig. 3. Homogeneous elutions of gp96 from 500 to 800 mM NaCl detected by SDS-PAGE and immunoblot. The gp96 preparations were collected as 1.3 ml fractions and a total of 10 individual fractions (lanes 1 – 10) were run on the SDS-PAGE gel with silverstaining (A). The corresponding fractions (lanes 1 – 10) were immunoblotted with anti-gp96/grp94 monoclonal antibody (B).
different peptides (as shown in Fig. 4A), the bulk peptide must be divided by this number to obtain the average molar amount of individual peptide. From the HPLC profile, we also estimated the specific peptide peak consisted of about 2% of the total peptides associated with gp96. If the recovery of HPLC is around 90%, the amount of peptide specific to tumor tissues can be calculated as follows: 80 (520 – 830) 1/2 0.8 0.02 0.9 = 300 – 478 pmol. 3.3. Amino acid sequencing of the specific peptide from purified gp96 The purified gp96 preparation was extracted with TFA and the low molecular weight material isolated by Centricon centrifugation (Centricon-10, which allows passage of molecules of less than 10 kDa).
Fig. 4. MALDI-TOF mass spectra of the isolated peptides. Bulk peptides (A) associated with gp96 and the isolated peptide (B) specific for HBV-induced hepatocellular carcinoma from tumor tissue (from patient 1) are presented here. In mass spectrum B, a single peptide of about 798 Da was detected without obvious contamination, and the identical molecular mass was also identified in A as indicated by the arrow with a molecular mass of 798 Da.
34
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
Fig. 5. Direct sequencing of HBV-DNA gene segment encoding the specific peptide from HBV-infected tumor tissue. This clearly shows the existence of the coding sequence of the isolated peptide, YVNTNMG.
deduced amino acid sequence was identical to the one obtained by Edman sequencing of the peptide (Fig. 5). These data supported the notion that the specific 7mer peptide isolated from gp96 was actually derived from HBV core protein.
4. Discussion Using a three-step purification consisting of ammonium sulfate precipitation, ConA-Sepharose affinity chromatography and anion exchange chromatography, we have successfully purified gp96 from human liver tissues. We routinely obtained about 20– 30 Ag/g of gp96 (over 95% purity) from normal tissue and 50 – 80 Ag/g from tumor tissues. The total recovery of gp96 by this method was estimated to be between 20 – 30% (Srivastava, 1997; Srivastava and Jaikaria, 2001). We also evaluated the addition of an extra step of DEAE-Sepharose chromatography in our purification steps as described by Srivastava (Srivastava, 1997; Srivastava and Jaikaria, 2001), but it did not give any obvious improvements. Therefore, our threestep purification method does not include this weak anion exchange chromatography step. It should be noted that although the ammonium sulfate precipitation step does not increase the purity of the final gp96 preparation as observed in our laboratory; it is necessary since it can effectively dilapidate samples. Experience suggests that lipids in liver tissues may cause irreversible fouling of the columns. One problem we encountered in gp96 purification was its instability and tendency to aggregate, which has also been observed by Srivastava et al. (Srivastava, 1997; Srivastava and Jaikaria, 2001). Therefore, in our experi-
ments, the purified gp96 preparations were usually used for acid peptide extraction on the same day of purification. gp96 may be among the ‘‘stickiest’’ proteins in the cell (Csermely et al., 1998). It is not recommended to store gp96 at concentrations of more than 1 mg/ml. At concentrations of 10 mg/ml, gp96 preparations will resemble a ‘‘molecular glue’’ due to oligomerization after a week, even when stored at 70 jC. Lyophilization cannot be used for long-term gp96 storage as this will cause it to become irreversibly insoluble (unpublished observation). Recently, the basis of this aggregation has been partly elucidated (Sastry and Linderoth, 1999). It was suggested that the gp96 molecule contains a dimerization domain (amino acid residues 692 – 709) in the C-terminal region, and can form a dimer or higher ordered oligomers which reach a molecular mass of hundreds of kilodaltons. In gp96 oligomers, the peptide-binding site may be concealed or less accessible, which will inevitably affect the efficiency of using gp96 for peptide extractions or as a tumor vaccine. This should be addressed in more detail in future studies. We routinely obtain apparently homogeneous gp96 within a wide range of salt concentrations in the last purification step. However, in two liver tumor samples, several other bands could be detected on the silver-stained SDS-PAGE in some eluted fractions that were not used for peptide extractions. The impurities are likely to be proteins bound to gp96, which cannot be separated by our current methods. gp96 associates with numerous other proteins, such as protein kinase, actin filaments, as well as other molecular chaperones of the ER where there are extremely high protein concentrations (estimated to be around 100 mg/ml) (Csermely et al., 1998). Therefore, it is
S.-D. Meng et al. / Journal of Immunological Methods 264 (2002) 29–35
conceivable that strong binding can occur between gp96 and other proteins. To verify the efficiency and validity of the purification method, we extracted and identified the peptides associated with gp96. Mass spectrometry analysis showed that the purified gp96 chaperoned various peptides generated within the cell, with lengths ranging from a 6-mer to more than a 10-mer, supporting the notion that the mean molecular weight of amino acid residues is 110 Da. Furthermore, one 7-mer peptide associated with gp96 was identified to be derived from HBV core protein (Meng et al., 2001). Our results do show that the gp96 preparations purified by this method were associated with the endogenous repertoire of peptides, including the antigenic ones derived from HBV. We recently found that the 7-mer peptide and its 9-mer homologues (Tsai et al., 1996) could be assembled with HLA-A * 1101 and h2 m into HLA – peptide complex in vitro (Rao and Gao, unpublished data). The three-step purification method might be used as a universal technique for the easy and reproducible isolation of heat shock protein gp96 for vaccine development, especially for the identification of the associated peptides from liver tissue or even other tissues of different sources. This will facilitate in vitro assembly of the defined antigenic peptides and the use of gp96 vaccines, especially therapeutic vaccines, against HBV-induced hepatic carcinoma. Acknowledgements This work was supported by a grant from China National Frontier Research Program (Grant No. G1999075602) and ‘‘one-to-one’’ Program of National 863 Project (to SDM and GFG). GFG is a Wellcome Trust (UK) International Research Fellow at Harvard. We thank Prof. Wei-Feng Chen (Peking Medical School, Peking University) for his help. References Basu, S., Binder, R.J., Ramalingam, T., Srivastava, P.K., 2001. CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 14, 303 – 313. Binder, R.J., Anderson, K.M., Basu, S., Srivastava, P.K., 2000a. Cutting edge: heat shock protein gp96 induces maturation and migration of CD11c+ cells in vivo. J. Immunol. 165, 6029 – 6035.
35
Binder, R.J., Han, D.K., Srivastava, P.K., 2000b. CD91: a receptor for heat shock protein gp96. Nat. Immunol. 1, 151 – 155. Chandawarkar, R.Y., Wagh, M.S., Srivastava, P.K., 1999. The dual nature of specific immunological activity of tumor-derived gp96 preparations. J. Exp. Med. 189, 1437 – 1442. Csermely, P., Schnaider, T., Soti, C., Prohaszka, Z., Nardai, G., 1998. The 90-kDa molecular chaperone family: structure, function, and clinical applications. A comprehensive review. Pharmacol. Ther. 79, 129 – 168. Janetzki, S., Blachere, N.E., Srivastava, P.K., 1998. Generation of tumor-specific cytotoxic T lymphocytes and memory T cells by immunization with tumor-derived heat shock protein gp96. J. Immunother. 21, 269 – 276. Janetzki, S., Palla, D., Rosenhauer, V., Lochs, H., Lewis, J.J., Srivastava, P.K., 2000. Immunization of cancer patients with autologous cancer-derived heat shock protein gp96 preparations: a pilot study. Int. J. Cancer 88, 232 – 238. Li, Z., 1997. Priming of T cells by heat shock protein – peptide complexes as the basis of tumor vaccines. Semin. Immunol. 9, 315 – 322. Meng, S.D., Gao, T., Gao, G.F., Tien, P., 2001. HBV-specific peptide associated with heat-shock protein gp96. Lancet 357, 528 – 529. Robert, J., Menoret, A., Cohen, N., 1999. Cell surface expression of the endoplasmic reticular heat shock protein gp96 is phylogenetically conserved. J. Immunol. 163, 4133 – 4139. Sastry, S., Linderoth, N., 1999. Molecular mechanisms of peptide loading by the tumor rejection antigen/heat shock chaperone gp96 (GRP94). J. Biol. Chem. 274, 12023 – 12035. Srivastava, P.K., 1997. Purification of heat shock protein – peptide complexes for use in vaccination against cancers and intracellular pathogens. Methods 12, 165 – 171. Srivastava, P.K., 2000. Immunotherapy of human cancer: lessons from mice. Nat. Immunol. 1, 363 – 366. Srivastava, P.K., Amato, R.J., 2001. Heat shock proteins: the ‘Swiss Army Knife’ vaccines against cancers and infectious agents. Vaccine 19, 2590 – 2597. Srivastava, P.K., Jaikaria, N.S., 2001. Methods of purification of heat shock protein – peptide complexes for use as vaccines against cancers and infectious diseases. Methods Mol. Biol. 156, 175 – 186. Suto, R., Srivastava, P.K., 1995. A mechanism for the specific immunogenicity of heat shock protein-chaperoned peptides. Science 269, 1585 – 1588. Tamura, Y., Peng, P., Liu, K., Daou, M., Srivastava, P.K., 1997. Immunotherapy of tumors with autologous tumor-derived heat shock protein preparations. Science 278, 117 – 120. Tsai, S.L., Chen, M.H., Yeh, C.T., Chu, C.M., Lin, A.N., Chiou, F.H., Chang, T.H., Liaw, Y.F., 1996. Purification and characterization of a naturally processed hepatitis B virus peptide recognized by CD8+ cytotoxic T lymphocytes. J. Clin. Invest. 97, 577 – 584. Udono, H., Levey, D.L., Srivastava, P.K., 1994. Cellular requirements for tumor-specific immunity elicited by heat shock proteins: tumor rejection antigen gp96 primes CD8+ T cells in vivo. Proc. Natl. Acad. Sci. U. S. A. 91, 3077 – 3081. Zugel, U., Sponaas, A.M., Neckermann, J., Schoel, B., Kaufmann, S.H., 2001. gp96-peptide vaccination of mice against intracellular bacteria. Infect. Immun. 69, 4164 – 4167.