- Email: [email protected]
Thrombin regulates matrix metalloproteinase-9 expression in human monocytes
Biochemical and Biophysical Research Communications 385 (2009) 241–246
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Thrombin regulates matrix metalloproteinase-9 expression in human monocytes Chi-Jen Chang a, Lung-An Hsu a, Yu-Hsein Ko a, Pei-Ling Chen a, Yi-Ting Chuang a, Chun-Yen Lin b, Chang-Hui Liao c, Jong-Hwei S. Pang d,* a
The First Cardiovascular Division, Chang-Gung University, Tao-Yuan, Taiwan Department of Hepatogastroenterology, Chang Gung Memorial Hospital, Chang-Gung University, Tao-Yuan, Taiwan c Graduate Institute of Natural Products, Chang-Gung University, Tao-Yuan, Taiwan d Graduate Institute of Clinical Medical Sciences, Chang-Gung University, 259 Wen-Hwa 1st Road, Kwei-Shan, Tao-Yuan 333, Taiwan b
a r t i c l e
i n f o
Article history: Received 5 May 2009 Available online 18 May 2009
Keywords: Thrombin Matrix metalloproteinase Monocytes
a b s t r a c t We investigated whether thrombin, the final activator of coagulation cascade, regulates expression of matrix metalloproteinases (MMP)-9 in human monocytes. We show that thrombin stimulation induced MMP-9 secretion of monocytes dose- and time-dependently as revealed by gelatin zymography. Real-time RT-PCR and Western blot analysis demonstrated that thrombin up-regulated mRNA and protein levels of MMP-9. Pre-incubation with anti-protease-activated receptor (PAR)-1 or anti-PAR-3 antibody partially inhibited the thrombin-induced MMP-9 secretion. Simultaneous incubation with both showed synergistic effect, indicating the involvement of both receptors in this thrombin effect. BAPTA, a Ca2+ chelator, abolished the thrombin-induced MMP-9 secretion, indicating the requirement of Ca2+ mobilization in this process. Inhibition of thrombin-induced MMP-9 secretion by either MEK inhibitor or p38 kinase inhibitor revealed that the thrombin effect was mediated by both ERK1/2 and p38 pathways. The activation of NFjB by thrombin as demonstrated by electromobility shift assay was also shown to be critical to the thrombin-induced MMP-9 up-regulation. Ó 2009 Elsevier Inc. All rights reserved.
Introduction MMPs are generally expressed at low levels in normal adult tissues, but could be up-regulated during physiological and pathological remodeling processes. Among the mechanisms involved in the pathogenesis of acute coronary syndrome, dysregulation of MMP expression by monocyte-derived macrophages has been revealed to play an important role. Increased expression of MMPs contributes to disruption or ulceration of atheroma, which triggers the intravascular thrombosis [1–7]. On the other hand, intravascular thrombus itself could be a potential source of MMP secretion. The mural thrombus in the human aortic aneurysm has been shown recently to be a source of MMP-9 secretion [8]. In specimens of thrombosed arteriovenous fistulae for hemodialysis access, we also demonstrated preferential expression of MMP-9 by the monocytes nearby the luminal thrombus [9]. These findings suggest that components of the thrombus may regulate MMP-9 expression in human monocytes. This study investigated whether thrombin regulates the expression of MMP-9 in human monocytes. We also investigated the * Corresponding author. Fax: +886 3 3281192. E-mail address: [email protected] (Jong-Hwei S. Pang). 0006-291X/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2009.05.049
potential thrombin receptors and cell signaling pathways involved in regulation of MMP-9 expression. Materials and methods Materials. CD14 microbeads were purchased from Meltenyi Biotec (Auburn CA) and Ficoll-Hypaque from Pharmacia (Uppsala, Sweden). Human thrombin (activity P2000 lnits/mg protein), control mouse and rabbit IgGs and curcumin were from Sigma (St. Louis, MO). Monoclonal anti-human protease-activated receptor (PAR)-1 (ATAP-2) antibody, rabbit anti-human PAR-3 (H-103) antibody and monoclonal anti-NFjB p65 antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). PAR-1 agonist peptide (TFLLR) was from Peptides International (Louisville, Ken). 20 -amino-30 -methoxyflavone (PD98059) and 4-(4-fluorophenyl)-2(4-methylsulfinylphenyl)-5-(4-pyridyl)1 H-imidazole (SB203580) were from Calbiochem (San Diego, CA). Monoclonal anti-human ERK1/2, anti-human phospho-ERK1/2, anti-human p38, and antihuman phospho-p38 antibodies were purchased from Cell Signaling Technology (Beverly, MA). RPMI 1640, fetal bovine serum and SuperScript III reverse transcriptase were obtained from Invitrogen (Carlsbad, CA). Fura-2 penta-acetoxymethylester (Fura-2/AM) and 1,2-bis (aminophenoxy) ethane-N,N,N0 ,N0 -tetraacetoxymethyl ester
242
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
(BAPTA) were from Molecular Probe (Eugene, OR). LightCycler FastStart DNA Master SYBR Green 1 and DIG Gel Shift kit were purchased from Roche Diagnostics (Mannheim, Germany). Endotoxin levels in thrombin and other reagents were <10 pg/mL as determined by Limulus amoebocyte lysate assay. Isolation and culture of monocytes. The study was performed according to the principles of the Declaration of Helsinki and was approved by the Ethics Committee of Chang Gung Memorial Hospital. Peripheral blood mononuclear cell isolated from normal healthy donor by Ficoll-Hypaque centrifugation were enriched for CD14+ monocytes using the autoMACS magnetic cell sorting system (Miltenyi Biotec, Bergisch Gladbach, Germany) as described previously [10]. Briefly, peripheral blood mononuclear cells were incubated with saturating concentrations of CD14 microbeads on ice for 15 min, washed, and suspended in PBS containing 2 mM EDTA and 0.5% bovine serum albumin. The cell suspension was then applied to the autoMACS separator using the positive selection program. The CD14-positive monocytes were eluted from the magnetic column and placed into 3-cm culture dishes (1 106 cells per dish). A purity of >95% were routinely obtained as confirmed by flow cytometry assay. Isolated CD14+ monocytes as well as human THP1 cell were cultured in RPMI 1640, supplemented with 50 U/mL penicillin and 50 lg/mL streptomycin, and 1% fetal bovine serum. Real-time reverse transcription-polymerase chain reaction. Total RNA was isolated from human monocytes by lysis in a guanidinium isothiocyanate buffer, followed by single step phenol–chloroform– isoamyl alcohol extraction. Isolated RNA was transcribed to complementary DNA using Super-Script III reverse transcriptase and oligo-dT primers and quantitative real-time PCR was performed with SYBR Green I chemistry (applied Biosystems, CA). Expression levels of tested genes were normalized according to the expression level of ribosomal protein L35a (RPL 35a). The reactions were performed in triplicates, and the experiments were repeated independently at least three times. The primer sequences were as follows: MMP-9 forward: 50 -GAACCAATCTCACCGACAGG-30 , MMP-9 reverse: 50 -GC CACCCGAGTGTAACCATA-30 , TIMP-1 forward: 50 -GGGCTTCACCAAG ACCTACA-30 , TIMP-1 reverse: 50 -TGCAGGGGATGGATAAACAG-30 , RPL35a forward: 50 -GCTGTGGTCCAAGGCCATTTT-30 and RPL35a reverse: 50 -CCGAGTTACTTTTCCCCAGATGAC-30 . Western blot analysis. Human monocytes were washed twice with phosphate-buffered saline and lysed in lysis buffer containing Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 2 mM DTT, 2 mM PMSF and 1% Triton X-100 by sonication. Samples were electrophoresed on 10% SDS–polyacrylamide gel, transferred to PVDF membranes and subsequently blocked in blocking solution (1% BSA, 1% goat serum in PBS). Membranes were then incubated with the indicated primary antibodies, followed by horseradish peroxidase-conjugated secondary antibodies. Blot were developed using the enhanced chemiluminescence. Gelatin zymography. Electrophoresis was performed with conditioned medium collected from cell cultures on a 10% polyacrylamide/SDS gel containing 1 mg/ml gelatin. SDS was removed by washing in 2.5% Triton X-100 for 1 h at room temperature before the enzyme reaction. The gel was incubated overnight at 37 °C in enzyme buffer containing 50 mM Tris, pH 7.5, 200 mM NaCl, 5 mM CaCl2 and 0.02% Brij-35. Areas of gelatin degradation, identified as MMP activity, appeared as distinct white bands after staining the gels with 0.5% Brilliant Blue G-250. Measurement of intracellular calcium concentration. Intracellular calcium concentrations ([Ca2+]i) were measured by Grynkiewicz’s method using fura-2/AM [11]. Briefly, monocytes were incubated with 3 lM fura-2/AM at 37 °C for 30 min in serum free RPMI 1640 medium. The assay was done with 1 106 monocytes/ml in Locke’s solution (154 mM NaCl, 5.6 mM KCl, 1.2 mM MgCl2, 5 mM HEPES, pH 7.3, 10 mM glucose, and 2 mM CaCl2). The
fluorescence changes at excitation wavelengths of 340 and 380 nm and a common emission wavelength of 500 nm were detected. Cytosolic free calcium was calculated from the fluorescence ratio at the two excitation wavelengths. The fluorescent images were acquired on an inverted Zeiss Axiovert 200 M microscope (Carl Zeiss Light Microscopy, Germany) equipped with automatic switching dual wavelength filter wheel and CCD camera (Cool SNAP HQ Microscope camera). Image processing was performed with SLIDEBOOK (Intelligent Imaging Innovation, Inc.). Electromobility shift assay. Nuclei were isolated from THP-1 cells according to the method described by Dignam [12]. The electromagnetic mobility shift assay was conducted using the DIG Gel Shift kit according to the manufacturer’s instructions. Oligonucleotides containing the NFjB binding site 50 AGTTGAGGGGACTTTCCCAGGC were end-labeled with DIG-11-ddUTP using terminal transferase. Assays were performed by incubating 5 lg of nuclear protein with DIG-labeled DNA probe, then loading them onto a 6% polyacrylamide gel and electrophoresing at 80 V for 1.5 h. For competition analysis, cold probe in 100-fold excess was added prior to the DIG-labeled probe. Following electrophoresis, the protein–DNA complex was transferred to a nylon membrane using electroblotting. The protein– DNA complexes were visualized by incubating the membrane with antidigoxigenin-AP conjugate and a chemiluminescent substrate solution (CSPD) followed by autoradiography. Immunocytochemistry for NFjB. Human monocytes cultured on cover slips with or without thrombin treatment were fixed in 4% formaldehyde (pH 7.5) followed by methanol permeabilization. The coverslips were first immersed in blocking solution containing 1% BSA and 1% goat serum in PBS and then incubated with monoclonal anti-NFjB p65 antibody primary antibody followed by secondary antibody. DAKO labeled streptavidin–biotin system was used to detect the signal and color development was performed by incubation with DAB substrate-chromogen. After counterstaining the cell nuclei with hematoxylin, coverslips were mounted. Statistical analysis. Optical densities of MMP-9 and TIMP-1 signals on X-ray films were measured by computer-assisted densitometry for quantification of changes in protein expression. Data are expressed as mean ± SEMs. For repeated measures, differences between groups were determined using Student’s unpaired t test. Differences were considered significant for p < 0.05.
Results Thrombin induces MMP-9 secretion of human monocytes in a time- and dose-dependent manner Human monocytes were treated with thrombin 8 U/mL and MMP-9 secretion in the media was analyzed using gelatin zymography. As demonstrated in Fig. 1A, the MMP-9 secretion was detected in the conditioned medium as early as 6 h after thrombin stimulation and persisted up to 30 h. The MMP-9 detected in the conditioned media was of proform. To investigate the dose effect of thrombin on MMP-9 secretion, cells were treated with various concentrations of thrombin for 24 h. Weak MMP-9 activity was detected in the conditioned media by zymography at the dose of as low as 0.1 U/mL. The activity increased dose-dependently with the thrombin dose up to 8 U/mL (Fig. 1B). Effect of thrombin on MMP-9 and TIMP-1 expressions in human monocytes at the transcriptional and translational levels The effect of thrombin stimulation on expression of MMP-9 mRNA in monocytes was determined by real-time RT-PCR. The expression of TIMP-1, the major endogenous inhibitor of MMP-9,
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
243
Fig. 1. Effect of thrombin on MMP-9 expression in human monocytes. (A) Human monocytes were stimulated with thrombin at the dose of 8 U/mL of thrombin for 0, 6, 12, 18, 24 and 30 h. The secreted MMP-9 in conditioned medium was measured by gelatin zymography. The conditioned media of cultured THP-1 cells stimulated with PMA 125 ng/mL was used as positive control (Lane 8). (B) Human monocytes were treated with various doses of thrombin (0, 0.01, 0.1, 1, 4 and 8 U/mL) for 24 h. The secreted MMP-9 in the conditioned medium was measured by gelatin zymography. (C) Total RNA was isolated from monocytes with or without thrombin (8 U/mL) pretreatment for 24 h. Transcripts for MMP-9 and TIMP-1 were detected by real-time PCR. Ribosomal protein (RPL35A) was used as the internal control. Average transcriptome abundance based on amplication efficiency normalized to the expression of the RPL35A. The bars represent the mean ± SEM of four experiments (*P < 0.05 thrombin treated vs untreated control). (D) The protein levels of MMP-9 and TIMP-1 in conditioned medium were measured by Western blot analysis. The figures are representative of four independent experiments.
was also investigated. When stimulated with thrombin at 8 U/mL for 24 h, MMP-9 mRNA expression increased by 11-folds (p = 0.03). In contrast, TIMP-1 mRNA expression remained unchanged in response to thrombin stimulation (p = 0.88) (Fig. 1C). MMP-9 protein expression was then determined in conditioned medium by Western blot analysis. In consistence with the finding of real-time PT-PCR, thrombin stimulation induced increased MMP-9 protein expression by 8-folds. (p = 0.01). The expression of TIMP-1 protein remained unchanged (p = 0.30) (Fig. 1D). Thrombin induces MMP-9 up-regulation in human monocytes through PAR-1 and PAR-3 Human monocytes have been demonstrated to express two known thrombin receptors, mainly PAR-1 and significantly less PAR-3 [13]. To investigate the roles of PAR-1 and PAR-3, we analyzed MMP-9 secretion in the presence of antibodies against human PAR-1 and PAR-3. Monocytes were preincubated with anti-human PAR-1 antibody (ATAP-2, 10 lg/mL) or anti-PAR-3 antibody (H103, 10 lg/mL) alone, or with both anti-PAR-1 and anti-PAR-3 antibodies (10 lg/mL each) simultaneously for 1 h
before stimulation with thrombin (8 U/mL) for 24 h. Preincubation with nonspecific mouse or rabbit IgG (10 lg/mL, respectively) served as negative controls. Preincubation with either anti-PAR-1 or anti-PAR-3 antibody partially inhibited the thrombin-induced MMP-9 secretion in the conditioned medium. Preincubation with both anti-PAR-1 and anti-PAR-3 antibodies together synergistically inhibited the MMP-9 secretion. When stimulated with PAR-1 agonist peptide (TFLLR-NH2, 10 lM) for 24 h, the MMP-9 activity of monocytes was also induced, which further confirmed that this thrombin receptor was involved in MMP-9 up-regulation (Fig. 2A). Together, these data suggested that the up-regulation of MMP-9 expression in human monocytes by thrombin was mediated by both PAR-1 and PAR-3. Thrombin-triggered increased intracellular calcium was required for the MMP-9 up-regulation in human monocytes Then we examined the effect of thrombin-induced intracellular calcium mobilization on the regulation of MMP-9 expression. When Fura-2-loaded monocytes were stimulated with 8 U/mL, a rapid increase in intracellular free calcium was observed. Preincubation
244
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
Fig. 3. Thrombin induces MMP-9 up-regulation in human monocytes through activation of ERK1/2 and p38. (A) Monocytes were stimulated with thrombin (8 U/ mL) for different times. Whole cell lysates were analyzed by Western blot using anti-ERK1/2, anti-phospho-ERK1/2, anti-p38 and anti-phospho-p38 antibodies. These figures are representative of three independent experiments. (B) Monocytes with or without preincubation with PD98059 (10 lM) or SB203580 (10 lM) for 1 h were stimulated with thrombin (8 U/mL) for 24 h. The secreted MMP-9 in the conditioned medium was measured by gelatin zymography. The figure is representative of four independent experiments. Fig. 2. Thrombin induces MMP-9 up-regulation in human monocytes through PAR1 and PAR-3, and calcium mobilization. (A) Human monocytes were preincubated with anti-human PAR-1 (ATAP-2, 10 lg/mL) or anti-human PAR-3 antibody (H103, 10 lg/mL) alone, or with both anti-PAR-1 and anti-PAR-3 (10 lg/mL each) antibodies simultaneously for 1 h before stimulation with thrombin (8 U/mL) for 24 h. Preincubation with nonspecific mouse or rabbit IgG (10 lg/mL, respectively) served as negative controls. The monocytes were also stimulated with the PAR-1 agonist peptide (TFLLR-NH2, 10 lM) alone for 24 h. The secreted MMP-9 in conditioned medium was determined by gelatin zymography. The figure is representative of four independent experiments. (B) Monocytes loaded with Fura2/AM were incubated with thrombin (8 U/mL) in the presence or absence of BAPTA (20 lM). Cytosolic free calcium was calculated from the fluorescence ratio (340:380 nm). The figure is representative of four independent experiments. (C) Monocytes were stimulated with thrombin (8 U/mL) for 24 h with or without pretreatment with BAPTA (20 lM). The secreted MMP-9 in conditioned medium was determined by gelatin zymography. The figure is representative of four independent experiments.
of monocytes with BAPTA (20 lM), a calcium chelating agent, completely abolished the thrombin-induced increase in calcium (Fig. 2B). Zymographic analysis showed that thrombin-induced MMP-9 secretion was also completely abolished by preincubation of monocytes with BAPTA (Fig. 2C), suggesting that calcium mobilization played an essential role in thrombin-induced MMP-9 expression. Thrombin induced MMP-9 up-regulation in human monocytes through activation of extracellular signaling-regulated protein kinase 1/2 and p38 We examined whether mitogen-activated protein kinases (MAPKs) were involved in thrombin-induced up-regulation of MMP-9. When monocytes were stimulated with thrombin at the concentration of 8 U/mL, phosphorylation of ERK1/2 and p38 increased, with maximal activity at 45 min after stimulation (Fig. 3A). Pretreatment of monocytes with PD98059 (10 lM), a selective MEK inhibitor, and SB203580 (10 lM), a p38 inhibitor,
for 1 h before thrombin stimulation inhibited the up-regulation of MMP-9 (Fig. 3B). These results indicated that thrombin induced MMP-9 up-regulation in human monocytes through both ERK1/2 and p38 pathways. NFjB activation is necessary for thrombin-induced MMP-9 upregulation in human monocytes To test whether thrombin induce MMP-9 up-regulation in human monocytes through NFjB pathway, we tested the effect of curcumin, an inhibitor of NFjB, on MMP-9 expression in human monocytes. Monocytes were pretreated with curcumin (25 lM) 1 h before thrombin stimulation. Zymography analysis showed that thrombin-induced MMP-9 secretion was completely inhibited by preincubation with curcumin (Fig. 4A). In Fig. 4B, immunocytochemical staining demonstrated the thrombin-induced nuclear translocation of NFjB in human monocytes. The staining of NFjB p65 was found predominantly in the cytosol at baseline and translocated progressively into the nuclei from 30 to 90 min after thrombin stimulation. At 90 min, the anti-NFjB p65 signal was found exclusively in the nuclei (Fig. 4C). Using human monocytic THP-1 cells, we further examined the effect of thrombin on the DNA binding activity of NFjB. Nuclear extracts prepared from cells stimulated with thrombin (8 U/mL) for 0, 30, 60 and 90 min were processed for electromobility shift assay with labeled DNA probe containing NFjB binding sequence. Exposure to phorbol myristate acetate (PMA) (125 ng/mL) served as a positive control. The NFjB DNA-biding activity was low at the baseline. The binding activity increased in response to thrombin stimulation with a maximal activity at 90 min after stimulation. Specificity of this thrombin-induced DNA–protein complex formation was confirmed by the competitive inhibition in the presence of a 100-fold excess of unlabeled DNA probe (Fig. 4C). These data indicated that thrombin induced MMP-9 up-regulation in human monocytes through NFjB pathway.
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
245
Thrombin has been shown in previous studies to up-regulate expression of MMP-9 in several cell types including oral squamous cell carcinoma [14], human dermal fibroblast [15] and mesangial cells [16], microvascular endothelial cells from human brain [17] and rabbit aortic smooth muscle cells [18]. In monocytes, thrombin-induced MMP-9 up-regulation may have potentially important impact on pathogenesis of acute coronary syndrome. Monocytes in circulation are not exposed to the active form of thrombin in normal physiological condition. However, the monocytes, trapped inside or nearby the thrombus in the thrombosed coronary arteries of patients with acute coronary syndrome, may be exposed to active thrombin generated from the thrombi and secrete MMP-9 as demonstrated in vitro in this study. Increased MMP-9 expression has been demonstrated to be involved in atheroma disruption and consequent thrombosis, which is the pivotal pathological mechanism of acute coronary syndrome [7]. Thrombin-induced MMP-9 up-regulation in these vulnerable atheroma may cause further instability of the atheroma and could beget further thrombus formation. One recent study done by Bea et al. provided in vivo evidences to support this hypothesis [19]. In apolipoprotein E-deficient mice, they demonstrated that thrombin inhibition by oral feeding of melagtran, a direct thrombin inhibitor, reduced MMP-9 protein and promoted plaque stability in advanced atheroma of aorta. In conclusion, this study demonstrated the effect of thrombin in inducing expression of MMP-9 in monocytes. These findings suggest that thrombin could play other important roles beside procoagulation in acute coronary syndrome. Antithrombin therapy may potentially provide benefit other than anticoagulation in patients with acute coronary syndrome. Acknowledgment Fig. 4. The up-regulation of MMP-9 by thrombin requires the activation of NFjB. (A) Human monocytes were preincubated with or without curcumin (25 lM) at 37 °C for 1 h and then stimulated with thrombin (8 U/mL) for 24 h. The secreted MMP-9 in the conditioned medium was determined by gelatin zymography. The figure is representative of four independent experiments. (B) Monocytes cultured on cover slips were collected at 0, 30, 60 and 90 min after stimulation with thrombin (8 U/mL) and immuno-stained with anti-NFjB p65 antibody. Nuclei were counterstained with hematoxylin. The figure is representative of three independent experiments. (C) Human monocytic THP-1 cells were stimulated with thrombin (8 U/mL) for 0, 30, 60 and 90 min. Nuclear proteins were extracted and processed for electrophoretic mobility shift assay. The NFjB/DNA complex was detected using a DIG-11-ddUTP-end labeled NFjB oligonucleotide probe. The specificity of this NFjB/DNA complex was confirmed by the competition experiment using 100-fold excess of unlabeled NFjB DNA probe. The figure is representative of three independent experiments.
Discussion This study demonstrated that thrombin up-regulates MMP-9 expression in human monocytes. The expression of TIMP-1 is not affected instead. We showed that both thrombin receptors of human monocytes, the PAR-1 and PAR-3, are involved in the thrombin-induced MMP-9 expression in human monocytes. This result is compatible with the findings of Colognato et al. [13]. They demonstrated that both PAR-1 and PAR-3 are functionally active in human monocytes and could elicit a cytosolic [Ca2+] increase in response to stimulation by thrombin. They further showed that PAR-1 activation is only partially responsible for the thrombin-induced cytosolic [Ca2+] increase, suggesting that PAR-3 is also partially responsible for Ca2+mobilization. Because agonist specific for PAR-3 is not yet available, it is currently not possible to test directly the functional activity of PAR-3 in human monocytes. We also demonstrated that Ca2+ mobilization, activation of ERK1/ 2 and p38 pathways and the DNA binding activity of NFjB are essential for the up-regulation of MMP-9 in monocytes.
The work was supported by Chang Gung Memorial Hospital Grant (CMRP-G3405). References [1] Z.S. Galis, G.K. Sukhova, M.W. Lark, P. Libby, Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques, J. Clin. Invest. 94 (1994) 2493–2503. [2] R.T. Lee, F.J. Schoen, H.M. Loree, M.W. Lark, P. Libby, Circumferential stress and matrix metalloproteinase 1 in human coronary atherosclerosis: implication for plaque rupture, Arterioscler. Thromb. Vasc. Biol. 16 (1996) 1070–1073. [3] P.K. Shah, E. Falk, J.J. Badimon, A. Fernandez-Ortiz, A. Mailhac, G. Villareal-Levy, J.T. Fallon, J. Regnstrom, V. Fuster, Human monocyte-derived macrophages induce collagen breakdown in fibrous caps of atherosclerotic plaques: potential role of matrix-degrading metalloproteinases and implications for plaque rupture, Circulation 92 (1995) 1565–1569. [4] G.K. Sukhova, U. Schonbeck, E. Rabkin, F.J. Schoen, A.R. Poole, R.C. Billinghurst, P. Libby, Evidence for increased collagenolysis by interstitial collagenases-1 and -3 in vulnerable human atheromatous plaques, Circulation 99 (1999) 2503–2509. [5] Z.S. Galis, G.K. Sukhova, R. Kranzhöfer, S. Clark, P. Libby, Macrophage foam cells from experimental atheroma constitutively produce matrix-degrading proteinases, Proc. Natl. Acad. Sci. USA 92 (1995) 402–406. [6] P.J. Gough, I.G. Gomez, P.T. Wille, E.W. Raines, Macrophage expression of active MMP-9 induces acute plaque disruption in apoE-deficient mice, J. Clin. Invest. 116 (2006) 59–69. [7] Z.S. Galis, J.J. Khatri, Matrix metalloproteinases in vascular remodeling and atherogenesis: the good, the bad, and the ugly, Circ. Res. 90 (2002) 251–262. [8] V. Fontaine, M.P. Jacob, X. Houard, P. Rossignol, D. Plissonnier, E. Angles-Cano, J.B. Michel, Involvement of the mural thrombus as a site of protease release and activation in human aortic aneurysms, Am. J. Pathol. 161 (2002) 1701–1710. [9] C.J. Chang, Y.S. Ko, P.J. Ko, L.A. Hsu, C.F. Chen, C.W. Yang, T.S. Hsu, J.H. Pang, Thrombosed arteriovenous fistula for hemodialysis access is characterized by a marked inflammatory activity, Kidney Int. 68 (2005) 1312–1319. [10] S. Miltenyi, W. Muller, W. Weichel, A. Radbruch, High gradient magnetic cell separation with MACS, Cytometry 11 (1990) 231–238. [11] G. Grynkiewicz, M. Poenie, R.Y. Tsien, A new generation of Ca2+ indicators with greatly improved fluorescence properties, J. Biol. Chem. 260 (1985) 3440– 3450. [12] J.D. Dignam, R.M. Lebovitz, R.G. Roeder, Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei, Nucleic Acids Res. 11 (1983) 1475–1489.
246
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
[13] R. Colognato, J.R. Slupsky, M. Jendrach, L. Burysek, T. Syrovets, T. Simmet, Differential expression and regulation of protease-activated receptors in human peripheral monocytes and monocyte-derived antigen-presenting cells, Blood 102 (2003) 2645–2652. [14] Y. Liu, M.Z. Gilcrease, Y. Henderson, X.H. Yuan, G.L. Clayman, Z. Chen, Expression of protease-activated receptor 1 in oral squamous cell carcinoma, Cancer Lett. 169 (2001) 173–180. [15] L. Wang, J. Luo, S. He, Induction of MMP-9 release from human dermal fibroblasts by thrombin: involvement of JAK/STAT3 signaling pathway in MMP-9 release, BMC Cell Biol. 8 (2007) 14. [16] W.H. Liu, X.M. Chen, B. Fu, Thrombin stimulates MMP-9 mRNA expression through AP-1 pathway in human mesangial cells, Acta Pharmacol. Sin. 21 (2000) 641–645.
[17] K. Kolev, J. Skopal, L. Simon, E. Csonka, R. Machovich, Z. Nagy, Matrix metalloproteinase-9 expression in post-hypoxic human brain capillary endothelial cells: H2O2 as a trigger and NF-kappaB as a signal transducer, Thromb. Haemost. 90 (2003) 528–537. [18] R.P. Fabunmi, A.H. Baker, E.J. Murray, R.F. Booth, A.C. Newby, Divergent regulation by growth factors and cytokines of 95 and 72 kDa gelatinases and tissue inhibitors or metalloproteinases-1, -2, and -3 in rabbit aortic smooth muscle cells, Biochem. J. 315 (Pt 1) (1996) 335–342. [19] F. Bea, J. Kreuzer, M. Preusch, S. Schaab, B. Isermann, M.E. Rosenfeld, H. Katus, E. Blessing, Melagatran reduces advanced atherosclerotic lesion size and may promote plaque stability in apolipoprotein E-deficient mice, Arterioscler. Thromb. Vasc. Biol. 26 (2006) 2787–2792.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Thrombin regulates matrix metalloproteinase-9 expression in human monocytes Chi-Jen Chang a, Lung-An Hsu a, Yu-Hsein Ko a, Pei-Ling Chen a, Yi-Ting Chuang a, Chun-Yen Lin b, Chang-Hui Liao c, Jong-Hwei S. Pang d,* a
The First Cardiovascular Division, Chang-Gung University, Tao-Yuan, Taiwan Department of Hepatogastroenterology, Chang Gung Memorial Hospital, Chang-Gung University, Tao-Yuan, Taiwan c Graduate Institute of Natural Products, Chang-Gung University, Tao-Yuan, Taiwan d Graduate Institute of Clinical Medical Sciences, Chang-Gung University, 259 Wen-Hwa 1st Road, Kwei-Shan, Tao-Yuan 333, Taiwan b
a r t i c l e
i n f o
Article history: Received 5 May 2009 Available online 18 May 2009
Keywords: Thrombin Matrix metalloproteinase Monocytes
a b s t r a c t We investigated whether thrombin, the final activator of coagulation cascade, regulates expression of matrix metalloproteinases (MMP)-9 in human monocytes. We show that thrombin stimulation induced MMP-9 secretion of monocytes dose- and time-dependently as revealed by gelatin zymography. Real-time RT-PCR and Western blot analysis demonstrated that thrombin up-regulated mRNA and protein levels of MMP-9. Pre-incubation with anti-protease-activated receptor (PAR)-1 or anti-PAR-3 antibody partially inhibited the thrombin-induced MMP-9 secretion. Simultaneous incubation with both showed synergistic effect, indicating the involvement of both receptors in this thrombin effect. BAPTA, a Ca2+ chelator, abolished the thrombin-induced MMP-9 secretion, indicating the requirement of Ca2+ mobilization in this process. Inhibition of thrombin-induced MMP-9 secretion by either MEK inhibitor or p38 kinase inhibitor revealed that the thrombin effect was mediated by both ERK1/2 and p38 pathways. The activation of NFjB by thrombin as demonstrated by electromobility shift assay was also shown to be critical to the thrombin-induced MMP-9 up-regulation. Ó 2009 Elsevier Inc. All rights reserved.
Introduction MMPs are generally expressed at low levels in normal adult tissues, but could be up-regulated during physiological and pathological remodeling processes. Among the mechanisms involved in the pathogenesis of acute coronary syndrome, dysregulation of MMP expression by monocyte-derived macrophages has been revealed to play an important role. Increased expression of MMPs contributes to disruption or ulceration of atheroma, which triggers the intravascular thrombosis [1–7]. On the other hand, intravascular thrombus itself could be a potential source of MMP secretion. The mural thrombus in the human aortic aneurysm has been shown recently to be a source of MMP-9 secretion [8]. In specimens of thrombosed arteriovenous fistulae for hemodialysis access, we also demonstrated preferential expression of MMP-9 by the monocytes nearby the luminal thrombus [9]. These findings suggest that components of the thrombus may regulate MMP-9 expression in human monocytes. This study investigated whether thrombin regulates the expression of MMP-9 in human monocytes. We also investigated the * Corresponding author. Fax: +886 3 3281192. E-mail address: [email protected] (Jong-Hwei S. Pang). 0006-291X/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2009.05.049
potential thrombin receptors and cell signaling pathways involved in regulation of MMP-9 expression. Materials and methods Materials. CD14 microbeads were purchased from Meltenyi Biotec (Auburn CA) and Ficoll-Hypaque from Pharmacia (Uppsala, Sweden). Human thrombin (activity P2000 lnits/mg protein), control mouse and rabbit IgGs and curcumin were from Sigma (St. Louis, MO). Monoclonal anti-human protease-activated receptor (PAR)-1 (ATAP-2) antibody, rabbit anti-human PAR-3 (H-103) antibody and monoclonal anti-NFjB p65 antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). PAR-1 agonist peptide (TFLLR) was from Peptides International (Louisville, Ken). 20 -amino-30 -methoxyflavone (PD98059) and 4-(4-fluorophenyl)-2(4-methylsulfinylphenyl)-5-(4-pyridyl)1 H-imidazole (SB203580) were from Calbiochem (San Diego, CA). Monoclonal anti-human ERK1/2, anti-human phospho-ERK1/2, anti-human p38, and antihuman phospho-p38 antibodies were purchased from Cell Signaling Technology (Beverly, MA). RPMI 1640, fetal bovine serum and SuperScript III reverse transcriptase were obtained from Invitrogen (Carlsbad, CA). Fura-2 penta-acetoxymethylester (Fura-2/AM) and 1,2-bis (aminophenoxy) ethane-N,N,N0 ,N0 -tetraacetoxymethyl ester
242
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
(BAPTA) were from Molecular Probe (Eugene, OR). LightCycler FastStart DNA Master SYBR Green 1 and DIG Gel Shift kit were purchased from Roche Diagnostics (Mannheim, Germany). Endotoxin levels in thrombin and other reagents were <10 pg/mL as determined by Limulus amoebocyte lysate assay. Isolation and culture of monocytes. The study was performed according to the principles of the Declaration of Helsinki and was approved by the Ethics Committee of Chang Gung Memorial Hospital. Peripheral blood mononuclear cell isolated from normal healthy donor by Ficoll-Hypaque centrifugation were enriched for CD14+ monocytes using the autoMACS magnetic cell sorting system (Miltenyi Biotec, Bergisch Gladbach, Germany) as described previously [10]. Briefly, peripheral blood mononuclear cells were incubated with saturating concentrations of CD14 microbeads on ice for 15 min, washed, and suspended in PBS containing 2 mM EDTA and 0.5% bovine serum albumin. The cell suspension was then applied to the autoMACS separator using the positive selection program. The CD14-positive monocytes were eluted from the magnetic column and placed into 3-cm culture dishes (1 106 cells per dish). A purity of >95% were routinely obtained as confirmed by flow cytometry assay. Isolated CD14+ monocytes as well as human THP1 cell were cultured in RPMI 1640, supplemented with 50 U/mL penicillin and 50 lg/mL streptomycin, and 1% fetal bovine serum. Real-time reverse transcription-polymerase chain reaction. Total RNA was isolated from human monocytes by lysis in a guanidinium isothiocyanate buffer, followed by single step phenol–chloroform– isoamyl alcohol extraction. Isolated RNA was transcribed to complementary DNA using Super-Script III reverse transcriptase and oligo-dT primers and quantitative real-time PCR was performed with SYBR Green I chemistry (applied Biosystems, CA). Expression levels of tested genes were normalized according to the expression level of ribosomal protein L35a (RPL 35a). The reactions were performed in triplicates, and the experiments were repeated independently at least three times. The primer sequences were as follows: MMP-9 forward: 50 -GAACCAATCTCACCGACAGG-30 , MMP-9 reverse: 50 -GC CACCCGAGTGTAACCATA-30 , TIMP-1 forward: 50 -GGGCTTCACCAAG ACCTACA-30 , TIMP-1 reverse: 50 -TGCAGGGGATGGATAAACAG-30 , RPL35a forward: 50 -GCTGTGGTCCAAGGCCATTTT-30 and RPL35a reverse: 50 -CCGAGTTACTTTTCCCCAGATGAC-30 . Western blot analysis. Human monocytes were washed twice with phosphate-buffered saline and lysed in lysis buffer containing Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 2 mM DTT, 2 mM PMSF and 1% Triton X-100 by sonication. Samples were electrophoresed on 10% SDS–polyacrylamide gel, transferred to PVDF membranes and subsequently blocked in blocking solution (1% BSA, 1% goat serum in PBS). Membranes were then incubated with the indicated primary antibodies, followed by horseradish peroxidase-conjugated secondary antibodies. Blot were developed using the enhanced chemiluminescence. Gelatin zymography. Electrophoresis was performed with conditioned medium collected from cell cultures on a 10% polyacrylamide/SDS gel containing 1 mg/ml gelatin. SDS was removed by washing in 2.5% Triton X-100 for 1 h at room temperature before the enzyme reaction. The gel was incubated overnight at 37 °C in enzyme buffer containing 50 mM Tris, pH 7.5, 200 mM NaCl, 5 mM CaCl2 and 0.02% Brij-35. Areas of gelatin degradation, identified as MMP activity, appeared as distinct white bands after staining the gels with 0.5% Brilliant Blue G-250. Measurement of intracellular calcium concentration. Intracellular calcium concentrations ([Ca2+]i) were measured by Grynkiewicz’s method using fura-2/AM [11]. Briefly, monocytes were incubated with 3 lM fura-2/AM at 37 °C for 30 min in serum free RPMI 1640 medium. The assay was done with 1 106 monocytes/ml in Locke’s solution (154 mM NaCl, 5.6 mM KCl, 1.2 mM MgCl2, 5 mM HEPES, pH 7.3, 10 mM glucose, and 2 mM CaCl2). The
fluorescence changes at excitation wavelengths of 340 and 380 nm and a common emission wavelength of 500 nm were detected. Cytosolic free calcium was calculated from the fluorescence ratio at the two excitation wavelengths. The fluorescent images were acquired on an inverted Zeiss Axiovert 200 M microscope (Carl Zeiss Light Microscopy, Germany) equipped with automatic switching dual wavelength filter wheel and CCD camera (Cool SNAP HQ Microscope camera). Image processing was performed with SLIDEBOOK (Intelligent Imaging Innovation, Inc.). Electromobility shift assay. Nuclei were isolated from THP-1 cells according to the method described by Dignam [12]. The electromagnetic mobility shift assay was conducted using the DIG Gel Shift kit according to the manufacturer’s instructions. Oligonucleotides containing the NFjB binding site 50 AGTTGAGGGGACTTTCCCAGGC were end-labeled with DIG-11-ddUTP using terminal transferase. Assays were performed by incubating 5 lg of nuclear protein with DIG-labeled DNA probe, then loading them onto a 6% polyacrylamide gel and electrophoresing at 80 V for 1.5 h. For competition analysis, cold probe in 100-fold excess was added prior to the DIG-labeled probe. Following electrophoresis, the protein–DNA complex was transferred to a nylon membrane using electroblotting. The protein– DNA complexes were visualized by incubating the membrane with antidigoxigenin-AP conjugate and a chemiluminescent substrate solution (CSPD) followed by autoradiography. Immunocytochemistry for NFjB. Human monocytes cultured on cover slips with or without thrombin treatment were fixed in 4% formaldehyde (pH 7.5) followed by methanol permeabilization. The coverslips were first immersed in blocking solution containing 1% BSA and 1% goat serum in PBS and then incubated with monoclonal anti-NFjB p65 antibody primary antibody followed by secondary antibody. DAKO labeled streptavidin–biotin system was used to detect the signal and color development was performed by incubation with DAB substrate-chromogen. After counterstaining the cell nuclei with hematoxylin, coverslips were mounted. Statistical analysis. Optical densities of MMP-9 and TIMP-1 signals on X-ray films were measured by computer-assisted densitometry for quantification of changes in protein expression. Data are expressed as mean ± SEMs. For repeated measures, differences between groups were determined using Student’s unpaired t test. Differences were considered significant for p < 0.05.
Results Thrombin induces MMP-9 secretion of human monocytes in a time- and dose-dependent manner Human monocytes were treated with thrombin 8 U/mL and MMP-9 secretion in the media was analyzed using gelatin zymography. As demonstrated in Fig. 1A, the MMP-9 secretion was detected in the conditioned medium as early as 6 h after thrombin stimulation and persisted up to 30 h. The MMP-9 detected in the conditioned media was of proform. To investigate the dose effect of thrombin on MMP-9 secretion, cells were treated with various concentrations of thrombin for 24 h. Weak MMP-9 activity was detected in the conditioned media by zymography at the dose of as low as 0.1 U/mL. The activity increased dose-dependently with the thrombin dose up to 8 U/mL (Fig. 1B). Effect of thrombin on MMP-9 and TIMP-1 expressions in human monocytes at the transcriptional and translational levels The effect of thrombin stimulation on expression of MMP-9 mRNA in monocytes was determined by real-time RT-PCR. The expression of TIMP-1, the major endogenous inhibitor of MMP-9,
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
243
Fig. 1. Effect of thrombin on MMP-9 expression in human monocytes. (A) Human monocytes were stimulated with thrombin at the dose of 8 U/mL of thrombin for 0, 6, 12, 18, 24 and 30 h. The secreted MMP-9 in conditioned medium was measured by gelatin zymography. The conditioned media of cultured THP-1 cells stimulated with PMA 125 ng/mL was used as positive control (Lane 8). (B) Human monocytes were treated with various doses of thrombin (0, 0.01, 0.1, 1, 4 and 8 U/mL) for 24 h. The secreted MMP-9 in the conditioned medium was measured by gelatin zymography. (C) Total RNA was isolated from monocytes with or without thrombin (8 U/mL) pretreatment for 24 h. Transcripts for MMP-9 and TIMP-1 were detected by real-time PCR. Ribosomal protein (RPL35A) was used as the internal control. Average transcriptome abundance based on amplication efficiency normalized to the expression of the RPL35A. The bars represent the mean ± SEM of four experiments (*P < 0.05 thrombin treated vs untreated control). (D) The protein levels of MMP-9 and TIMP-1 in conditioned medium were measured by Western blot analysis. The figures are representative of four independent experiments.
was also investigated. When stimulated with thrombin at 8 U/mL for 24 h, MMP-9 mRNA expression increased by 11-folds (p = 0.03). In contrast, TIMP-1 mRNA expression remained unchanged in response to thrombin stimulation (p = 0.88) (Fig. 1C). MMP-9 protein expression was then determined in conditioned medium by Western blot analysis. In consistence with the finding of real-time PT-PCR, thrombin stimulation induced increased MMP-9 protein expression by 8-folds. (p = 0.01). The expression of TIMP-1 protein remained unchanged (p = 0.30) (Fig. 1D). Thrombin induces MMP-9 up-regulation in human monocytes through PAR-1 and PAR-3 Human monocytes have been demonstrated to express two known thrombin receptors, mainly PAR-1 and significantly less PAR-3 [13]. To investigate the roles of PAR-1 and PAR-3, we analyzed MMP-9 secretion in the presence of antibodies against human PAR-1 and PAR-3. Monocytes were preincubated with anti-human PAR-1 antibody (ATAP-2, 10 lg/mL) or anti-PAR-3 antibody (H103, 10 lg/mL) alone, or with both anti-PAR-1 and anti-PAR-3 antibodies (10 lg/mL each) simultaneously for 1 h
before stimulation with thrombin (8 U/mL) for 24 h. Preincubation with nonspecific mouse or rabbit IgG (10 lg/mL, respectively) served as negative controls. Preincubation with either anti-PAR-1 or anti-PAR-3 antibody partially inhibited the thrombin-induced MMP-9 secretion in the conditioned medium. Preincubation with both anti-PAR-1 and anti-PAR-3 antibodies together synergistically inhibited the MMP-9 secretion. When stimulated with PAR-1 agonist peptide (TFLLR-NH2, 10 lM) for 24 h, the MMP-9 activity of monocytes was also induced, which further confirmed that this thrombin receptor was involved in MMP-9 up-regulation (Fig. 2A). Together, these data suggested that the up-regulation of MMP-9 expression in human monocytes by thrombin was mediated by both PAR-1 and PAR-3. Thrombin-triggered increased intracellular calcium was required for the MMP-9 up-regulation in human monocytes Then we examined the effect of thrombin-induced intracellular calcium mobilization on the regulation of MMP-9 expression. When Fura-2-loaded monocytes were stimulated with 8 U/mL, a rapid increase in intracellular free calcium was observed. Preincubation
244
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
Fig. 3. Thrombin induces MMP-9 up-regulation in human monocytes through activation of ERK1/2 and p38. (A) Monocytes were stimulated with thrombin (8 U/ mL) for different times. Whole cell lysates were analyzed by Western blot using anti-ERK1/2, anti-phospho-ERK1/2, anti-p38 and anti-phospho-p38 antibodies. These figures are representative of three independent experiments. (B) Monocytes with or without preincubation with PD98059 (10 lM) or SB203580 (10 lM) for 1 h were stimulated with thrombin (8 U/mL) for 24 h. The secreted MMP-9 in the conditioned medium was measured by gelatin zymography. The figure is representative of four independent experiments. Fig. 2. Thrombin induces MMP-9 up-regulation in human monocytes through PAR1 and PAR-3, and calcium mobilization. (A) Human monocytes were preincubated with anti-human PAR-1 (ATAP-2, 10 lg/mL) or anti-human PAR-3 antibody (H103, 10 lg/mL) alone, or with both anti-PAR-1 and anti-PAR-3 (10 lg/mL each) antibodies simultaneously for 1 h before stimulation with thrombin (8 U/mL) for 24 h. Preincubation with nonspecific mouse or rabbit IgG (10 lg/mL, respectively) served as negative controls. The monocytes were also stimulated with the PAR-1 agonist peptide (TFLLR-NH2, 10 lM) alone for 24 h. The secreted MMP-9 in conditioned medium was determined by gelatin zymography. The figure is representative of four independent experiments. (B) Monocytes loaded with Fura2/AM were incubated with thrombin (8 U/mL) in the presence or absence of BAPTA (20 lM). Cytosolic free calcium was calculated from the fluorescence ratio (340:380 nm). The figure is representative of four independent experiments. (C) Monocytes were stimulated with thrombin (8 U/mL) for 24 h with or without pretreatment with BAPTA (20 lM). The secreted MMP-9 in conditioned medium was determined by gelatin zymography. The figure is representative of four independent experiments.
of monocytes with BAPTA (20 lM), a calcium chelating agent, completely abolished the thrombin-induced increase in calcium (Fig. 2B). Zymographic analysis showed that thrombin-induced MMP-9 secretion was also completely abolished by preincubation of monocytes with BAPTA (Fig. 2C), suggesting that calcium mobilization played an essential role in thrombin-induced MMP-9 expression. Thrombin induced MMP-9 up-regulation in human monocytes through activation of extracellular signaling-regulated protein kinase 1/2 and p38 We examined whether mitogen-activated protein kinases (MAPKs) were involved in thrombin-induced up-regulation of MMP-9. When monocytes were stimulated with thrombin at the concentration of 8 U/mL, phosphorylation of ERK1/2 and p38 increased, with maximal activity at 45 min after stimulation (Fig. 3A). Pretreatment of monocytes with PD98059 (10 lM), a selective MEK inhibitor, and SB203580 (10 lM), a p38 inhibitor,
for 1 h before thrombin stimulation inhibited the up-regulation of MMP-9 (Fig. 3B). These results indicated that thrombin induced MMP-9 up-regulation in human monocytes through both ERK1/2 and p38 pathways. NFjB activation is necessary for thrombin-induced MMP-9 upregulation in human monocytes To test whether thrombin induce MMP-9 up-regulation in human monocytes through NFjB pathway, we tested the effect of curcumin, an inhibitor of NFjB, on MMP-9 expression in human monocytes. Monocytes were pretreated with curcumin (25 lM) 1 h before thrombin stimulation. Zymography analysis showed that thrombin-induced MMP-9 secretion was completely inhibited by preincubation with curcumin (Fig. 4A). In Fig. 4B, immunocytochemical staining demonstrated the thrombin-induced nuclear translocation of NFjB in human monocytes. The staining of NFjB p65 was found predominantly in the cytosol at baseline and translocated progressively into the nuclei from 30 to 90 min after thrombin stimulation. At 90 min, the anti-NFjB p65 signal was found exclusively in the nuclei (Fig. 4C). Using human monocytic THP-1 cells, we further examined the effect of thrombin on the DNA binding activity of NFjB. Nuclear extracts prepared from cells stimulated with thrombin (8 U/mL) for 0, 30, 60 and 90 min were processed for electromobility shift assay with labeled DNA probe containing NFjB binding sequence. Exposure to phorbol myristate acetate (PMA) (125 ng/mL) served as a positive control. The NFjB DNA-biding activity was low at the baseline. The binding activity increased in response to thrombin stimulation with a maximal activity at 90 min after stimulation. Specificity of this thrombin-induced DNA–protein complex formation was confirmed by the competitive inhibition in the presence of a 100-fold excess of unlabeled DNA probe (Fig. 4C). These data indicated that thrombin induced MMP-9 up-regulation in human monocytes through NFjB pathway.
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
245
Thrombin has been shown in previous studies to up-regulate expression of MMP-9 in several cell types including oral squamous cell carcinoma [14], human dermal fibroblast [15] and mesangial cells [16], microvascular endothelial cells from human brain [17] and rabbit aortic smooth muscle cells [18]. In monocytes, thrombin-induced MMP-9 up-regulation may have potentially important impact on pathogenesis of acute coronary syndrome. Monocytes in circulation are not exposed to the active form of thrombin in normal physiological condition. However, the monocytes, trapped inside or nearby the thrombus in the thrombosed coronary arteries of patients with acute coronary syndrome, may be exposed to active thrombin generated from the thrombi and secrete MMP-9 as demonstrated in vitro in this study. Increased MMP-9 expression has been demonstrated to be involved in atheroma disruption and consequent thrombosis, which is the pivotal pathological mechanism of acute coronary syndrome [7]. Thrombin-induced MMP-9 up-regulation in these vulnerable atheroma may cause further instability of the atheroma and could beget further thrombus formation. One recent study done by Bea et al. provided in vivo evidences to support this hypothesis [19]. In apolipoprotein E-deficient mice, they demonstrated that thrombin inhibition by oral feeding of melagtran, a direct thrombin inhibitor, reduced MMP-9 protein and promoted plaque stability in advanced atheroma of aorta. In conclusion, this study demonstrated the effect of thrombin in inducing expression of MMP-9 in monocytes. These findings suggest that thrombin could play other important roles beside procoagulation in acute coronary syndrome. Antithrombin therapy may potentially provide benefit other than anticoagulation in patients with acute coronary syndrome. Acknowledgment Fig. 4. The up-regulation of MMP-9 by thrombin requires the activation of NFjB. (A) Human monocytes were preincubated with or without curcumin (25 lM) at 37 °C for 1 h and then stimulated with thrombin (8 U/mL) for 24 h. The secreted MMP-9 in the conditioned medium was determined by gelatin zymography. The figure is representative of four independent experiments. (B) Monocytes cultured on cover slips were collected at 0, 30, 60 and 90 min after stimulation with thrombin (8 U/mL) and immuno-stained with anti-NFjB p65 antibody. Nuclei were counterstained with hematoxylin. The figure is representative of three independent experiments. (C) Human monocytic THP-1 cells were stimulated with thrombin (8 U/mL) for 0, 30, 60 and 90 min. Nuclear proteins were extracted and processed for electrophoretic mobility shift assay. The NFjB/DNA complex was detected using a DIG-11-ddUTP-end labeled NFjB oligonucleotide probe. The specificity of this NFjB/DNA complex was confirmed by the competition experiment using 100-fold excess of unlabeled NFjB DNA probe. The figure is representative of three independent experiments.
Discussion This study demonstrated that thrombin up-regulates MMP-9 expression in human monocytes. The expression of TIMP-1 is not affected instead. We showed that both thrombin receptors of human monocytes, the PAR-1 and PAR-3, are involved in the thrombin-induced MMP-9 expression in human monocytes. This result is compatible with the findings of Colognato et al. [13]. They demonstrated that both PAR-1 and PAR-3 are functionally active in human monocytes and could elicit a cytosolic [Ca2+] increase in response to stimulation by thrombin. They further showed that PAR-1 activation is only partially responsible for the thrombin-induced cytosolic [Ca2+] increase, suggesting that PAR-3 is also partially responsible for Ca2+mobilization. Because agonist specific for PAR-3 is not yet available, it is currently not possible to test directly the functional activity of PAR-3 in human monocytes. We also demonstrated that Ca2+ mobilization, activation of ERK1/ 2 and p38 pathways and the DNA binding activity of NFjB are essential for the up-regulation of MMP-9 in monocytes.
The work was supported by Chang Gung Memorial Hospital Grant (CMRP-G3405). References [1] Z.S. Galis, G.K. Sukhova, M.W. Lark, P. Libby, Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques, J. Clin. Invest. 94 (1994) 2493–2503. [2] R.T. Lee, F.J. Schoen, H.M. Loree, M.W. Lark, P. Libby, Circumferential stress and matrix metalloproteinase 1 in human coronary atherosclerosis: implication for plaque rupture, Arterioscler. Thromb. Vasc. Biol. 16 (1996) 1070–1073. [3] P.K. Shah, E. Falk, J.J. Badimon, A. Fernandez-Ortiz, A. Mailhac, G. Villareal-Levy, J.T. Fallon, J. Regnstrom, V. Fuster, Human monocyte-derived macrophages induce collagen breakdown in fibrous caps of atherosclerotic plaques: potential role of matrix-degrading metalloproteinases and implications for plaque rupture, Circulation 92 (1995) 1565–1569. [4] G.K. Sukhova, U. Schonbeck, E. Rabkin, F.J. Schoen, A.R. Poole, R.C. Billinghurst, P. Libby, Evidence for increased collagenolysis by interstitial collagenases-1 and -3 in vulnerable human atheromatous plaques, Circulation 99 (1999) 2503–2509. [5] Z.S. Galis, G.K. Sukhova, R. Kranzhöfer, S. Clark, P. Libby, Macrophage foam cells from experimental atheroma constitutively produce matrix-degrading proteinases, Proc. Natl. Acad. Sci. USA 92 (1995) 402–406. [6] P.J. Gough, I.G. Gomez, P.T. Wille, E.W. Raines, Macrophage expression of active MMP-9 induces acute plaque disruption in apoE-deficient mice, J. Clin. Invest. 116 (2006) 59–69. [7] Z.S. Galis, J.J. Khatri, Matrix metalloproteinases in vascular remodeling and atherogenesis: the good, the bad, and the ugly, Circ. Res. 90 (2002) 251–262. [8] V. Fontaine, M.P. Jacob, X. Houard, P. Rossignol, D. Plissonnier, E. Angles-Cano, J.B. Michel, Involvement of the mural thrombus as a site of protease release and activation in human aortic aneurysms, Am. J. Pathol. 161 (2002) 1701–1710. [9] C.J. Chang, Y.S. Ko, P.J. Ko, L.A. Hsu, C.F. Chen, C.W. Yang, T.S. Hsu, J.H. Pang, Thrombosed arteriovenous fistula for hemodialysis access is characterized by a marked inflammatory activity, Kidney Int. 68 (2005) 1312–1319. [10] S. Miltenyi, W. Muller, W. Weichel, A. Radbruch, High gradient magnetic cell separation with MACS, Cytometry 11 (1990) 231–238. [11] G. Grynkiewicz, M. Poenie, R.Y. Tsien, A new generation of Ca2+ indicators with greatly improved fluorescence properties, J. Biol. Chem. 260 (1985) 3440– 3450. [12] J.D. Dignam, R.M. Lebovitz, R.G. Roeder, Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei, Nucleic Acids Res. 11 (1983) 1475–1489.
246
C.-J. Chang et al. / Biochemical and Biophysical Research Communications 385 (2009) 241–246
[13] R. Colognato, J.R. Slupsky, M. Jendrach, L. Burysek, T. Syrovets, T. Simmet, Differential expression and regulation of protease-activated receptors in human peripheral monocytes and monocyte-derived antigen-presenting cells, Blood 102 (2003) 2645–2652. [14] Y. Liu, M.Z. Gilcrease, Y. Henderson, X.H. Yuan, G.L. Clayman, Z. Chen, Expression of protease-activated receptor 1 in oral squamous cell carcinoma, Cancer Lett. 169 (2001) 173–180. [15] L. Wang, J. Luo, S. He, Induction of MMP-9 release from human dermal fibroblasts by thrombin: involvement of JAK/STAT3 signaling pathway in MMP-9 release, BMC Cell Biol. 8 (2007) 14. [16] W.H. Liu, X.M. Chen, B. Fu, Thrombin stimulates MMP-9 mRNA expression through AP-1 pathway in human mesangial cells, Acta Pharmacol. Sin. 21 (2000) 641–645.
[17] K. Kolev, J. Skopal, L. Simon, E. Csonka, R. Machovich, Z. Nagy, Matrix metalloproteinase-9 expression in post-hypoxic human brain capillary endothelial cells: H2O2 as a trigger and NF-kappaB as a signal transducer, Thromb. Haemost. 90 (2003) 528–537. [18] R.P. Fabunmi, A.H. Baker, E.J. Murray, R.F. Booth, A.C. Newby, Divergent regulation by growth factors and cytokines of 95 and 72 kDa gelatinases and tissue inhibitors or metalloproteinases-1, -2, and -3 in rabbit aortic smooth muscle cells, Biochem. J. 315 (Pt 1) (1996) 335–342. [19] F. Bea, J. Kreuzer, M. Preusch, S. Schaab, B. Isermann, M.E. Rosenfeld, H. Katus, E. Blessing, Melagatran reduces advanced atherosclerotic lesion size and may promote plaque stability in apolipoprotein E-deficient mice, Arterioscler. Thromb. Vasc. Biol. 26 (2006) 2787–2792.