Thrombin Peptide, TP508, Induces Differential Gene Expression in Fibroblasts through a Nonproteolytic Activation Pathway

Experimental Cell Research 247, 422– 431 (1999) Article ID excr.1998.4372, available online at http://www.idealibrary.com on

Thrombin Peptide, TP508, Induces Differential Gene Expression in Fibroblasts through a Nonproteolytic Activation Pathway Laurie E. Sower,* Deborah A. Payne,† Rebecca Meyers,* and Darrell H. Carney* ,1 *The Department of Human Biological Chemistry and Genetics, The University of Texas Medical Branch, Galveston, Texas 77555-0645; and †Molecular Diagnostics Laboratory, The Department of Pathology, The University of Texas Medical Branch, Galveston, Texas 77555-0743

INTRODUCTION Prior studies have shown that synthetic peptides representing the domain of thrombin responsible for high-affinity binding to fibroblasts stimulate chemotactic and cell proliferative signals through a nonproteolytic mechanism. One of these peptides, TP508, has recently been shown to be chemotactic for neutrophils, to enhance collagen accumulation in wounds, to enhance revascularization of wounds, and to accelerate the healing of incisional and open wounds in normal animals and in animals with impaired healing. To determine whether TP508 activates the proteolytically activated receptor for thrombin (PAR1), or the signals that are activated by PAR1, we treated human fibroblasts with TP508 and the PAR1-activating peptide, SFLLRNP, and analyzed the effects of these peptides on gene expression using differential display reverse transcriptase polymerase chain reaction. TP508 induces expression of a number of specific message fragments with short tyrosine kinase-like domains that are not induced by SFLLRNP. Sequencing fulllength clones prepared by Marathon extension of TP508-induced fragments revealed that among the induced transcripts, there was a sequence with 88% homology to human annexin V. Northern analysis with authentic annexin V cDNA confirms that TP508, but not SFLLRNP, induces expression of annexin V in human fibroblasts. These results demonstrate that TP508 activates a cellular response separate from that activated through PAR1 and supports the hypothesis that TP508 acts through a separate nonproteolytically activated thrombin receptor that may be responsible for high-affinity thrombin binding and for nonproteolytic signals that are required for thrombin stimulation of cell proliferation. © 1999 Academic Press Key Words: thrombin; thrombin peptides; thrombin receptors; nonproteolytic activation; cell signaling; annexin V.

1 To whom correspondence should be addressed at Department of Human Biological Chemistry and Genetics, The University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0645. Fax: (409) 772-2348. E-mail: [email protected].

0014-4827/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.

We have discovered that a synthetic peptide, TP508, representing a portion of human thrombin, competes for high-affinity thrombin binding to fibroblasts and stimulates mitogenesis and chemotaxis, although the peptide is nonproteolytic [1]. A single topical application of TP508 increases incisional breaking strength and neovascularization in normal rats [2] and in rats with radiation-induced healing defects [3]. TP508 has also been shown to accelerate healing of full dermal acute excisional wounds in rats and mice [4]. Histological data indicates that TP508 treatment enhances neutrophil recruitment, collagen deposition, granulation tissue formation, neovascularization, and other wound-healing events [2, 4]. Thus, exogenously added TP508 appears to mimic and accelerate many of the normal effects of thrombin in initiating wound healing, even though it has no proteolytic activity and does not appear to activate the proteolytically activated thrombin receptor (PAR1). It is now widely recognized that thrombin is an important growth factor and immunoregulator at the site of tissue injury. Highly purified thrombin stimulates proliferation of chick embryo and mammalian fibroblasts under serum-free culture conditions [5–7]; activates monocytes [8], NK cells [9], and T cells [10]; and is chemotactic for a number of cells including neutrophils and monocytes [11, 12]. Early studies showed that thrombin action at the cell surface is sufficient to stimulate cell proliferation by initiating transmembrane signals [13], yet the nature of the signals has been difficult to define. 125 I-thrombin binding studies with fibroblasts reveal ;150,000 receptors per cell with an apparent affinity of 1 nM and show that binding of thrombin to these receptors is necessary for thrombin-induced mitogenesis [14]. Binding alone to these high-affinity sites, however, is not sufficient for complete mitogenesis since DIP-thrombin (thrombin that is chemically inactivated by diisopropylphosphofluoridate), binds to high-affinity binding sites, with an affinity equal to native a-throm-

422

THROMBIN PEPTIDE INDUCES DIFFERENTIAL GENE EXPRESSION

bin, but is unable to stimulate mitogenesis without additional signals generated by proteolytically active thrombin or the thrombin derivative, g-thrombin [15– 17]. These results indicate that both a binding event and a separate cleavage event are necessary for stimulation of cell proliferation in fibroblasts and that two different requisite transmembrane signals are generated by thrombin [18]. Epithelial cells [19] and vascular smooth muscle cells [20] also appear to require both a receptor-occupancy-dependent event (nonproteolytic) and a proteolytic event for mitogenic stimulation. Thus, the requirement for two types of signals is not limited to fibroblasts. If fibroblasts are treated with phorbol myristate acetate (which activates protein kinase C) and DIPthrombin [21], monoclonal antibodies to thrombin receptors [22], or the TP508 synthetic peptide (corresponding to amino acids 508 –530 of human prothrombin [1], cell proliferation results. These results demonstrate that the proteolytically initiated thrombin signals are largely transmitted via activation of protein kinase C, but additional undefined signals generated by nonproteolytic activation of thrombin receptor components also appear to be required. Thrombin stimulates amiloride-sensitive Na 1/H 1 antiport [23, 24], phosphoinositide turnover [25, 26], mobilization of intracellular calcium [25, 27, 28], and arachidonate production [27] as necessary events in thrombin-induced mitogenesis. All of these signals, however, require proteolytically active thrombin for initiation [18, 27, 29, 30]. In contrast, a transient increase in cAMP can be stimulated by DIP thrombin, but not proteolytically active g-thrombin [30]. Several laboratories have cloned members of a proteolytically activated seven-transmembrane domain Gprotein-linked receptor family that include PAR1, PAR2, PAR3, and PAR4 [31–37]. The first characterized receptor of this family, PAR1, possesses a specific thrombin cleavage site that allows thrombin cleavage to expose a new amino-terminus domain that acts as a tethered ligand, folding back onto itself, inducing its activation [32, 38]. PAR2 has a similar mechanism for activation, but is principally activated by trypsin-like enzymes [34]. The most recently described member of the family, PAR3, also has a similar mechanism of activation and appears to function as a second thrombin receptor in platelets [35]. PAR4 has been detected in mouse megakaryocytes and studies suggest that it also functions in human platelets [36]. Activation of these G-protein-linked receptors appears to be responsible for all of the proteolytic cleavage-dependent signals initiated by thrombin. In some studies, SFLLRN alone has been shown to stimulate cell proliferation [39], while in other studies, activation of PAR1 alone is not sufficient to stimulate cell proliferation [40]. Recent studies with PAR1 knockout mice

423

indicate that without PAR1, mice exhibit normal skin wound healing [41]. Moreover, cells that express fully functional PAR1 receptors are nonresponsive to thrombin due to a defect that presumably lies in the ability of these cells to be stimulated by a nonproteolytic activation pathway [42]. We propose that there is a separate nonproteolytically activated thrombin receptor component (NPAR) present on most cells and that this component is responsible for high-affinity binding and for signals that are not stimulated by proteolytic activation of PAR receptors. Neutrophils, for example, bind 125I-thrombin with high affinity [43; Ramakrishnan and Carney, unpublished], yet they do not express PAR1 [44]. In contrast, IIC9 fibroblasts overexpress PAR1 [45], but do not bind thrombin with high affinity [46]. Interestingly, high-affinity binding sites reportedly remain on the cell surface following thrombin incubation [47], while PAR1 is rapidly internalized following cleavage by thrombin or activation by SFLLRNP [48]. In addition, recent binding studies in solution or solid phase have shown that the apparent affinity of thrombin binding to PAR1 peptides is in the micromolar to 10 nM range [49] or from one to three orders of magnitude less than the observed high-affinity binding of a-thrombin or DIP-thrombin to fibroblasts [14, 15]. Thus, the two types of interactions and two types of signals that are generated may involve two different receptor components. As part of an ongoing effort to establish the validity of a two-receptor model for thrombin mitogenesis, we have utilized differential display to identify uniquely expressed mRNA and proteins that may be differentially regulated by activation of PAR1 and by nonproteolytic activation of NPAR. We now show that in fibroblasts, the nonproteolytic peptide, TP508, initiates signals that are distinct from those initiated by SFLLRNP activation of PAR1. Differential display reverse transcriptase polymerase chain reaction (DDRT-PCR) shows TP508 induces differentially expressed genes. The sequences of one of these genes has homology to annexin V and this differential gene expression was confirmed by Northern blot analysis using authentic annexin V cDNA. The data generated in these studies, therefore, demonstrate that proteolytic and nonproteolytic thrombin activation involves separate intracellular signaling pathways. MATERIALS AND METHODS Reagents. Human a-thrombin was purchased from Dr. John Fenton, II (Albany Medical College, Albany, NY). Primer sequences. The oligo(dT) degenerate primers, oligo(dT12) VA, VC, VG, or VT, were purchased from Operon Technologies, Inc. (Alameda, CA.). Gene specific primers were GSP1 (GATGTTTGGTGTTTCGGCCTTGACAATATC) and GSP2 (GGTGCTTCGGGAGATACTGGTCAAATCC). The tyrosine kinase degenerate

424

SOWER ET AL.

primer, WSNGAYGTNTGGWSNTTYGG (50), was synthesized at Genosys (Woodlands, TX). Cell lines. WI38 human lung fibroblast cell line was obtained from ATCC (ATCC-CCL-75, Rockville, MD). Cell culture/RNA isolation. WI38 fibroblasts were cultured in a 1:1 mixture of Dulbecco–Vogt modified medium (DMEM) and Ham’s F-12 medium supplemented with 10% fetal bovine serum (DV-10). Prior to assay, cells were placed in serum-free medium for 48 h and were then treated with one of the following: medium, thrombin, TP508, or SFLLRNP for 30 min. Total RNA was isolated using the TRI-Reagent method (Molecular Research Center, Inc., Cincinnati, OH) as previously described [51]. Briefly, 1 3 10 6 cells were resuspended in 1 ml of TRI-Reagent and incubated at 22°C for 5 min. Chloroform was added and the incubation was continued for 10 min at 22°C. The lysate was spun at 12,000 rpm for 15 min at 22°C and the upper aqueous layer was transferred to a fresh 1.5-ml microfuge tube. The RNA was precipitated with isopropanol for 10 min at 22°C and then pelleted at 12,000 rpm for 8 min at 22°C. The pellet was washed with 75% ethanol and air-dried. Following resuspension in DEPC H 2O, the total RNA was quantitated using a Beckman spectrophotometer. Poly(A) selection was achieved by using the Qiagen mRNA OligoTex isolation kit as described previously (Qiagen, Chatsworth, CA) [52]. Briefly, 250 mg of total RNA was added to binding buffer (20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, and 0.2% SDS). Oligotex suspension was added and the sample was incubated at 65°C for 3 min to disrupt secondary structure. To allow hybridization between the oligo(dT) and the poly(A) RNA, the suspension was allowed to sit at 22°C for 10 min. The suspension was centrifuged for 2 min at 14,000 rpm at 22°C and the pellet was washed in washing buffer (10 mM Tris–HCl, pH 7.5, 150 mM NaCl, and 1 mM EDTA). This suspension was added to a column and centrifuged for 30 s at 14,000 rpm followed by washing. Poly(A) RNA was eluted using the elution buffer (5 mM Tris–HCl, pH 7.5) and quantitated by spectrophotometer. DNase treatment. Poly(A) RNA (1 mg) was incubated with 10 units of DNase I (Promega, Madison, WI) and 10 units of RNasin inhibitor (Promega, Madison, WI) for 30 min at 37°C. DNased poly(A) was then subjected to phenol– chloroform extraction followed by ethanol precipitation using a 1/10 volume of sodium acetate and 2 volumes of 100% ethanol. Reverse transcription. DNased poly(A) RNA (3 ml) was subjected to reverse transcription by adding 5 mM oligo(dT) VN primer and water to 60 ml. This suspension was heated to 70°C for 10 min and placed on ice for 5 min. The following additions were made: 20 mM dNTPs (Pharmacia, Piscataway, NJ), 10 mM DTT, 13 first-strand buffer (250 mM Tris–HCl, pH 8.3, 375 mM KCl, 15 mM MgCl 2, and 500 U Superscript II (Life Technologies, Gaithersburg, MD)), and the reaction was allowed to procede at 42°C for 1 h. PCR. For DDRT-PCR, cDNAs synthesized from the reverse transcription were amplified in duplicate in a 20-ml reaction volume containing the following: 13 PCR buffer (100 mM Tris–HCl, pH 8.3, 500 mM KCl), 1.5 mM MgCl 2, 1 U Taq polymerase (Perkin–Elmer, Branchburg, NJ) 50 mM dNTPs, 1 mM of each primer, and 1.25 mCi of [a- 33P]dATP (Amersham, Arlington Heights, IL). The samples were predenatured for 4 min at 94°C and amplified for 30 cycles (94°C, 45 s; 55°C, 2 min; 72°C, 45 s) followed by 72°C for 8 min to complete the extension. PCR controls included the omission of reverse transcriptase in the RT step. Band selection and reamplification. Radiolabeled PCR products were separated on a 6% polyacrylamide sequencing gel for 8 h at 450 volts. The dried gel was exposed to X-ray film (XAR5 Eastman Kodak, Rochester, NY) overnight at 22°C. Bands were selected on the following basis: (i) differential appearance in test versus control lanes (ii) dependent on the addition of reverse transcriptase and (iii) dependent on appearance in both lanes of equally treated samples.

Selected bands were excised after careful alignment of the autoradiogram to the gel and the DNA was recovered by rehydrating in H 2O at 22°C for 30 min followed by boiling for 30 min. The DNA was ethanol precipitated overnight and was reamplified using the same primers and PCR cycling parameters discussed above. If the DNA failed to reamplify, the DNA was discarded. Cloning and sequencing. Reamplified PCR products were cloned using the TA Cloning kit (Invitrogen, San Diego, CA). Plasmid was isolated using the Qiagen spin prep columns (Qiagen, Chatsworth, CA). Sequence analysis was done by the Sealy Center for Molecular Science Sequencing Center (UTMB, Galveston, TX). Nucleotide and predicted amino acid sequenced were tested for homology to known sequences in the DNA and protein databases of the National Center for Biotechnology Information by BLAST and Beauty search (Bethesda, MD). Northern blot analysis. For cloned cDNAs probes, human annexin V probe, a 1-kb fragment corresponding to the full coding region of the cDNA (provided by M. Pilar Fernandez, Department of Biochemistry and Molecular Biology, University of Oviedo, Spain), and G3PDH cDNA obtained from Clontech (Palo Alto, CA) were labeled with [a- 32P]dCTP obtained from Amersham (Arlington Heights, IL) using a Decaprime labeling kit (Ambion, Inc., Austin, TX) and purified using a drip column (Pharmacia, Piscataway, NJ). Total RNA was extracted from WI38 cells treated with medium, thrombin, SFLLRNP, and TP508 using TRI REAGENT (Molecular Research Center, Inc., Cincinnati, OH), separated on a 5.4% formaldehyde/1% agarose gel and blotted onto nylon membrane (Micron Separations Inc., Westboro, MA). The membrane was UV crosslinked and prehybridized for 4 h using 50% formamide, 53 SSPE, 0.1% SDS, 53 Denhardt’s, and 100 mg/ml sheared salmon sperm DNA at 55°C, followed by hybridization overnight under the same conditions. The nylon membrane was washed under high-stringency conditions (0.13 SSC, 1% SDS) and exposed to a phosphoimaging screen for 18 h (Molecular Dynamics, Sunnyvale, CA). Bands were quantitated using the Image Quant program available within the Molecular Dynamics software. Marathon cDNA amplification. Poly(A) RNA from TP508-treated cells was subjected to cDNA synthesis using the Marathon cDNA synthesis primer. The second strand was synthesized and the ends polished by using Pfu polymerase (Stratagene, LaJolla, CA). The Marathon cDNA Adaptor was ligated overnight and the cDNA was subjected to rapid amplification of 59-cDNA ends (59-RACE). Briefly, the adaptor-ligated cDNA is subjected to PCR using the AP1 primer and the designed gene-specific primer using the following conditions: predenature and 94°C for 1 min and 25 cycles of 94°C for 30 s; 60°C for 30 s; and 68°C for 4 min. DNA was then run on a 1% agarose gel (13 TAE), and bands that appeared in the lanes with AP1 primer plus GSP1 versus either primer alone was cut out and eluted from the gel using Geneclean (BIO101, Vista, CA). Following elution, the DNA was again ligated into a TA cloning vector (Invitrogen, Carlsbad, CA) and subjected to transformation into TOP F9 cells (TA cloning kit, Invitrogen) and minipreps (Qiagen spin prep columns). Upon reisolation, the DNA was sequenced in the Sealy Center Molecular Science Sequencing facility.

RESULTS

Identification of Differentially Expressed Genes Many of the cellular effects of thrombin appear to be mediated through PAR1, yet certain effects can be stimulated by proteolytically inactivated thrombin derivatives or the thrombin peptide, TP508 [1, 18, 27, 29, 30]. To determine if two separate receptor activation pathways are involved, we used DDRT-PCR to com-

THROMBIN PEPTIDE INDUCES DIFFERENTIAL GENE EXPRESSION

pare gene expression in WI38 cells stimulated with thrombin, TP508, and SFLLRNP. Initial experiments using random primers for DDRT-PCR and total RNA resulted in 27 message fragments that were differentially displayed upon gel electrophoresis. Of the 27 differentially displayed bands, eight of these did not reamplify. Following the cloning and sequencing of the 19 remaining differentially displayed fragments, 14 had high homology with known genes (28S and 18S ribosomal RNA), while 5 were expressed sequenced tags. Therefore, these results indicated differential expression, but no specific messages were identified with the primers we initially used. We therefore decided to use degenerate primers for tyrosine kinase domains to limit the number and types of differentially displayed genes that we could detect to those that have short regions of homology to tyrosine kinase domains, even though functionally they may not be tyrosine kinases. In these experiments, serum-starved WI38 fibroblasts, were treated with medium alone, or media with native a-thrombin, SFLLRNP, or TP508. Total RNA was purified and either subjected to poly(A) selection or formaldehyde–agarose gel electrophoresis. The RNA that was electrophoresed was blotted to nylon using capillary transfer. The poly(A) selected RNA was used for cDNA synthesis utilizing an oligo(dT) degenerate primer and the tyrosine kinase degenerate primer as described under Materials and Methods. PCR reactions were electrophoresed on a 6% polyacrylamide gel that was dried and exposed to X-ray film. The differentially expressed cDNA fragments were eluted from the gel and subjected to PCR reamplification. Sixteen differentially expressed gene fragments were identified using this method. Of the 16, 4 reamplified and were shown to be differentially induced by TP508 and not by SFLLRNP. The reamplified cDNA fragments induced by TP508 were cloned into a TA cloning vector and transformed into Escherichia coli. Isolated colonies were selected for mini-plasmid prep analysis. Upon reisolation of the insert containing plasmid, DNA was digested with EcoRI to confirm insert size. The DNA was then sequenced and gene comparison analysis was performed using the NCBI Genebank server. Each sequence was checked for homology to tyrosine kinase domains and indeed each sequence had at least 40% homology at the protein level, but it is important to keep in mind this homology may only be around the primer sequence area. These data indicate that the use of specific primers and poly(A) RNA narrows the focus of differential display to specific types of gene fragments and in this case to those which may have signaling relevance. To confirm the differential expression, insert cDNAs were radiolabeled and hybridized to Northern blots of the initial total RNA treated under the same condi-

425

FIG. 1. Northern blot analysis of differentially expressed cDNA. cDNA from TP508-induced differentially expressed bands that were reamplified were radiolabeled and hybridized to Northern blots of total RNA treated with medium, 0.5 mg/ml thrombin, 150 mg/ml SFLLRNP, or TP508 (Lanes 1– 4, respectively) for 30 min. Blots were stripped and reprobed with G3PDH. Data presented are expressed as the mean % of the housekeeping gene, G3PDH, from two independent experiments.

tions. Figure 1 shows the analysis of this data and is expressed as the mean percentage of the housekeeping gene, G3PDH, from two separate experiments. These data show that the differentially expressed cDNA were not artifacts and that TP508 and thrombin differentially induce expression of genes at levels up to 2.5-fold higher than media control or SFLLRNP-treated cells. It should be noted that this concentration of SFLLRNP (150 mg/ml) is sufficient to fully activate mitogenic signals in fibroblasts [39, 40, 42]. Although this data represents a single time point and single concentration of SFLLRNP, it confirms the differential expression. Marathon RACE of Differentially Expressed Genes Since the differentially expressed gene fragments were confirmed by Northern blot analysis, Marathon RACE was used to clone full-length cDNAs corresponding to the differentially expressed mRNAs. For these experiments, we initially decided to focus on cloning the full-length messages from two of the four products. Gene-specific primers (GSPs) were designed based on the sequence obtained from the plasmid inserts of Bands 6 and 8 and the protocol suggested length, T m, and GC content. In this method, poly(A) RNA from WI38 cells treated with TP508 was subjected to cDNA synthesis using the Marathon cDNA synthesis primer. The second strand was synthesized and ends were blunted and polished using Pfu polymerase. The Marathon adaptor primer was then ligated, and the product was subjected to PCR analysis using the AP1 primer provided and the designed GSPs as described under Materials and Methods. These PCR products were run on a 1% agarose gel and the bands that were observed in the AP1 primer plus GSP1 primer lanes that were not present in the GSP1 primer or AP1 primer alone lanes were cut out and eluted. The band-

426

SOWER ET AL.

TABLE 1 Genebank Analysis of Marathon RACE Fragments Band No.

RACE clones

Homologous protein

% Homology (protein level)

6 6 8 8

4 5 1 2

Sodium channel protein Type III collagen Human calcineurin B Annexin V

51 47 87 88

Note. Marathon 59-RACE was used to clone full-length cDNA from Bands 6 and 8. Following isolation of DNA, it was sequenced and analyzed using the NCBI Blast & Beauty Genebank server. The sequence homology at the protein level is shown.

ing pattern resulted in four fragments of DNA ranging from 700 to 1200 bp. This DNA was cloned, sequenced, and analyzed use the NCBI Genebank server as described above. Results in Table 1 show that the fragments have high homology at the protein level to a sodium channel protein, type III collagen, human calcineurin B, and annexin V. Although it is possible that TP508 upregulates several of these gene products, the highest homology was to human annexin V; therefore, we focused on annexin V as an example of a TP508upregulated gene product.

this upregulation may be a distinct marker for nonproteolytic thrombin activation of cells. DISCUSSION

Thrombin initiates multiple intracellular signals via proteolytic activation of PAR1; however, nonproteolytic thrombin binding also appears to be necessary for many of its postclotting cellular effects. We now show that the thrombin peptide, TP508, which has been shown to compete with thrombin for cell surface binding, induces differential gene expression when compared to cells stimulated by thrombin or the PAR1 activation peptide, SFLLRNP. These results, therefore, confirm that TP508 exerts its effects on cells by stimulating a nonproteolytically activated signal pathway. Using DDRT-PCR, we have shown differential gene expression induced by TP508. Upregulation of these messages was confirmed by Northern blot analysis using radiolabeled differentially induced message fragments. Of the four differentially expressed messages that were induced by TP508, we cloned full-length cDNA for two. Sequencing the full-length clones revealed high homology (47– 88%) with known proteins. This study has resulted in several rather significant findings. The first is that we utilized a tyrosine kinase

Northern Blot Analysis Using Human Annexin V cDNA If the annexin V gene is upregulated in fibroblasts by TP508, it should be possible to confirm the upregulation by Northern blot analysis using authentic annexin V cDNA. Therefore, human annexin V cDNA (provided by Dr. M. Pilar Fernandez) was radiolabeled and hybridized to Northern blots of RNA treated under the initial conditions (medium, thrombin, SFLLRNP, and TP508). As shown in Fig. 2, TP508 induces a threefold increase in message for annexin V in a dose-dependent manner with maximal stimulation at 100 –150 mg/ml. In two parallel experiments, SFLLRNP did not induce annexin V expression above that seen in media alone. In these same experiments, thrombin induced expression to levels similar to those induced by 25 and 50 mg/ml TP508 (data not shown). Northern blots of the kinetics of annexin V upregulation by TP508 revealed that the message is optimally expressed at 60 min and decreases by 3 h (Fig. 3). Thrombin also induced annexin V in these experiments. This induction is less than that observed for TP508, which may indicate that the proteolytic activity of thrombin modulates the nonproteolytic effects or simply that the concentration of thrombin utilized for these experiments is suboptimal relative to TP508. These data confirm that TP508 induces upregulation of human annexin V expression in a time- and dose-dependent manner and indicate that

FIG. 2. Dose response of TP508-induced annexin V expression. WI38 fibroblasts were treated with TP508 (25, 50, 100, and 150 mg/ml; Lanes 1– 4, respectively) for 30 min. RNA was purified and transferred to nylon and subjected to Northern blot analysis using the human annexin V cDNA provided by Dr. M. Pilar Fernandez. The blot was stripped and rehybridized with G3PDH cDNA probe. Data represent % of the housekeeping gene, G3PDH, and are representative of three independent experiments.

THROMBIN PEPTIDE INDUCES DIFFERENTIAL GENE EXPRESSION

FIG. 3. Kinetics of annexin V expression. WI38 fibroblasts were treated with medium, 0.5 mg/ml a-thrombin, and 100 mg/ml of TP508 for 30, 60, 180, and 360 min. Total RNA was isolated and run on a formaldehyde–agarose gel and Northern blotted as described under Materials and Methods. Blots were probed with human annexin V cDNA, stripped, and rehybridized with G3PDH. Results are expressed as relative area (%) as quantitated using the Image Quant Analysis program of the Molecular Dynamics Phosphoimager and are representative of three independent experiments.

degenerate primer to identify fragments that were differentially induced by TP508 versus SFLLRNP. We believe that this method is preferred to original differential display protocols that utilize random degenerate primers to pull out every possible transcript because it targets potential molecules of interest and reduces the time necessary to screen nonrelevant differentially displayed products. While the sequences identified using these primers all had short regions of homology to tyrosine kinase domains, it is important to understand that these primers are degenerate and that sequence does not necessarily correlate with function. The primers merely function as an initial screening device so that when differentially expressed genes are sequenced, they must have some homology to a tyrosine kinase or they are considered false positives. The second significant finding of this study and perhaps the most important is that the TP508 peptide, which corresponds to the binding region of thrombin,

427

differentially induces molecules that may have signaling relevance and that are totally distinct from those that are induced by the PAR1 peptide, SFLLRNP. Several of these differentially expressed messages had high homology to known proteins that are involved in intracellular signaling. Of the differentially induced message fragments, we chose to initially clone full-length transcripts from two. Following sequencing of the RACE fragments generated, four protein sequences with homology to our two fragments were found (Table 1). One of the sequences had homology to a sodium channel protein. A second sequence had homology to type III collagen, which is the first collagen type to be laid down during wound healing [53]. This is interesting as TP508 has been shown to enhance wound healing in rats and mice [2, 4]. From the second differentially induced fragment, two full-length clones were also generated. One had sequence homology to human calcineurin B, which is a calmodulin-stimulated protein phosphatase [54]. The other had homology to human annexin V. We chose to initially focus on annexin V because it had the highest homology to our sequence, because it has been reported to have ion channel activity [55], and because it appears to have a number of regulatory effects that may be relevant to thrombin signaling. Annexin V is a Ca 21 dependent phospholipid binding protein that has many proposed functions including playing a role in anticoagulation [56]. The anticoagulant action results from annexin V binding to phospholipid surfaces in competition with clotting factors [57], inhibition of the prothrombinase complex [58 – 63], and inhibition of thrombin formation [64 – 66]. Furthermore, annexin V inhibits platelet adhesion [67] and thrombin-induced eicosanoid and thromboxane B2 release from platelets [68]. At the cellular level, annexin V interacts with cytoskeletal components, binds collagen, and inhibits protein kinase C (PKC), resulting in decreased phosphorylation of annexin I and II and of histone IIIS, which are substrates of PKC [69 –78]. Inhibition of PKC may be a consequence of competition between PKC and annexin V for membrane binding to negatively charged phospholipids or for direct inhibition of annexin V through direct binding to PKC. Interestingly, endogenous inhibitors of PKC all have an annexin-like 16 amino acid domain homologous with the last 14 amino acids of the annexin family [79]. Because of its important functions and the possibility of playing a role in signaling, we obtained authentic annexin V cDNA and were able to confirm that TP508 upregulated the message for annexin V (Figs. 2 and 3). In these experiments, TP508 increased annexin V expression in a dose- and time-dependent manner with optimal dosage being between 100 and 150 mg/ml and with optimal expression being at 60 min.

428

SOWER ET AL.

FIG. 4. Working model of thrombin stimulation of cellular events through a proteolytic and a nonproteolytic pathway. See text for details.

Proposed Thrombin Receptor Model The demonstration of differential gene expression induced by TP508 confirms our “double signal” model for thrombin activation of cellular functions [18]. As shown in Fig. 4, we propose that thrombin acts through two independent receptors or receptor components to induce postclotting cellular effects: (i) the proteolytically activated G-protein receptors for thrombin (PAR1, PAR3, and PAR4); and (ii) a nonproteolytically activated receptor component, NPAR. Based on the present studies, it appears that thrombin activation of NPAR induces expression of a different set of proteins including annexin V when compared with thrombin activation of PAR1 or the other PAR receptors. Since annexin V has been shown to inhibit PKC, the TP508-induced upregulation of this protein may provide a mechanism whereby the two types of signals can act in concert to induce cell proliferation, but may also be antagonistic to each other. As shown in Fig. 4, proteolytic activation of PAR1 stimulates signals that result in activation of PKC and downstream signals that include c-jun upregulation and phosphorylation of numerous substrates including phosphorylation and activation of map kinase [80 – 82]. In contrast, nonpro-

teolytic activation of NPAR upregulates annexin V, which could function as a positive signal or a negative regulator to block PKC activation. This model may provide an important insight into how proteolytically active thrombin and nonproteolytic thrombin fragments play different roles in tissue repair following wounding. For example, at the time of wounding, proteolytically active thrombin may stimulate a number of downstream signals that are proinflammatory and may lead to degradation of the damaged tissues. Some of the thrombin is sequestered within fibrin clots at the time the clot is formed [83] and is later released or broken down to nonproteolytic fragments as the clot is digested by proteases released from cells recruited into the wound. These nonproteolytic fragments may be able to recruit cells into the wound by activating a separate set of chemotactic signals and also inhibit some of the early responses that are initiated by proteolytically active thrombin. This model also would predict that by controlling the relative expression of the two different receptor components in different cell types, it would be possible to regulate the type of response initiated by thrombin interaction with different cells. Work is now underway in our laboratory to further define the ability of TP508 to inhibit PKC through upregulation of annexin V and to determine how such inhibition may relate to the acceleration of wound healing which is stimulated by topical application of this peptide to wounds. This work was supported by grants from The Kempner Foundation (Galveston, TX) and from the National Institute of General Medicine (NIH 5RO1 GM47572). We also thank Jennifer Murphy for the artwork of the two-receptor model.

REFERENCES 1.

2.

3.

4.

5.

6.

Glenn, K. C., Frost, G. H., Bergmann, J. S., and Carney, D. H. (1988). Synthetic peptides bind to high-affinity thrombin receptors and modulate thrombin mitogenesis. Peptide Res. 1, 65–73. Carney, D. H., Mann, R., Redin, W. R., Pernia, S. D., Berry, D., Heggers, J. P., Hayward, P. G., Robson, M. C., Christie, J., Annable, C. et al. (1992). Enhancement of incisional wound healing and neovascularization in normal rats by thrombin and synthetic thrombin receptor-activating peptides. J. Clin. Invest. 89, 1469 –1477. Cromack, D. T., Porras-Reuys, B. H., Wee, S. S., Glenn, K. C., Pardee, Carney, D. H., and Mustoe, T. A. (1992). J. Surg. Res. 55, 117–122. Stiernberg, J., Redin, W. R., Warner, W. S., and Carney, D. H. (1993). The role of thrombin and thrombin receptor activating peptide (TRAP-508) in initiation of tissue repair. Thromb. Haemost. 70, 158 –162. Chen, L. B., and Buchanan, J. M. (1975). Plasminogen-independent fibrinolysis by proteases produced by transformed chick embryo fibroblasts. Proc. Natl. Acad. Sci. USA 72, 131–135. Carney, D. H., Glenn, K. C., and Cunningham, D. D. (1978). Conditions which affect initiation of animal cell division by trypsin and thrombin. J. Cell. Physiol. 95, 13–22.

THROMBIN PEPTIDE INDUCES DIFFERENTIAL GENE EXPRESSION 7. 8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

Pohjanpelto, P. (1978). Proteases stimulate proliferation of human fibroblasts. J. Cell. Physiol. 91, 387–392. Sower, L. E., Froelich, C. J., Allegretto, N., Rose, P. M., Hanna, W. D., and Klimpel, G. R. (1996). Extracellular activities of human granzyme A: Monocyte activation by granzyme A versus a-thrombin. J. Immunol. 156, 2585–2590. Naldini, A., and Carney, D. H. (1996). Thrombin modulation of natural killer activity in human peripheral lymphocytes. Cell. Immunol. 172, 35– 42. Naldini, A., Carney, D. H., Bocci, V., Klimpel, K. D., Asuncion, M., Soares, L. E., and Klimpel, G. R. (1993). Thrombin enhances T cell proliferative responses and cytokine production. Cell. Immunol. 147, 367–377. Bizios, R., Lai, L., Fenton, J. W., II, and Malik, A. B. (1986). Thrombin-induced chemotaxis and aggregation of neutrophils. J. Cell. Physiol. 128, 485. Bar-Shavit, R., Kahn, A., Fenton, J. W., II, and Wilner, G. D. (1983). Chemotactic response of monocytes to thrombin. J. Cell. Biol. 96, 282. Carney, D. H., and Cunningham, D. D. (1978). Cell surface action of thrombin is sufficient to initiate division of chick cells. Cell 14, 811– 823. Carney, D. H., and Cunningham, D. D. (1978). Role of specific cell surface receptors in thrombin-stimulated cell division. Cell 15, 1341–1349. Glenn, K. C., Carney, D. H., Fenton, J. W., II, and Cunningham, D. D. (1980). Thrombin active site regions required for fibroblast receptor binding and initiation of cell division. J. Biol. Chem. 255, 6609 – 6616. Perdue, J. F., Lubenskyi, W., Kivity, E., Sonder, S., and Fenton, J. W., II. (1981). Protease mitogenic response of chick embryo fibroblasts and receptor binding/processing of human alphathrombin. J. Biol. Chem. 256, 2767–2776. Carney, D. H., Stiernberg, J., and Fenton, J. W., II. (1984). Initiation of proliferative events by human alpha-thrombin requires both receptor binding and enzymatic activity. J. Cell. Biochem. 26, 181–195. Carney, D. H., Herbosa, G. J., Stiernberg, J., Bergmann, J. S., Gordon, E. A., Scott, D., and Fenton, J. W., II (1986). Doublesignal hypothesis for thrombin initiation of cell proliferation. Semin. Thromb. Hemost. 12, 231–240. He, C-J., Peraldi, M. N., Rebibou, J. M., Meulders, Q., and Sraer, J. D. (1992). Thrombin signal transduction mechanisms in human glomerular epithelial cells. J. Cell. Physiol. 150, 475– 483. Berk, B. C., Taubmann, M. B., Cragoe, E. J., Jr., Fenton, J. W., II, and Griendling, K. K. (1990). Thrombin signal transduction mechanisms in rat vascular smooth muscle cells: Calcium and protein kinase C-dependent and -independent pathways. J. Biol. Chem. 265, 17334 –17340. Gordon, E. A., and Carney, D. H. (1986). Thrombin receptor occupancy initiates cell proliferation in the presence of phorbol myristic acetate. Biochem. Biophys. Res. Commun. 141, 650 – 656. Frost, G. H., Thompson, W. C., and Carney, D. H. (1987). Monoclonal antibody to the thrombin receptor stimulates DNA synthesis in combination with gamma-thrombin or phorbol myristate acetate. J. Cell Biol. 105, 2551–2558. Stiernberg, J., LaBelle, E. F., and Carney, D. H. (1983). Demonstration of a late amiloride-sensitive event as a necessary step in initiation of DNA synthesis by thrombin. J. Cell. Physiol. 117, 272–281. Carney, D. H., Scott, D. L., Gordon, E. A., and LaBelle, E. F. (1985). Phosphoinositides in mitogenesis: neomycin inhibits

429

thrombin-stimulated phosphoinositide turnover and initiation of cell proliferation. Cell 42, 479 – 488. 25.

Paris, S., Chambard, J. C., and Pouyssegur, J. (1987). Coupling between phosphoinositide breakdown and early mitogenic events in fibroblasts: Studies with fluoroaluminate, vanadate, and pertussis toxin. J. Biol. Chem. 262, 1977–1983.

26.

Raben, D. M., Yasukda, K. M., and Cunningham, D. D. (1987). Relationship of thrombin-stimulated arachidonic acid release and metabolism to mitogenesis and phosphatidylinositol synthesis. J. Cell. Physiol. 130, 466 – 473.

27.

Rath, H. M., Fee, J. A., Rhee, S. G., and Silbert, D. F. (1990). Characterization of phosphatidylinositol-specific phospholipase C defects associated with thrombin-induced mitogenesis. J. Biol. Chem. 265, 3080 –3087.

28.

Stiernberg, J., Carney, D. H., Fenton, J. W., II, and LaBelle, E. F. (1984). Initiation of DNA synthesis by human thrombin: Relationships between receptor binding, enzymic activity, and stimulation of 86Rb1 influx. J. Cell. Physiol. 120, 289 –295.

29.

Carney, D. H. (1987). In “Control of Animal Cell Proliferation” (A. L. Boynton and H. L. Leffert, Eds.), Vol. 2, pp. 265–296, Academic Press, Orlando, FL.

30.

Gordon, E. A., Fenton, J. W., II, and Carney, D. H. (1986). Thrombin-receptor occupancy initiates a transient increase in cAMP levels in mitogenically responsive hamster (NIL) fibroblasts. Ann. NY Acad. Sci. 485, 249 –263.

31.

Vu, T-K. H., Hung, D. T., Wheaton, V. I., and Coughlin, S. R. (1991). Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64, 1057–1068.

32.

Rasmussen, U. B., Craviari, V. V., Jallat, S., Schlesinger, Y., Pages, G., Pavirani, A., Lecocq, J-P., Pouyssegur, J., and Van Obberghen-Schilling, E. (1991). cDNA cloning and expression of a hamster alpha-thrombin receptor coupled to Ca 12 mobilization. FEBS Lett. 288, 123–128.

33.

Zhong, C., Hayzer, D. J., Corson, M. A., and Runge, M. S. (1992). Molecular cloning of the rat vascular smooth muscle thrombin receptor: Evidence for in vitro regulation by basic fibroblast growth factor. J. Biol. Chem. 267, 16975–16979.

34.

Nystedt, S., Emilsson, K., Wahlestedt, C., and Sundelin, J. (1994). Molecular cloning of a potential novel proteinase activated receptor. Proc. Natl. Acad. Sci. USA 91, 9208 –9212.

35.

Ishihara, H., Connolly, A. J., Zeng, D., Kahn, M. L., Zheng, Y. W., Timmons, C., Tram, T., and Coughlin, S. R. (1997). Protease-activated receptor 3 is a second thrombin receptor in humans. Nature 386, 502–506.

36.

Kahn, M. L., Zheng, Y. W., Huang, W., Bigornia, V., Zeng, D. W., Moff, S., Farese, R. V., Tam, C., and Coughlin, S. R. (1998). A dual thrombin receptor system for platelet activation. Nature 394, 690 – 694.

37.

Kahn, M. L., Hammes, S. R., Botka, C., and Coughlin, S. R. (1998). Gene and locus structure and chromosomal localization of the protease-activated receptor gene family. J. Biol. Chem. 273(36), 23290 –23296.

38.

Vu, T-K. H., Wheaton, V. I., Hung, D. T., Charo, I., and Coughlin, S. R. (1991). Domains specifying thrombin-receptor interaction. Nature 353, 674 – 677.

39.

Baffy, G., Yang, L., Raj, S., Manning, D. R., and Williamson, J. R. (1994). G protein coupling to the thrombin receptor in chinese hamster lung fibroblasts. J. Biol. Chem. 269(11), 8483– 8487.

40.

Vouret-Craviari, V., Van Obberghen-Schilling, E., Rasmussen, U. B., Pavirani, A., Lecocq, J-P., and Pouyssegur, J. (1992). Synthetic alpha-thrombin receptor peptides activate G protein-

430

SOWER ET AL. coupled signaling pathways but are unable to induce mitogenesis. J. Mol. Biol. Cell. 3, 95–102.

41.

58.

Connolly, A. J., Suh, D. Y., Hunt, T. K., and Coughlin, S. R. (1997). Mice lacking the thrombin receptor, PAR1, have normal skin wound healing. Am. J. Pathol. 151, 1199 –1204.

59.

42.

Kim, D. W., Wang, F., Ramakrishnan, S., Scott, D. L., Hensler, T. M., Thompson, W. C., and Carney, D. H. (1994). Mouse fibroblasts defective in thrombin mitogeness possess functional proteolytically activated receptor for thrombin: Requirement for a second signaling pathway. J. Cell. Physiol. 160, 573–584.

60.

43.

Sonne, O. (1988). The specific binding of thrombin to human polymorphonuclear leucocytes. Scan. J. Clin. Lab. Invest. 48, 831.

44.

Jenkins, A. L., Howells, G. L., Scott, E., LeBonniec, B. F., Curtis, M. A., and Stone, S. R. (1995). The response to thrombin of human neutrophils: Evidence for two novel receptors. J. Cell Sci. 108, 3059 –3066.

45.

Kim, D. (1995). Ph.D. Dissertation. The University of Texas Medical Branch at Galveston.

46.

Low, D. A., Wiley, H. S., and Cunningham, D. D. (1985). Role of cell surface thrombin binding sites in mitogenesis. In “Cancer Cells 3/Growth Factors and Transformation,” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

47.

Carney, D. H., and Bergmann, J. S. (1982). 125I-Thrombin binds to clustered receptors on noncoated regions of mouse embryo cell surfaces. J. Cell Biol. 95, 697–703.

61.

62.

63.

64.

48.

Hoxie, J. A., Ahuja, M., Belmonte, E., Pizarro, S., Parton, R., and Brass, L. F. (1993). Internalization and recycling of activated thrombin receptors. J. Biol. Chem. 268, 13756 –13763.

49.

Coughlin, S. R. (1998). Interactions between thrombin and thrombin receptor peptides studied with real-time BIA. Application Note 702, Biacore.

65.

50.

Hoehn, G. T., Stokland, T., Amin, S., Ramirez, M., Hawkins, A. L., Griffin, C. A., Small, D., and Civin, C. I. (1996). Oncogene 12, 903–913.

66.

51.

Chomczynski, P., and Mackey, K. (1995). Substitution of chloroform with bromochloropropane in the single-step method of RNA isolation. Anal. Biochem. 225, 163–164.

52.

53.

Kuribayashi, K., Hikata, M., Hiraoka, O., Miyamoto, C., and Furuichi, Y. (1988). A rapid and efficient purification of poly(A)mRNA by oligo(dT)30-latex. Nucleic Acids Res. Symp. Series. 19, 61– 64. McDonald, J. A., Kelly, D. G., and Broekelmann, T. J. (1982). Role of fibronectin in collagen deposition: Fab9 antibodies to the gelatin binding domain of fibronectin inhibits both fibronectin and collagen organization in fibroblast extracellular matrix. J. Cell Biol. 92, 485– 492.

67.

68.

69.

54.

Guerini, D., Krinks, M. H., Sikela, J. M., Hahn, W. E., and Klee, C. B. (1989). Isolation and sequence of a cDNA clone for human calcineurin B, the Ca 12-binding subunit of the Ca 12 calmodulinstimulated protein phosphatase. DNA 8(9), 675– 682.

70.

55.

Voges, D., Berendes, R., Demange, P., Benz, J., Gottig, P., Liemann, S., Humber, R., and Burger, A. (1995). Structure and function of the ion channel model system annexin V. Adv. Enzymol. Relat. Areas Mol. Biol. 71, 209 –239.

71.

56.

Reutelingsperger, C. P. M., Hornstra, G., and Hemker, H. C. (1985). Isolation and partial purification of a novel anticoagulant from arteries of human umbiblical cord. Eur. J. Biochem. 151, 625– 629.

57.

Scandura, J. M., Ahmad, S. S., and Walsh, P. N. (1996). A binding site expressed on the surface of activated human platelets is shared by factor X and prothrombin. Biochemistry 35, 8890.

72.

73.

74.

Rao, L. V. M., Tait, J., and Hoang, A. D. (1994). Binding of Annexin V to human ovarian carcinoma cell line (OC-2008): Contrasting effects on cell surface factor VIIa/tissue factor activity and prothrombinase activity. Thromb. Res. 67, 517–531. Van Heerde, W. L., Poort, S., van ’t Veer, C., Reutelingsperger, C. P. M., and De Groot, Ph. G. (1994). Binding of recombinant annexin V to endothelial cells: Effects of annexin V binding on endothelial-cell-medicated thrombin formation. Biochemical J. 302, 305–312. Reutelingsperger, C. P. M., Kop, J. M. M., Hornstra, G., and Hemker, H. C. (1988). Purification and characterization of a novel protein from bovine aorta that inhibits coagulation. Eur. J. Biochem. 173, 171–178. Andree, H. A. M., Stuart, M. C. A., Hermens, With., Reutelingsperger, C. P. M., Hemker, H. C., Frederik, P. M., and Willems, G. M. (1992). Clustering of lipid-bound annexin V may explain its anticoagulant effect. J. Biol. Chem. 267, 17907–17912. Almus, F. E., Rao, V. M., and Rapaport, S. I. Regulation of factor VIIa/tissue factor functional activity in an umbiblical vein model. (1993). Arterioscler. Thromb. 13, 105–111. Hauptmann, R., Maurer-Fogy, I., Krystek, E., Bodo, G., Andree, H., and Reutelingsperger, C. P. M. (1989). Vascular anticoagulant B: A novel human Ca 12 phospholipid binding protein that inhibits coagulation and phospholipase A2 activity. Eur. J. Biochem. 185, 63–171. Van Heerde, W. L., Sakariassen, K. S., Hemker, H. C., Sixma, J. J., Reutelingsperger, C. P. M., and De Groot, Ph. G. (1994). Annexin V inhibits the procoagulant activity of matrices of TNF-stimulated endothelium under blood flow conditions. Arterioscler. Thromb. 14, 824 – 830. Romisch, J., and Pacques, E. (1991). Annexins: calcium-binding proteins of multi-functional importance? Med. Microbiol. Immunol. 180, 109 –126. Van Ryn-McKenna, J., Merk, H., Muller, T. H., Buchanan, M. R., and Eisert, W. G. (1993). The effects of heparin and annexin V on fibrin accretion after injury in the jugular veins of rabbits. Thromb. Haemost. 69, 227–230. Sun, J., Bird, P., and Salem, H. H. (1993). Interaction of annexin V and platelets: Effects on platelet function and protein S binding. Thrombosis Res. 69(3), 289 –296. Parente, L., Solito, E., Giannessi, P., Paggiari, P., Sicari, R., and De Caterina, R. (1992). Inhibition of eicosanoid formation and lipocortin induction by glucocorticoids in human cell lines and in patients with inflammatory lung disease. Pharmacol. Res. 26(Suppl. 2), 44 – 45. Mollenhauer, J., and von der Mark, K. (1983). Isolation and characterization of a collagen-binding glycoprotein from chondrocyte membranes. EMBO J. 2, 45–50. Schlaepfer, D. D., Mehlman, T., Burgess, W. H., and Haigler, H. T. (1987). Structural and functional characterization of endonexin II, a calcium- and phospholipid-binding protein. Proc. Natl. Acad. Sci. USA 84, 6078 – 6082. Giambanco, I., Pula, G., Bianchi, R., and Donato, R. (1990). Interaction of two brain annexins, CaBP33 and CaBP37, with membrane-skeletal proteins. FEBS Lett. 267, 171–175. Kirsch, T., and Pfaffle, M. (1992). Selective binding of anchorin CII (AnnexinV) to type II and X collagen and to chondrocalcin (C-propeptide of type II collagen). FEBS Lett. 310, 143–147. Wu, L. N. Y., Genge, B. R., Lloyd, G. C., and Wuthier, R. E. (1991). Collagen-binding protein in collagenase-released matrix vesicles from cartilage. J. Biol. Chem. 266, 1195–1203. Dubois, T., Oudinet, J. P., Mira, J. P., and Russo-Marie, R. (1996). Annexins and protein kinase C. Biochim. Biophys. Acta. 1313, 290 –294.

THROMBIN PEPTIDE INDUCES DIFFERENTIAL GENE EXPRESSION 75.

76.

77.

78.

79.

Schlaepfer, D. D., Jones, J., and Haigler, H. T. (1992). Inhibition of protein kinase C by annexin V. Biochemistry 31, 1886 – 1891. Raynal, P., Hullin, F., Ragab-Thomas, J. M. F., Fauvel, J., and Chap, H. (1993). Annexin V as a potential regulator of annexin 1 phosphorylation by protein kinase C. Biochem. J. 292, 759 –765. Rothhut, B., Dubois, T., Feliers, D., Russo-Marie, F., and Oudinet, J. P. (1995). Inhibitory effect of annexin V on protein kinase C activity in mesangial cell lysates. Eur. J. Biochem. 232, 865– 872. Shibata, S., Sato, H., and Maki, M. (1992). Calphobindings (placental annexins) inhibit protein kinase C. J. Biochem. 112, 552–556. Dubois, T., Oudinet, J. P., Mira, J. P., and Russo-Marie, R. (1996). Annexins and protein kinase C. Biochim. Biophys. Acta 1313, 290 –294.

Received July 15, 1998 Revised version received December 15, 1998

431

80.

Bhat, N. R., Ahang, P., and Hogan, E. L. (1995). Thrombin activates mitogen-activated protein kinase in primary astrocyte cultures. J. Cell. Physiol. 165(2), 417– 424.

81.

Wheeler-Jones, C. P., and Pearson, J. D. (1995). Thrombin and histamine phosphorylate the 42 kDa mitogen-activated protein kinase in HUVEC. Biochem. Soc. Trans. 23(2), 203S.

82.

Nakashima, S., Chatani, Y., Nakamura, M., Miyoshi, N., Kohono, M., and Nozawa, Y. (1994). Tyrosine phosphorylation and activation of mitogen-activated protein kinases by thrombin in human platelets: Possible involvement in late arachidonic acid release. Biochem. Biophys. Res. Commun. 198(2), 497–503.

83.

Wilner, G. D., Danitz, M. P., Mudd, S. M., Hsieh, K-H., and Fenton, J. W., II (1981). Selective immobilization of alphathrombin by surface-bound fibrin. J. Lab. Clin. Med. 97(3), 403– 411.