- Email: [email protected]
Thymic myoid cells express high levels of muscle genes
Journal of Neuroimmunology 148 (2004) 97 – 105 www.elsevier.com/locate/jneuroim
Thymic myoid cells express high levels of muscle genes
$
Laurence Mesnard-Rouiller, Jacky Bismuth, Abdel Wakkach 1, Sandrine Poe¨a-Guyon, Sonia Berrih-Aknin * Laboratoire de Physiologie Thymique, CNRS UMR-8078, IPSC, Hoˆpital Marie Lannelongue, 133 Avenue de la Re´sistance, 92350 Le Plessis Robinson, France Received 30 June 2003; received in revised form 11 November 2003; accepted 12 November 2003
Abstract To explore the possible contribution of thymic myoid cells in tolerance induction mechanisms, we quantified by real-time RT-PCR, the expression of 12 muscle genes (the five subunits of acetylcholine receptor, Musk, rapsyn, utrophin, ErbB2, ErbB3, troponin T, and MCK) in a human thymic myoid cell line (MITC), compared to thymic epithelial cells (TEC) and thymocytes. Although expression of all the genes analyzed was detected in TEC and thymocytes, the level of expression in these cells was much lower than in MITC, except for q-AChR, utrophin and ErbB3 genes. Since myoid cells express high level of most muscle genes and are consistently found in the thymic medulla, they may contribute to the mechanisms involved in the induction and maintenance of immune tolerance. D 2004 Elsevier B.V. All rights reserved. Keywords: Thymus; Myoid cells; Muscle genes; Acetylcholine receptor; Tolerance; Myasthenia gravis
1. Introduction The relationship between the thymic expression of an autoantigen and its tolerization is not totally enlightened but there are many lines of evidence suggesting that tolerance depends upon the level of expression of the antigen. It was shown that susceptibility to uveoretinitis is related to the thymic level of the ocular autoantigens (Egwuagu et al., 1997). In type 1 diabetes, thymic insulin levels play a pivotal role in insulin-specific T-cell selftolerance (Chentoufi and Polychronakos, 2002). In models of transgenic mice expressing various level of hgalactosidase in the thymus, we previously showed that high level of expression is associated with full tolerance
Abbreviations: AChR, acetylcholine receptor; MCK, muscle creatine kinase; MG, Myasthenia gravis; MITC, myoid immortalized thymic cells; MuSK, muscle specific kinase; nCP, normalized crossing point; TEC, thymic epithelial cells. $ CNRS UMR-8078 is affiliated to Institut Paris-Sud sur les Cytokines. * Corresponding author. Tel.: +33-1-45-37-15-51; fax: +33-1-46-3045-64. E-mail address: [email protected] (S. Berrih-Aknin). 1 Current address: INSERM U343, Hoˆpital de l’Archet, Route de St Antoine de Ginestie`re, 06202 Nice, France. 0165-5728/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.jneuroim.2003.11.013
and low level with restricted tolerance (Salmon et al., 1998). The analysis of many tissue antigens in the thymus demonstrated that medullary TEC are a unique type of cell expressing a diverse range of these antigens, that may facilitate tolerance induction to self-antigens (Derbinski et al., 2001), but did not consider the intriguing myoid cells that are consistently found in the thymic medulla. Myoid cells have been found in the thymus in humans and in various animal species (Rimmer, 1980). They express muscle proteins including desmin, AChR, myosin, C-protein and troponin (Dhoot et al., 1986). They form only a small population of cells in the thymus and are located in the medullary area (Schluep et al., 1987; Wakkach et al., 1999). The presence of such cells in the thymus raises a number of questions concerning their role in thymus physiology and function. They have been described as a source of cells for myoblast transfer (Pagel et al., 2000) and a study in mdx dystrophy mice indicated that these mice had fewer myoid cells than normal in the thymus (Wong et al., 1999), demonstrating that the development of thymic myoid cells is similar to that of peripheral muscle cells. Although the role of myoid cells in physiology is unknown, their involvement in the pathogenesis of myasthenia gravis (MG) has been suggested; they are believed to
98
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
trigger the autoimmune response to AChR (Roxanis et al., 2002; Spuler et al., 1994). Antibodies to AChR are detected in 80 –90% of MG patients (Lindstrom et al., 1976), and in patients without anti-AChR antibodies, autoantibodies against muscle-specific receptor tyrosine kinase, (MuSK) have been recently described (Hoch et al., 2001). Autoantibodies against other muscle proteins such as the ryanodin receptor, rapsyn or titin have also been described in MG (Agius et al., 1998; Romi et al., 2000). Therefore it is possible that thymic myoid cells are involved in the autosensitization towards muscle antigens leading to pathogenic antibodies in MG. AChR is the main autoantigen in MG and its gene expression has been analyzed in the thymus by several groups, including ours, but only at a qualitative level (Kaminski et al., 1993; Navaneetham et al., 2001; Wakkach et al., 1996). Many proteins originally described in muscle and related to AChR stabilization, regulation and function have never been explored in the thymus. Rapsyn is a 43-kDa cytoskeletal protein originally isolated by copurification with AChR; it is involved in AChR clustering in muscle cells (Gautam et al., 1995). Utrophin, a dystrophin-related cytoskeletal protein, may be involved in the maturation and maintenance of neuromuscular junctions (Grady et al., 1997). ErbB2 and ErbB3 are tyrosine kinases involved in AChR induction (Altiok et al., 1995). The troponin protein complex mediates the Ca2 + effect in myofibrillar structures, leading to contraction (Berchtold et
al., 2000; Perry, 1998). MuSK is also of particular interest because it is the target of autoantibodies in some seronegative MG patients (Hoch et al., 2001). We therefore decided to study the expression of genes encoding 12 muscle proteins in the various thymic cell types. We used the myoid cell line previously established in our laboratory (Wakkach et al., 1999) and quantified their levels of mRNA and compared them with those in thymocytes, and medullary thymic epithelial cells. We then confirmed that mRNA was translated into protein by assessing the expression of some of these proteins on thymic sections by double immunofluorescence labeling.
2. Materials and methods 2.1. Tissue samples Discarded thymic fragments were obtained from control subjects undergoing corrective cardiovascular surgery at Marie Lannelongue Hospital. Human muscle biopsies were harvested from patients during thoracic surgery, after their informed consent. 2.2. Immunofluorescence Thymic fragments were flash-frozen in liquid nitrogen after surgery and kept at 80 jC until use. Thymus
Table 1 Characteristics of the primers used in this study Gene
Strand
Sequence 5V ! 3V
Hybridization temperature (jC)
a-AChR
+ + + + + + + + + + + + +
ATAGGTCACGGAGTGCTTCCA GCCAGACCTGAGCAACTTCAT TGCGGCGGATGATGAGGTAG GTGTCAGGCTCAGCGTTGGT GGCGGATGATGAGGAAGAAGGTGA CAGAGAACGGGGAGTGGGAGATAG TGAAGAGCGAGAGCATG GTCCCGGCTACAGAAT GTGCTCAACGTGTCCCAGCGGACG AGCAGCTCCAGGAGAACGT GGTCTCAAACATGATCTGGG GGGTCAGAAGGATTCCTATG AAACACTCCCAGGCTTCCCAGGTGC GACTGGATCCACCAGCTGGAGTCT AAGAGGAGGAGGAAGGCAGATTTG GGAAGAGAAGACCCACAGAGGACT TCATGGCGGAGTCGTACCTG TGCCTGCTCTGCTTCGCTGACATC GTGGCCTGCTGGGAACATTT TGTCGGTTCACCGCCAGAGT AACTTGGGGTGCTTGCTCAGGTG TGGTGTGGGTGAACGAGGAGGAT ATGCCCCTCTGATGACTCTGATGC GCTGACCTGCTGCCTCCTGATGAT TCCAGCAGTGAGCGGTAGAA ATCCCCCAAAGCCAACAAAG
65 65 63 63 65 65 64 64 65 65 58 58 62 62 63 63 62 62 60 60 61 61 58 58 63 63
h-AChR y-AChR g-AChR q-AChR h-Actin sKTnT MuSK Rapsyn Utrophin MCK ErbB2 ErbB3
Expected size (bp) 79 216 112 341 197 238 201 212 79 410 247 747 735
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
sections (5 Am) from newborns were prepared from samples fixed in acetone and stored frozen. These sections were incubated with antibodies for one h at room temperature. The following primary antibodies (Ab) were used: monoclonal anti-keratin antibodies (mixture of MNF116 and CK1) (Dako, Trappes, France) or polyclonal anti-keratin antibodies (Dako), polyclonal antidesmin Ab (ICN Biomedicals), monoclonal anti-utrophin monoclonal (Santa Cruz Biotechnology) and anti-ErbB2 Ab (Santa Cruz Biotechnology). Primary antibodies were detected by incubation with the following secondary antibodies: fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse or tetramethyl rhodamine (TRITC)conjugated goat anti-rabbit antibodies (Immunotech).
99
ratio. For reverse transcription, we incubated 1 Ag of total RNA for each sample for 1 h at 42 jC with 4 units of AMV reverse transcriptase (Eurobio, Les Ulis, France) and 50 pmol of 3V primer (Table 1) in a total volume of 50 Al.
2.3. Cell culture and isolation The myoid cell line (MITC) established in our laboratory was cultured as previously described (Wakkach et al., 1999). Thymic lymphocytes were extracted mechanically by mincing and gently scraping normal thymic tissues. The cells were then filtered through sterile gauze and washed twice in HBSS (Invitrogen, Cergy Pontoise, France). Thymic epithelial cells were obtained by culturing small fragments of thymic tissue as previously described (Wakkach et al., 1996). After 8 – 10 days of culture, the percentage of epithelial cells as determined by immunofluorescence with the anti –keratin Ab reaches 80 –90%. In our culture conditions, most epithelial cells have a medullary phenotype as assessed by a specific monoclonal antibody (Wakkach et al., 2001). Pellets containing 1– 10 106 cells were immediately frozen and stored at 80 jC until RNA extraction. The human rhabdomyosarcoma cell line TE671 (Luther et al., 1989) was used as controls, TE671 cells were cultured at 37 jC under a 95% air/5% CO2 atmosphere, in modified Dulbecco’s medium supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 Ag/ml streptomycin, 1mM sodium pyruvate and 10% fetal calf serum (Invitrogen). 2.4. Total RNA preparation and reverse transcription For RNA extraction, we treated 1 to 5 106 cells with Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Total RNA was purified by precipitation in 0.5 volume of 7.5 mol/l ammonium acetate and 2.5 volumes of 100% ethanol. The precipitated RNA was collected by centrifugation at 15 000 rpm for 30 min at 4 jC. The pellet was washed twice in 75% ethanol, dried under vacuum, dissolved in diethylpyrocarbonatetreated water and stored at 80 jC. Total RNA concentration was determined by measuring absorbance at 260 nm on a Gene Quant II spectrophotometer (Pharmacia Biotech, Uppsala, Sweden). Purity was checked by determining the 260 nm/280 nm absorbance
Fig. 1. Example of an analysis of real-time PCR experiment. (A) During real-time PCR, the fluorescence emitted by the amplified product is measured once per cycle and the curve shows three parts. During the first one, the product is not detectable; during the second one, the product increases exponentially and the third one is the plateau. The noise band line is set above the background (dotted line). (B) An example of analysis is shown. The crossing point is a cycle corresponding to the intersection point between the amplification curve and the noise band (‘‘Fit Point Method’’, LightCycler version 3.3). (C) Example of a standard curve of real-time RTPCR. The cycle number is plotted as a function of log concentration. The efficiency of the PCR can be calculated from the slope of the curve (slope = 1/log(efficiency)). A 100% efficiency corresponds to a slope of 3.32. The slope of 3.290 illustrated in the figure corresponds to 101% efficiency.
100
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
2.5. Real-time PCR PCR reactions were performed on a LightCycler apparatus (Roche Diagnostics), using primers designed with Oligo software (Med Probe Oslo, Norway). The primers were purchased from Eurobio and the sequences are indicated in Table 1. PCR reactions were performed using the Faststart DNA Master SYBR Green I kit (Roche Diagnostics). The LightCycler mastermix (13.5 Al) was placed in the LightCycler glass capillaries and 1.5 Al cDNA was added as PCR template. Capillaries were closed, centrifuged and placed in the LightCycler rotor. For hactin amplification, the cDNA was diluted 10-fold before the PCR. The following LightCycler experimental run protocol was used: denaturation program (95 jC for 10 min), amplification and quantification program and melting curve program (60 – 95 jC with a heating rate of 0.1jC/s and continuous fluorescence measurement) and finally cooling to 40 jC. Optimal experiment parameters (hybridization temperature, elongation time and MgCl2 concentrations) were determined for each primer pair; the hybridization temperature is indicated in Table 1. For each gene, the specificity of the PCR product was assessed by checking that there was a single peak in melting curve analysis and by checking the size of the fragments by electrophoresis in an agarose gel during the setting up of experiments. 2.6. Comparative analysis of gene expression In order to compare the abundance of the transcripts for the AChR subunits, we calculated the Cp values after normalization of the PCR efficiency, as explained below and using a method similar to the one recently described (Pfaffl, 2001). The Cp value is defined as the cycle at which fluorescence increased markedly above background levels. The noise band line (above the background) is illustrated in Fig. 1A. The ‘‘Fit Point Method’’ of LightCycler version 3.3 (Roche Diagnostics) was used to determine the Cp value (Fig. 1B). The efficiency of PCR was determined for each primer pair from the standard curve in which Cp is plotted as a function of log concentration. The slope of the line is 1/log efficiency (Rasmussen, 2001). An example is shown in Fig. 1C. When the efficiency is 100%, the value of the slope is 3.32. Only efficiencies higher than 85% (slopes up to 3.75) were considered acceptable. We compared the levels of expression of the various AChR subunits by normalizing Cp values (Cp100%) so as to obtain PCR efficiencies of
Fig. 2. Amplification by quantitative RT-PCR of AChR subunits: comparison of MITC with TE671 cells and thymic cells (TEC and thymocytes). The results are expressed as ratios of mRNA levels for the gene of interest with respect to values obtained with one of the TE671 cell preparations used as a reference. These mRNA levels were previously normalized for h-actin gene.
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
101
100% according to the following equation: Cp100%= (Cpexp log(effexp))/log(eff100%). The Cp100% is named nCp (normalized Cp value) in the manuscript.
3. Results 3.1. Comparison of AChR subunit mRNA levels in thymic cells Three thymic cell types were studied: myoid cells, thymocytes and thymic epithelial cells (TEC). As myoid cells are very rare and difficult to isolate from the thymus, we used the myoid cell line (MITC) previously established from a normal human thymus in our laboratory (Wakkach et al., 1999). The TE671 cell line was used as a positive control for the expression of muscle gene transcripts (Luther et al., 1989). For each cell type, three different cultures or cell isolates were analyzed. Specific reverse transcription was carried out simultaneously in all cell types and cDNAs were amplified in duplicate on a LightCycler apparatus, using specific primers (Table 1). For each sample, the level of h-actin mRNA expression was quantified and was similar in the various samples (108 F 28, 116 F 7, 85 F 12, 99 F 18, in the TE671 cells, myoid cells, epithelial cells and thymocytes, respectively). The mRNA expression of each gene was then normalized to its h-actin mRNA expression. Results are expressed as mean of a percentage of the amplification obtained with one TE671 culture (TE3) used as a reference. All five AChR subunits were similarly amplified in the myoid cell line and in TE671 cells (Fig. 2). In TEC and thymocytes, the a, g and y subunit mRNA levels were below 1% of the reference while it was in similar range for the q subunit (Fig. 2). Significant amounts of h-AChR mRNA were detected in TEC (5.6% of the reference), but not in thymocytes. Then to compare the abundance of transcripts for the different subunits, we analyzed the nCp values as described in Materials and methods. The relative abundance of the transcripts corresponding to the different AChR subunits is shown in Table 2. In TE671 cells and in MITC, the a-, h-, g- and yAChR subunits were much more expressed than the q Table 2 Classification of the relative abundances of mRNAs for the AChR subunits in the thymic cell populations nCp value
13 – 16
17 – 20
21 – 24
Transcript abundance
++ + +
+++
++
TE671 Muscle biopsies MITC TEC Thymocytes
a, h, y
g a, h, y g h
a, h, y
q a, y a, h, y
25 – 28 + q g q g, q g, q
Note that q subunit is similarly expressed in all cell populations, but with a relatively low expression of the transcript level.
Fig. 3. Amplification by quantitative RT-PCR of utrophin, rapsyn and skeletal troponin T: comparison of MITC with TE671 cells and thymic cells (TEC and thymocytes). The results are expressed as ratios of mRNA levels for the gene of interest with respect to values obtained with one of the TE671 cell preparations used as a reference. These mRNA levels were previously normalized for h-actin gene.
subunit. In TEC and thymocytes, the classification is different from the myoid cells (Table 2). These results were also compared to the expression in muscle biopsies. The classification is almost similar to that of TE671 cells but the expression for a, h and y is lower than in the immortalized cells, while it is higher for the q subunit (Table 2). 3.2. Levels of rapsyn, utrophin and troponin T mRNAs in thymic cells The same quantitative analysis was performed for genes encoding muscle proteins involved in the stabilization of the
102
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
AChR and the neuromuscular junction: rapsyn, a protein that binds to the AChR in the membrane of muscle cells and is involved in its aggregation (Fuhrer et al., 1999), troponin T (Perry, 1998) and utrophin, a dystrophin-related cytoskeletal protein (Mitsui et al., 2000). The rapsyn and troponin T mRNAs were produced in large amounts in MITC and in TE671 cells but were much less expressed in TEC and thymocytes (Fig. 3). Utrophin mRNA was detected at the same range, in the distinct cell populations (Fig. 3). Because of the relatively high expression of utrophin mRNA in the thymus, we analyzed the protein expression by immunofluorescence. As shown in Fig. 4, we found that utrophin is not only expressed in myoid cells (Fig. 4C and D), but also in thymocytes (Fig. 4E) and medullary epithelial cells (Fig. 4A and B) and also in vascular structures. 3.3. Expression of muscle signaling genes in thymic cells We also studied mRNA levels for the ErbB2 and ErbB3 receptor tyrosine kinases, MuSK and MCK in the various thymic cell populations. The levels of mRNAs encoding MCK and MuSK were similar in the myoid cell line and in TE671 cells and were much lower in TEC and thymocytes (Fig. 5). Conversely, the level of mRNAs encoding for
Fig. 4. Utrophin expression in the normal human thymus. In a medullary area, the epithelial network labeled with anti-keratin antibodies (A) is partially double-stained with anti-utrophin antibody (B). The arrows show some double-stained cells. Myoid cells double-stained with anti-desmin (C) and anti-utrophin (D) antibodies are also pointed by arrows. In cortical areas, the thymocytes are stained with the anti-utrophin antibodies (E), while the control obtained by omitting the first layer antibody is negative (F).
Fig. 5. Amplification by quantitative RT-PCR of MCK, MuSK, ErbB2 and ErbB3: comparison of MITC with TE671 cells and thymic cells (TEC and thymocytes). The results are expressed as ratios of mRNA levels for the gene of interest with respect to values obtained with one of the TE671 cell preparations used as a reference. These mRNA levels were previously normalized for h-actin gene.
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
103
(2) All the muscle genes explored (a-, h-, g-, y-, q-AChR genes, Musk, MCK, ErbB2, ErbB3, utrophin, troponin T and rapsyn) could be amplified in all samples, but there are striking quantitative differences between myoid cells that express most genes at a high level and TEC or thymocytes. (3) The relatively high level of utrophin and ErbB2 in TEC and at lesser extent in thymocytes suggests an intrinsic role of these proteins in the physiology of these cells.
4.1. Contribution of the various thymic cells in tolerance mechanisms
Fig. 6. ErbB2 expression in the normal human thymus. Myoid cells are double-stained with anti-desmin antibodies (A) and ErbB2 (B) antibodies. The arrows show some double-stained myoid cells. The epithelial network labeled with anti-keratin antibodies (C) is also double-stained with antiErbB2 antibody (D). Most ErbB2+ cells are located in the medullary areas (D). At a higher magnification, the epithelial network is clearly double stained with anti-keratin (E) and anti-ErbB2 (F) antibodies.
Our results clearly show that all AChR subunits and AChR-related genes are weakly expressed in a general manner in the major thymic compartments (TEC and thymocytes) but that the level of expression of these genes is much higher and similar to that in muscle cells in the myoid cell population. The low level (less than 1%) of many genes (a-, y- and g-AChR subunits, MCK and Musk) in TEC raises questions concerning self-tolerance towards these antigens. As previously reported tolerance towards a thymic antigen depends upon the level of expression of that antigen (Salmon et al., 1998) and level of expression of autoantigens correlates with resistance to autoimmune diseases (Chentoufi and Polychronakos, 2002; Egwuagu et al., 1997). 4.2. Role of myoid cells in tolerance and autoimmunity
ErbB2 was similar in TEC and MITC cells, while it was much lower in thymocytes. ErbB3 was moderately expressed in TEC and thymocytes (between 1% and 10% of the reference value). We then analyzed ErbB2 expression on thymic sections by immunofluorescence. Myoid cells identified by labeling with an anti-desmin antibody (Fig. 6A) were clearly double stained with anti-ErbB2 (Fig. 6B), but other cells were also labeled. Double staining with anti-keratin antibodies indicated that most ErbB2-positive cells were epithelial cells (Fig. 6C – F). Interestingly, the area markedly stained by the anti-ErbB2 antibody is the medulla (Fig. 6C and D). The double-stained cells are clearly distinguishable at a higher magnification (Fig. 6E and F).
4. Discussion The main results of our study are as follows: (1) The thymic myoid cell line displays similar characteristics compared to the rhabdomyosarcoma cell line in terms of the quantitative expression of all the genes explored, making this cell line a unique ‘‘thymicmuscle’’ tool.
It is generally accepted that myoid cells play a role in the breakdown of tolerance (or of ignorance) in MG, because of their high level of expression of AChR (Wakkach et al., 1999). Our data proving that myoid cells express high levels of AChR and AChR-related genes in non-pathological situations raise the possibility of their involvement in tolerance mechanisms. Tolerance induction could occur by direct mechanisms through scanning by T cells or indirect pathways after antigen spreading (Klein and Kyewski, 2000). The medulla location of myoid cells makes possible interactions between these cells and neighboring thymocytes that could lead to deletion of autoreactive cells if HLA – TCR interactions between myoid cells and thymocytes are strong enough. However, myoid cells express class I but not class II antigens (Schluep et al., 1987; Wakkach et al., 1999). Therefore it is possible that only autoreactive CD8 + T cells could be deleted. This hypothesis is consistent with data showing that cytotoxic T cells specific for muscle antigens are not involved in pathogenic mechanisms at the muscle endplates in MG patients (Nakano and Engel, 1993). The role of myoid cells in tolerance mechanism could also occur by antigen spreading pathway. The antigens produced by myoid cells could be available and presented by specialized antigen-presenting cells if these antigens are secreted or if the myoid cells undergo apoptosis. This process is
104
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
possible since medullary dendritic cells are in close proximity with myoid cells. The turnover of myoid cells was evidenced by morphological features of degenerating myoid cells (Bornemann and Kirchner, 1998) and could then contribute to the tolerization through antigen spreading mechanisms. One could wonder whether the number of myoid cells in the thymus could be a susceptibility factor to autoimmune diseases, and particularly to diseases affecting muscles, such as myasthenia gravis. Our data clearly show that some of the muscle antigens are not only present in TEC but also in thymocytes. Although the expression is generally low, one could wonder its signification. Since antigen presentation could turn out by an indirect pathway, through the secretion of the antigens or their accessibility after cell apoptosis, if the transcripts are efficiently translated in the thymocytes, then the antigens could be captured, after apoptosis of thymocytes, by neighboring specialized antigen-presenting cells. Although the expression of self-antigens by thymocytes has already been reported (Heath et al., 1998), this question is opened and deserves further investigation. To explain the possible involvement of myoid cells in both tolerance induction and autoimmunity, the two-signal theory could be put forward, as it was suggested in several physiological and pathological situations (Baxter and Hodgkin, 2002). According to this theory, we propose that muscle antigens in the thymus induce tolerization in a resting environment while they induce activation of autoreactive cells in an inflammatory context; Indeed, it is possible that a pathological inflammatory event occurring in the thymus from MG patients makes the muscle antigens accessible for the capture by dendritic cells located in the same thymic compartment (medulla). Therefore, the autoreactive T cells instead of being deleted are activated and become pathogenic. The initial pathological event is not known but myoid cells could be attacked by early anti-AChR autoantibodies, as it has been recently suggested (Roxanis et al., 2002). The location of myoid cells in and around germinal centers in MG patient’s thymus is consistent with this hypothesis. 4.3. Characterization of myoid cells We previously showed that myoid cells produce all the chains of AChR and that this receptor, is functional as demonstrated in patch-clamp experiments (Wakkach et al., 1999). In this study, we extended this analysis further by real-time PCR quantification of the levels of mRNA for seven other related genes. Altogether, the level of expression was very similar in myoid cells and in the TE671 cells used as a muscle cell control. We found that the abundance of mRNA for the various AChR subunits could be classified as follows: a = h>y>gHq. These results are similar to those we previously obtained with a radioactive quantitative PCR approach, showing that the a- and h-AChR subunits were much more abundant than the q subunit in muscle biopsy samples (Guyon et al., 1994, 1998). Similarly to our
previous report (Guyon et al., 1998), this study shows that the level of expression for AChR subunits is higher in the rhabdomyosarcoma cell line than in muscle biopsy samples, except for the q subunit. It is interesting to note that the q subunit, which was considered absent from the TE671 cells (Beeson et al., 1996), was detectable in these cells, although the expression was very low, indicating that the fetal form is largely predominant in these cells. The expression of all muscle genes in myoid cells provides evidence of the muscular nature of the MITC cell line and demonstrates the potential value of muscle gene expression for exploring the role of this tiny cell population of the thymic medulla. The role of these cells in the thymus remains unclear. A recent study by Pagel et al. (2000) indicated that these cells have the capacity to generate muscle cells, and may therefore be seen as a novel source of muscle stem cells. Another report showed that mdx dystrophy mice have fewer myoid cells than normal in their thymuses (Wong et al., 1999), indicating that the development of thymic myoid cells is parallel to that of peripheral muscle cells. In a previous study, we found that the myoid cell line partially protects thymocytes from apoptosis (Wakkach et al., 1999) and their possible role in induction of tolerance is discussed above. Further investigation is required to determine whether these functions are modified in mdx dystrophy mice and to explore in more detail the physiological role of myoid cells in the thymus. In conclusion, this work demonstrates that thymic myoid cells have many properties typical of muscle cells, as shown not only by quantitative comparison of the expression of AChR genes, but also by quantitative analysis of seven other related genes. Although expression of all the genes analyzed was detected in TEC and thymocytes, the level of expression in these cells was much lower than in MITC, except for q-AChR, utrophin and ErbB3 genes. Since myoid cells express high level of most muscle genes and are consistently found in the thymic medulla, their contribution to tolerance induction could be seriously evoked. It will be interesting to evaluate whether a high number of thymic myoid cells could be correlated with resistance to autoimmune diseases affecting muscles. Acknowledgements This work was supported by grants from the Association Francßaise contre les Myopathies (AFM), the National Institute of Health (NS39869) and the European Community (QLG1-CT-2001-01918). LMR received a postdoctoral grant from Association Francßaise contre les myopathies. References Agius, M.A., Zhu, S., Kirvan, C.A., Schafer, A.L., Lin, M.Y., Fairclough, R.H., Oger, J.J., Aziz, T., Aarli, J.A., 1998. Rapsyn antibodies in myasthenia gravis. Ann. N.Y. Acad. Sci. 841, 516 – 521.
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105 Altiok, N., Bessereau, J.L., Changeux, J.P., 1995. ErbB3 and ErbB2/neu mediate the effect of heregulin on acetylcholine receptor gene expression in muscle: differential expression at the endplate. EMBO J. 14, 4258 – 4266. Baxter, A.G., Hodgkin, P.D., 2002. Activation rules: the two-signal theories of immune activation. Nat. Rev., Immunol. 2, 439 – 446. Beeson, D., Jacobson, L., Newsom-Davis, J., Vincent, A., 1996. A transfected human muscle cell line expressing the adult subtype of the human muscle acetylcholine receptor for diagnostic assays in myasthenia gravis. Neurology 47, 1552 – 1555. Berchtold, M.W., Brinkmeier, H., Muntener, M., 2000. Calcium ion in skeletal muscle: its crucial role for muscle function, plasticity, and disease. Physiol. Rev. 80, 1215 – 1265. Bornemann, A., Kirchner, T., 1998. Thymic myoid cell turnover in myasthenia gravis patients and in normal controls. Virchows Arch. 432, 357 – 361. Chentoufi, A.A., Polychronakos, C., 2002. Insulin expression levels in the thymus modulate insulin-specific autoreactive T-cell tolerance: the mechanism by which the IDDM2 locus may predispose to diabetes. Diabetes 51, 1383 – 1390. Derbinski, J., Schulte, A., Kyewski, B., Klein, L., 2001. Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nat. Immunol. 2, 1032 – 1039. Dhoot, G.K., Dransfield, I., Grand, R.J., Perry, S.V., 1986. Distribution of isoforms of the myofibrillar proteins in myoid cells of thymus. J. Muscle Res. Cell Motil. 7, 351 – 360. Egwuagu, C.E., Charukamnoetkanok, P., Gery, I., 1997. Thymic expression of autoantigens correlates with resistance to autoimmune disease. J. Immunol. 159, 3109 – 3112. Fuhrer, C., Gautam, M., Sugiyama, J.E., Hall, Z.W., 1999. Roles of rapsyn and agrin in interaction of postsynaptic proteins with acetylcholine receptors. J. Neurosci. 19, 6405 – 6416. Gautam, M., Noakes, P.G., Mudd, J., Nichol, M., Chu, G.C., Sanes, J.R., Merlie, J.P., 1995. Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature 377, 232 – 236. Grady, R.M., Merlie, J.P., Sanes, J.R., 1997. Subtle neuromuscular defects in utrophin-deficient mice. J. Cell Biol. 136, 871 – 882. Guyon, T., Levasseur, P., Truffault, F., Cottin, C., Gaud, C., BerrihAknin, S., 1994. Regulation of acetylcholine receptor alpha subunit variants in human myasthenia gravis. Quantification of steady-state levels of messenger RNA in muscle biopsy using the polymerase chain reaction. J. Clin. Invest. 94, 16 – 24. Guyon, T., Wakkach, A., Poea, S., Mouly, V., Klingel-Schmitt, I., Levasseur, P., Beeson, D., Asher, O., Tzartos, S., Berrih-Aknin, S., 1998. Regulation of acetylcholine receptor gene expression in human myasthenia gravis muscles. Evidences for a compensatory mechanism triggered by receptor loss. J. Clin. Invest. 102, 249 – 263. Heath, V.L., Moore, N.C., Parnell, S.M., Mason, D.W., 1998. Intrathymic expression of genes involved in organ specific autoimmune disease. J. Autoimmun. 11, 309 – 318. Hoch, W., McConville, J., Helms, S., Newsom-Davis, J., Melms, A., Vincent, A., 2001. Auto-antibodies to the receptor tyrosine kinase MuSK in patients with myasthenia gravis without acetylcholine receptor antibodies. Nat. Med. 7, 365 – 368. Kaminski, H.J., Fenstermaker, R.A., Abdul Karim, F.W., Clayman, J., Ruff, R.L., 1993. Acetylcholine receptor subunit gene expression in thymic tissue. Muscle Nerve 16, 1332 – 1337. Klein, L., Kyewski, B., 2000. Self-antigen presentation by thymic stromal cells: a subtle division of labor. Curr. Opin. Immunol. 12, 179 – 186. Lindstrom, J.M., Seybold, M.E., Lennon, V.A., Whittingham, S., Duane, D.D., 1976. Antibody to acetylcholine receptor in myasthenia gravis. Prevalence, clinical correlates, and diagnostic value. Neurology 26, 1054 – 1059.
105
Luther, M.A., Schoepfer, R., Whiting, P., Casey, B., Blatt, Y., Montal, M.S., Montal, M., Linstrom, J., 1989. A muscle acetylcholine receptor is expressed in the human cerebellar medulloblastoma cell line TE671. J. Neurosci. 9, 1082 – 1096. Mitsui, T., Kawajiri, M., Kunishige, M., Endo, T., Akaike, M., Aki, K., Matsumoto, T., 2000. Functional association between nicotinic acetylcholine receptor and sarcomeric proteins via actin and desmin filaments. J. Cell. Biochem. 77, 584 – 595. Nakano, S., Engel, A.G., 1993. Myasthenia gravis: quantitative immunocytochemical analysis of inflammatory cells and detection of complement membrane attack complex at the end-plate in 30 patients. Neurology 43, 1167 – 1172. Navaneetham, D., Penn, A.S., Howard, J.F., Conti-Fine, B.M., 2001. Human thymuses express incomplete sets of muscle acetylcholine receptor subunit transcripts that seldom include the delta subunit. Muscle Nerve 24, 203 – 210. Pagel, C.N., Morgan, J.E., Gross, J.G., Partridge, T.A., 2000. Thymic myoid cells as a source of cells for myoblast transfer. Cell Transplant 9, 531 – 538. Perry, S.V., 1998. Troponin T: genetics, properties and function. J. Muscle Res. Cell Motil. 19, 575 – 602. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, E45. Rasmussen, R., 2001. Quantification on the light cycler. In: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real-time PCR, Methods and Applications. Springer, Heidelberg, pp. 21 – 34. Rimmer, J.J., 1980. Myoid cells and myasthenia gravis: a phylogenetic overview. Dev. Comp. Immunol. 4, 385 – 394. Romi, F., Skeie, G.O., Aarli, J.A., Gilhus, N.E., 2000. Muscle autoantibodies in subgroups of myasthenia gravis patients. J. Neurol. 247, 369 – 375. Roxanis, I., Micklem, K., McConville, J., Newsom-Davis, J., Willcox, N., 2002. Thymic myoid cells and germinal center formation in myasthenia gravis; possible roles in pathogenesis. J. Neuroimmunol. 125, 185 – 197. Salmon, A.M., Bruand, C., Cardona, A., Changeux, J.P., Berrih-Aknin, S., 1998. An acetylcholine receptor alpha subunit promoter confers intrathymic expression in transgenic mice. Implications for tolerance of a transgenic self-antigen and for autoreactivity in myasthenia gravis. J. Clin. Invest. 101, 2340 – 2350. Schluep, M., Willcox, N., Vincent, A., Dhoot, G.K., Newsom-Davis, J., 1987. Acetylcholine receptors in human thymic myoid cells in situ: an immunohistological study. Ann. Neurol. 22, 212 – 222. Spuler, S., Marx, A., Kirchner, T., Hohlfeld, R., Wekerle, H., 1994. Myogenesis in thymic transplants in the severe combined immunodeficient mouse model of myasthenia gravis. Differentiation of thymic myoid cells into striated muscle cells. Am. J. Pathol. 145, 766 – 770. Wakkach, A., Guyon, T., Bruand, C., Tzartos, S., Cohen-Kaminsky, S., Berrih-Aknin, S., 1996. Expression of acetylcholine receptor genes in human thymic epithelial cells: implications for myasthenia gravis. J. Immunol. 157, 3752 – 3760. Wakkach, A., Poea, S., Chastre, E., Gespach, C., Lecerf, F., De La Porte, S., Tzartos, S., Coulombe, A., Berrih-Aknin, S., 1999. Establishment of a human thymic myoid cell line. Phenotypic and functional characteristics. Am. J. Pathol. 155, 1229 – 1240. Wakkach, A., Chastre, E., Bruand, C., Cohen-Kaminsky, S., Emami, S., Gespach, C., Berrih-Aknin, S., 2001. Phenotypic and functional characterization of human thymic stromal cell lines. Cell. Mol. Biol. 47, 167 – 178 (Noisy-le-grand). Wong, A., Garrett, K.L., Anderson, J.E., 1999. Myoid cell density in the thymus is reduced during mdx dystrophy and after muscle crush. Biochem. Cell. Biol. 77, 33 – 40.
Thymic myoid cells express high levels of muscle genes
$
Laurence Mesnard-Rouiller, Jacky Bismuth, Abdel Wakkach 1, Sandrine Poe¨a-Guyon, Sonia Berrih-Aknin * Laboratoire de Physiologie Thymique, CNRS UMR-8078, IPSC, Hoˆpital Marie Lannelongue, 133 Avenue de la Re´sistance, 92350 Le Plessis Robinson, France Received 30 June 2003; received in revised form 11 November 2003; accepted 12 November 2003
Abstract To explore the possible contribution of thymic myoid cells in tolerance induction mechanisms, we quantified by real-time RT-PCR, the expression of 12 muscle genes (the five subunits of acetylcholine receptor, Musk, rapsyn, utrophin, ErbB2, ErbB3, troponin T, and MCK) in a human thymic myoid cell line (MITC), compared to thymic epithelial cells (TEC) and thymocytes. Although expression of all the genes analyzed was detected in TEC and thymocytes, the level of expression in these cells was much lower than in MITC, except for q-AChR, utrophin and ErbB3 genes. Since myoid cells express high level of most muscle genes and are consistently found in the thymic medulla, they may contribute to the mechanisms involved in the induction and maintenance of immune tolerance. D 2004 Elsevier B.V. All rights reserved. Keywords: Thymus; Myoid cells; Muscle genes; Acetylcholine receptor; Tolerance; Myasthenia gravis
1. Introduction The relationship between the thymic expression of an autoantigen and its tolerization is not totally enlightened but there are many lines of evidence suggesting that tolerance depends upon the level of expression of the antigen. It was shown that susceptibility to uveoretinitis is related to the thymic level of the ocular autoantigens (Egwuagu et al., 1997). In type 1 diabetes, thymic insulin levels play a pivotal role in insulin-specific T-cell selftolerance (Chentoufi and Polychronakos, 2002). In models of transgenic mice expressing various level of hgalactosidase in the thymus, we previously showed that high level of expression is associated with full tolerance
Abbreviations: AChR, acetylcholine receptor; MCK, muscle creatine kinase; MG, Myasthenia gravis; MITC, myoid immortalized thymic cells; MuSK, muscle specific kinase; nCP, normalized crossing point; TEC, thymic epithelial cells. $ CNRS UMR-8078 is affiliated to Institut Paris-Sud sur les Cytokines. * Corresponding author. Tel.: +33-1-45-37-15-51; fax: +33-1-46-3045-64. E-mail address: [email protected] (S. Berrih-Aknin). 1 Current address: INSERM U343, Hoˆpital de l’Archet, Route de St Antoine de Ginestie`re, 06202 Nice, France. 0165-5728/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.jneuroim.2003.11.013
and low level with restricted tolerance (Salmon et al., 1998). The analysis of many tissue antigens in the thymus demonstrated that medullary TEC are a unique type of cell expressing a diverse range of these antigens, that may facilitate tolerance induction to self-antigens (Derbinski et al., 2001), but did not consider the intriguing myoid cells that are consistently found in the thymic medulla. Myoid cells have been found in the thymus in humans and in various animal species (Rimmer, 1980). They express muscle proteins including desmin, AChR, myosin, C-protein and troponin (Dhoot et al., 1986). They form only a small population of cells in the thymus and are located in the medullary area (Schluep et al., 1987; Wakkach et al., 1999). The presence of such cells in the thymus raises a number of questions concerning their role in thymus physiology and function. They have been described as a source of cells for myoblast transfer (Pagel et al., 2000) and a study in mdx dystrophy mice indicated that these mice had fewer myoid cells than normal in the thymus (Wong et al., 1999), demonstrating that the development of thymic myoid cells is similar to that of peripheral muscle cells. Although the role of myoid cells in physiology is unknown, their involvement in the pathogenesis of myasthenia gravis (MG) has been suggested; they are believed to
98
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
trigger the autoimmune response to AChR (Roxanis et al., 2002; Spuler et al., 1994). Antibodies to AChR are detected in 80 –90% of MG patients (Lindstrom et al., 1976), and in patients without anti-AChR antibodies, autoantibodies against muscle-specific receptor tyrosine kinase, (MuSK) have been recently described (Hoch et al., 2001). Autoantibodies against other muscle proteins such as the ryanodin receptor, rapsyn or titin have also been described in MG (Agius et al., 1998; Romi et al., 2000). Therefore it is possible that thymic myoid cells are involved in the autosensitization towards muscle antigens leading to pathogenic antibodies in MG. AChR is the main autoantigen in MG and its gene expression has been analyzed in the thymus by several groups, including ours, but only at a qualitative level (Kaminski et al., 1993; Navaneetham et al., 2001; Wakkach et al., 1996). Many proteins originally described in muscle and related to AChR stabilization, regulation and function have never been explored in the thymus. Rapsyn is a 43-kDa cytoskeletal protein originally isolated by copurification with AChR; it is involved in AChR clustering in muscle cells (Gautam et al., 1995). Utrophin, a dystrophin-related cytoskeletal protein, may be involved in the maturation and maintenance of neuromuscular junctions (Grady et al., 1997). ErbB2 and ErbB3 are tyrosine kinases involved in AChR induction (Altiok et al., 1995). The troponin protein complex mediates the Ca2 + effect in myofibrillar structures, leading to contraction (Berchtold et
al., 2000; Perry, 1998). MuSK is also of particular interest because it is the target of autoantibodies in some seronegative MG patients (Hoch et al., 2001). We therefore decided to study the expression of genes encoding 12 muscle proteins in the various thymic cell types. We used the myoid cell line previously established in our laboratory (Wakkach et al., 1999) and quantified their levels of mRNA and compared them with those in thymocytes, and medullary thymic epithelial cells. We then confirmed that mRNA was translated into protein by assessing the expression of some of these proteins on thymic sections by double immunofluorescence labeling.
2. Materials and methods 2.1. Tissue samples Discarded thymic fragments were obtained from control subjects undergoing corrective cardiovascular surgery at Marie Lannelongue Hospital. Human muscle biopsies were harvested from patients during thoracic surgery, after their informed consent. 2.2. Immunofluorescence Thymic fragments were flash-frozen in liquid nitrogen after surgery and kept at 80 jC until use. Thymus
Table 1 Characteristics of the primers used in this study Gene
Strand
Sequence 5V ! 3V
Hybridization temperature (jC)
a-AChR
+ + + + + + + + + + + + +
ATAGGTCACGGAGTGCTTCCA GCCAGACCTGAGCAACTTCAT TGCGGCGGATGATGAGGTAG GTGTCAGGCTCAGCGTTGGT GGCGGATGATGAGGAAGAAGGTGA CAGAGAACGGGGAGTGGGAGATAG TGAAGAGCGAGAGCATG GTCCCGGCTACAGAAT GTGCTCAACGTGTCCCAGCGGACG AGCAGCTCCAGGAGAACGT GGTCTCAAACATGATCTGGG GGGTCAGAAGGATTCCTATG AAACACTCCCAGGCTTCCCAGGTGC GACTGGATCCACCAGCTGGAGTCT AAGAGGAGGAGGAAGGCAGATTTG GGAAGAGAAGACCCACAGAGGACT TCATGGCGGAGTCGTACCTG TGCCTGCTCTGCTTCGCTGACATC GTGGCCTGCTGGGAACATTT TGTCGGTTCACCGCCAGAGT AACTTGGGGTGCTTGCTCAGGTG TGGTGTGGGTGAACGAGGAGGAT ATGCCCCTCTGATGACTCTGATGC GCTGACCTGCTGCCTCCTGATGAT TCCAGCAGTGAGCGGTAGAA ATCCCCCAAAGCCAACAAAG
65 65 63 63 65 65 64 64 65 65 58 58 62 62 63 63 62 62 60 60 61 61 58 58 63 63
h-AChR y-AChR g-AChR q-AChR h-Actin sKTnT MuSK Rapsyn Utrophin MCK ErbB2 ErbB3
Expected size (bp) 79 216 112 341 197 238 201 212 79 410 247 747 735
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
sections (5 Am) from newborns were prepared from samples fixed in acetone and stored frozen. These sections were incubated with antibodies for one h at room temperature. The following primary antibodies (Ab) were used: monoclonal anti-keratin antibodies (mixture of MNF116 and CK1) (Dako, Trappes, France) or polyclonal anti-keratin antibodies (Dako), polyclonal antidesmin Ab (ICN Biomedicals), monoclonal anti-utrophin monoclonal (Santa Cruz Biotechnology) and anti-ErbB2 Ab (Santa Cruz Biotechnology). Primary antibodies were detected by incubation with the following secondary antibodies: fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse or tetramethyl rhodamine (TRITC)conjugated goat anti-rabbit antibodies (Immunotech).
99
ratio. For reverse transcription, we incubated 1 Ag of total RNA for each sample for 1 h at 42 jC with 4 units of AMV reverse transcriptase (Eurobio, Les Ulis, France) and 50 pmol of 3V primer (Table 1) in a total volume of 50 Al.
2.3. Cell culture and isolation The myoid cell line (MITC) established in our laboratory was cultured as previously described (Wakkach et al., 1999). Thymic lymphocytes were extracted mechanically by mincing and gently scraping normal thymic tissues. The cells were then filtered through sterile gauze and washed twice in HBSS (Invitrogen, Cergy Pontoise, France). Thymic epithelial cells were obtained by culturing small fragments of thymic tissue as previously described (Wakkach et al., 1996). After 8 – 10 days of culture, the percentage of epithelial cells as determined by immunofluorescence with the anti –keratin Ab reaches 80 –90%. In our culture conditions, most epithelial cells have a medullary phenotype as assessed by a specific monoclonal antibody (Wakkach et al., 2001). Pellets containing 1– 10 106 cells were immediately frozen and stored at 80 jC until RNA extraction. The human rhabdomyosarcoma cell line TE671 (Luther et al., 1989) was used as controls, TE671 cells were cultured at 37 jC under a 95% air/5% CO2 atmosphere, in modified Dulbecco’s medium supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 Ag/ml streptomycin, 1mM sodium pyruvate and 10% fetal calf serum (Invitrogen). 2.4. Total RNA preparation and reverse transcription For RNA extraction, we treated 1 to 5 106 cells with Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Total RNA was purified by precipitation in 0.5 volume of 7.5 mol/l ammonium acetate and 2.5 volumes of 100% ethanol. The precipitated RNA was collected by centrifugation at 15 000 rpm for 30 min at 4 jC. The pellet was washed twice in 75% ethanol, dried under vacuum, dissolved in diethylpyrocarbonatetreated water and stored at 80 jC. Total RNA concentration was determined by measuring absorbance at 260 nm on a Gene Quant II spectrophotometer (Pharmacia Biotech, Uppsala, Sweden). Purity was checked by determining the 260 nm/280 nm absorbance
Fig. 1. Example of an analysis of real-time PCR experiment. (A) During real-time PCR, the fluorescence emitted by the amplified product is measured once per cycle and the curve shows three parts. During the first one, the product is not detectable; during the second one, the product increases exponentially and the third one is the plateau. The noise band line is set above the background (dotted line). (B) An example of analysis is shown. The crossing point is a cycle corresponding to the intersection point between the amplification curve and the noise band (‘‘Fit Point Method’’, LightCycler version 3.3). (C) Example of a standard curve of real-time RTPCR. The cycle number is plotted as a function of log concentration. The efficiency of the PCR can be calculated from the slope of the curve (slope = 1/log(efficiency)). A 100% efficiency corresponds to a slope of 3.32. The slope of 3.290 illustrated in the figure corresponds to 101% efficiency.
100
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
2.5. Real-time PCR PCR reactions were performed on a LightCycler apparatus (Roche Diagnostics), using primers designed with Oligo software (Med Probe Oslo, Norway). The primers were purchased from Eurobio and the sequences are indicated in Table 1. PCR reactions were performed using the Faststart DNA Master SYBR Green I kit (Roche Diagnostics). The LightCycler mastermix (13.5 Al) was placed in the LightCycler glass capillaries and 1.5 Al cDNA was added as PCR template. Capillaries were closed, centrifuged and placed in the LightCycler rotor. For hactin amplification, the cDNA was diluted 10-fold before the PCR. The following LightCycler experimental run protocol was used: denaturation program (95 jC for 10 min), amplification and quantification program and melting curve program (60 – 95 jC with a heating rate of 0.1jC/s and continuous fluorescence measurement) and finally cooling to 40 jC. Optimal experiment parameters (hybridization temperature, elongation time and MgCl2 concentrations) were determined for each primer pair; the hybridization temperature is indicated in Table 1. For each gene, the specificity of the PCR product was assessed by checking that there was a single peak in melting curve analysis and by checking the size of the fragments by electrophoresis in an agarose gel during the setting up of experiments. 2.6. Comparative analysis of gene expression In order to compare the abundance of the transcripts for the AChR subunits, we calculated the Cp values after normalization of the PCR efficiency, as explained below and using a method similar to the one recently described (Pfaffl, 2001). The Cp value is defined as the cycle at which fluorescence increased markedly above background levels. The noise band line (above the background) is illustrated in Fig. 1A. The ‘‘Fit Point Method’’ of LightCycler version 3.3 (Roche Diagnostics) was used to determine the Cp value (Fig. 1B). The efficiency of PCR was determined for each primer pair from the standard curve in which Cp is plotted as a function of log concentration. The slope of the line is 1/log efficiency (Rasmussen, 2001). An example is shown in Fig. 1C. When the efficiency is 100%, the value of the slope is 3.32. Only efficiencies higher than 85% (slopes up to 3.75) were considered acceptable. We compared the levels of expression of the various AChR subunits by normalizing Cp values (Cp100%) so as to obtain PCR efficiencies of
Fig. 2. Amplification by quantitative RT-PCR of AChR subunits: comparison of MITC with TE671 cells and thymic cells (TEC and thymocytes). The results are expressed as ratios of mRNA levels for the gene of interest with respect to values obtained with one of the TE671 cell preparations used as a reference. These mRNA levels were previously normalized for h-actin gene.
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
101
100% according to the following equation: Cp100%= (Cpexp log(effexp))/log(eff100%). The Cp100% is named nCp (normalized Cp value) in the manuscript.
3. Results 3.1. Comparison of AChR subunit mRNA levels in thymic cells Three thymic cell types were studied: myoid cells, thymocytes and thymic epithelial cells (TEC). As myoid cells are very rare and difficult to isolate from the thymus, we used the myoid cell line (MITC) previously established from a normal human thymus in our laboratory (Wakkach et al., 1999). The TE671 cell line was used as a positive control for the expression of muscle gene transcripts (Luther et al., 1989). For each cell type, three different cultures or cell isolates were analyzed. Specific reverse transcription was carried out simultaneously in all cell types and cDNAs were amplified in duplicate on a LightCycler apparatus, using specific primers (Table 1). For each sample, the level of h-actin mRNA expression was quantified and was similar in the various samples (108 F 28, 116 F 7, 85 F 12, 99 F 18, in the TE671 cells, myoid cells, epithelial cells and thymocytes, respectively). The mRNA expression of each gene was then normalized to its h-actin mRNA expression. Results are expressed as mean of a percentage of the amplification obtained with one TE671 culture (TE3) used as a reference. All five AChR subunits were similarly amplified in the myoid cell line and in TE671 cells (Fig. 2). In TEC and thymocytes, the a, g and y subunit mRNA levels were below 1% of the reference while it was in similar range for the q subunit (Fig. 2). Significant amounts of h-AChR mRNA were detected in TEC (5.6% of the reference), but not in thymocytes. Then to compare the abundance of transcripts for the different subunits, we analyzed the nCp values as described in Materials and methods. The relative abundance of the transcripts corresponding to the different AChR subunits is shown in Table 2. In TE671 cells and in MITC, the a-, h-, g- and yAChR subunits were much more expressed than the q Table 2 Classification of the relative abundances of mRNAs for the AChR subunits in the thymic cell populations nCp value
13 – 16
17 – 20
21 – 24
Transcript abundance
++ + +
+++
++
TE671 Muscle biopsies MITC TEC Thymocytes
a, h, y
g a, h, y g h
a, h, y
q a, y a, h, y
25 – 28 + q g q g, q g, q
Note that q subunit is similarly expressed in all cell populations, but with a relatively low expression of the transcript level.
Fig. 3. Amplification by quantitative RT-PCR of utrophin, rapsyn and skeletal troponin T: comparison of MITC with TE671 cells and thymic cells (TEC and thymocytes). The results are expressed as ratios of mRNA levels for the gene of interest with respect to values obtained with one of the TE671 cell preparations used as a reference. These mRNA levels were previously normalized for h-actin gene.
subunit. In TEC and thymocytes, the classification is different from the myoid cells (Table 2). These results were also compared to the expression in muscle biopsies. The classification is almost similar to that of TE671 cells but the expression for a, h and y is lower than in the immortalized cells, while it is higher for the q subunit (Table 2). 3.2. Levels of rapsyn, utrophin and troponin T mRNAs in thymic cells The same quantitative analysis was performed for genes encoding muscle proteins involved in the stabilization of the
102
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
AChR and the neuromuscular junction: rapsyn, a protein that binds to the AChR in the membrane of muscle cells and is involved in its aggregation (Fuhrer et al., 1999), troponin T (Perry, 1998) and utrophin, a dystrophin-related cytoskeletal protein (Mitsui et al., 2000). The rapsyn and troponin T mRNAs were produced in large amounts in MITC and in TE671 cells but were much less expressed in TEC and thymocytes (Fig. 3). Utrophin mRNA was detected at the same range, in the distinct cell populations (Fig. 3). Because of the relatively high expression of utrophin mRNA in the thymus, we analyzed the protein expression by immunofluorescence. As shown in Fig. 4, we found that utrophin is not only expressed in myoid cells (Fig. 4C and D), but also in thymocytes (Fig. 4E) and medullary epithelial cells (Fig. 4A and B) and also in vascular structures. 3.3. Expression of muscle signaling genes in thymic cells We also studied mRNA levels for the ErbB2 and ErbB3 receptor tyrosine kinases, MuSK and MCK in the various thymic cell populations. The levels of mRNAs encoding MCK and MuSK were similar in the myoid cell line and in TE671 cells and were much lower in TEC and thymocytes (Fig. 5). Conversely, the level of mRNAs encoding for
Fig. 4. Utrophin expression in the normal human thymus. In a medullary area, the epithelial network labeled with anti-keratin antibodies (A) is partially double-stained with anti-utrophin antibody (B). The arrows show some double-stained cells. Myoid cells double-stained with anti-desmin (C) and anti-utrophin (D) antibodies are also pointed by arrows. In cortical areas, the thymocytes are stained with the anti-utrophin antibodies (E), while the control obtained by omitting the first layer antibody is negative (F).
Fig. 5. Amplification by quantitative RT-PCR of MCK, MuSK, ErbB2 and ErbB3: comparison of MITC with TE671 cells and thymic cells (TEC and thymocytes). The results are expressed as ratios of mRNA levels for the gene of interest with respect to values obtained with one of the TE671 cell preparations used as a reference. These mRNA levels were previously normalized for h-actin gene.
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
103
(2) All the muscle genes explored (a-, h-, g-, y-, q-AChR genes, Musk, MCK, ErbB2, ErbB3, utrophin, troponin T and rapsyn) could be amplified in all samples, but there are striking quantitative differences between myoid cells that express most genes at a high level and TEC or thymocytes. (3) The relatively high level of utrophin and ErbB2 in TEC and at lesser extent in thymocytes suggests an intrinsic role of these proteins in the physiology of these cells.
4.1. Contribution of the various thymic cells in tolerance mechanisms
Fig. 6. ErbB2 expression in the normal human thymus. Myoid cells are double-stained with anti-desmin antibodies (A) and ErbB2 (B) antibodies. The arrows show some double-stained myoid cells. The epithelial network labeled with anti-keratin antibodies (C) is also double-stained with antiErbB2 antibody (D). Most ErbB2+ cells are located in the medullary areas (D). At a higher magnification, the epithelial network is clearly double stained with anti-keratin (E) and anti-ErbB2 (F) antibodies.
Our results clearly show that all AChR subunits and AChR-related genes are weakly expressed in a general manner in the major thymic compartments (TEC and thymocytes) but that the level of expression of these genes is much higher and similar to that in muscle cells in the myoid cell population. The low level (less than 1%) of many genes (a-, y- and g-AChR subunits, MCK and Musk) in TEC raises questions concerning self-tolerance towards these antigens. As previously reported tolerance towards a thymic antigen depends upon the level of expression of that antigen (Salmon et al., 1998) and level of expression of autoantigens correlates with resistance to autoimmune diseases (Chentoufi and Polychronakos, 2002; Egwuagu et al., 1997). 4.2. Role of myoid cells in tolerance and autoimmunity
ErbB2 was similar in TEC and MITC cells, while it was much lower in thymocytes. ErbB3 was moderately expressed in TEC and thymocytes (between 1% and 10% of the reference value). We then analyzed ErbB2 expression on thymic sections by immunofluorescence. Myoid cells identified by labeling with an anti-desmin antibody (Fig. 6A) were clearly double stained with anti-ErbB2 (Fig. 6B), but other cells were also labeled. Double staining with anti-keratin antibodies indicated that most ErbB2-positive cells were epithelial cells (Fig. 6C – F). Interestingly, the area markedly stained by the anti-ErbB2 antibody is the medulla (Fig. 6C and D). The double-stained cells are clearly distinguishable at a higher magnification (Fig. 6E and F).
4. Discussion The main results of our study are as follows: (1) The thymic myoid cell line displays similar characteristics compared to the rhabdomyosarcoma cell line in terms of the quantitative expression of all the genes explored, making this cell line a unique ‘‘thymicmuscle’’ tool.
It is generally accepted that myoid cells play a role in the breakdown of tolerance (or of ignorance) in MG, because of their high level of expression of AChR (Wakkach et al., 1999). Our data proving that myoid cells express high levels of AChR and AChR-related genes in non-pathological situations raise the possibility of their involvement in tolerance mechanisms. Tolerance induction could occur by direct mechanisms through scanning by T cells or indirect pathways after antigen spreading (Klein and Kyewski, 2000). The medulla location of myoid cells makes possible interactions between these cells and neighboring thymocytes that could lead to deletion of autoreactive cells if HLA – TCR interactions between myoid cells and thymocytes are strong enough. However, myoid cells express class I but not class II antigens (Schluep et al., 1987; Wakkach et al., 1999). Therefore it is possible that only autoreactive CD8 + T cells could be deleted. This hypothesis is consistent with data showing that cytotoxic T cells specific for muscle antigens are not involved in pathogenic mechanisms at the muscle endplates in MG patients (Nakano and Engel, 1993). The role of myoid cells in tolerance mechanism could also occur by antigen spreading pathway. The antigens produced by myoid cells could be available and presented by specialized antigen-presenting cells if these antigens are secreted or if the myoid cells undergo apoptosis. This process is
104
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105
possible since medullary dendritic cells are in close proximity with myoid cells. The turnover of myoid cells was evidenced by morphological features of degenerating myoid cells (Bornemann and Kirchner, 1998) and could then contribute to the tolerization through antigen spreading mechanisms. One could wonder whether the number of myoid cells in the thymus could be a susceptibility factor to autoimmune diseases, and particularly to diseases affecting muscles, such as myasthenia gravis. Our data clearly show that some of the muscle antigens are not only present in TEC but also in thymocytes. Although the expression is generally low, one could wonder its signification. Since antigen presentation could turn out by an indirect pathway, through the secretion of the antigens or their accessibility after cell apoptosis, if the transcripts are efficiently translated in the thymocytes, then the antigens could be captured, after apoptosis of thymocytes, by neighboring specialized antigen-presenting cells. Although the expression of self-antigens by thymocytes has already been reported (Heath et al., 1998), this question is opened and deserves further investigation. To explain the possible involvement of myoid cells in both tolerance induction and autoimmunity, the two-signal theory could be put forward, as it was suggested in several physiological and pathological situations (Baxter and Hodgkin, 2002). According to this theory, we propose that muscle antigens in the thymus induce tolerization in a resting environment while they induce activation of autoreactive cells in an inflammatory context; Indeed, it is possible that a pathological inflammatory event occurring in the thymus from MG patients makes the muscle antigens accessible for the capture by dendritic cells located in the same thymic compartment (medulla). Therefore, the autoreactive T cells instead of being deleted are activated and become pathogenic. The initial pathological event is not known but myoid cells could be attacked by early anti-AChR autoantibodies, as it has been recently suggested (Roxanis et al., 2002). The location of myoid cells in and around germinal centers in MG patient’s thymus is consistent with this hypothesis. 4.3. Characterization of myoid cells We previously showed that myoid cells produce all the chains of AChR and that this receptor, is functional as demonstrated in patch-clamp experiments (Wakkach et al., 1999). In this study, we extended this analysis further by real-time PCR quantification of the levels of mRNA for seven other related genes. Altogether, the level of expression was very similar in myoid cells and in the TE671 cells used as a muscle cell control. We found that the abundance of mRNA for the various AChR subunits could be classified as follows: a = h>y>gHq. These results are similar to those we previously obtained with a radioactive quantitative PCR approach, showing that the a- and h-AChR subunits were much more abundant than the q subunit in muscle biopsy samples (Guyon et al., 1994, 1998). Similarly to our
previous report (Guyon et al., 1998), this study shows that the level of expression for AChR subunits is higher in the rhabdomyosarcoma cell line than in muscle biopsy samples, except for the q subunit. It is interesting to note that the q subunit, which was considered absent from the TE671 cells (Beeson et al., 1996), was detectable in these cells, although the expression was very low, indicating that the fetal form is largely predominant in these cells. The expression of all muscle genes in myoid cells provides evidence of the muscular nature of the MITC cell line and demonstrates the potential value of muscle gene expression for exploring the role of this tiny cell population of the thymic medulla. The role of these cells in the thymus remains unclear. A recent study by Pagel et al. (2000) indicated that these cells have the capacity to generate muscle cells, and may therefore be seen as a novel source of muscle stem cells. Another report showed that mdx dystrophy mice have fewer myoid cells than normal in their thymuses (Wong et al., 1999), indicating that the development of thymic myoid cells is parallel to that of peripheral muscle cells. In a previous study, we found that the myoid cell line partially protects thymocytes from apoptosis (Wakkach et al., 1999) and their possible role in induction of tolerance is discussed above. Further investigation is required to determine whether these functions are modified in mdx dystrophy mice and to explore in more detail the physiological role of myoid cells in the thymus. In conclusion, this work demonstrates that thymic myoid cells have many properties typical of muscle cells, as shown not only by quantitative comparison of the expression of AChR genes, but also by quantitative analysis of seven other related genes. Although expression of all the genes analyzed was detected in TEC and thymocytes, the level of expression in these cells was much lower than in MITC, except for q-AChR, utrophin and ErbB3 genes. Since myoid cells express high level of most muscle genes and are consistently found in the thymic medulla, their contribution to tolerance induction could be seriously evoked. It will be interesting to evaluate whether a high number of thymic myoid cells could be correlated with resistance to autoimmune diseases affecting muscles. Acknowledgements This work was supported by grants from the Association Francßaise contre les Myopathies (AFM), the National Institute of Health (NS39869) and the European Community (QLG1-CT-2001-01918). LMR received a postdoctoral grant from Association Francßaise contre les myopathies. References Agius, M.A., Zhu, S., Kirvan, C.A., Schafer, A.L., Lin, M.Y., Fairclough, R.H., Oger, J.J., Aziz, T., Aarli, J.A., 1998. Rapsyn antibodies in myasthenia gravis. Ann. N.Y. Acad. Sci. 841, 516 – 521.
L. Mesnard-Rouiller et al. / Journal of Neuroimmunology 148 (2004) 97–105 Altiok, N., Bessereau, J.L., Changeux, J.P., 1995. ErbB3 and ErbB2/neu mediate the effect of heregulin on acetylcholine receptor gene expression in muscle: differential expression at the endplate. EMBO J. 14, 4258 – 4266. Baxter, A.G., Hodgkin, P.D., 2002. Activation rules: the two-signal theories of immune activation. Nat. Rev., Immunol. 2, 439 – 446. Beeson, D., Jacobson, L., Newsom-Davis, J., Vincent, A., 1996. A transfected human muscle cell line expressing the adult subtype of the human muscle acetylcholine receptor for diagnostic assays in myasthenia gravis. Neurology 47, 1552 – 1555. Berchtold, M.W., Brinkmeier, H., Muntener, M., 2000. Calcium ion in skeletal muscle: its crucial role for muscle function, plasticity, and disease. Physiol. Rev. 80, 1215 – 1265. Bornemann, A., Kirchner, T., 1998. Thymic myoid cell turnover in myasthenia gravis patients and in normal controls. Virchows Arch. 432, 357 – 361. Chentoufi, A.A., Polychronakos, C., 2002. Insulin expression levels in the thymus modulate insulin-specific autoreactive T-cell tolerance: the mechanism by which the IDDM2 locus may predispose to diabetes. Diabetes 51, 1383 – 1390. Derbinski, J., Schulte, A., Kyewski, B., Klein, L., 2001. Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nat. Immunol. 2, 1032 – 1039. Dhoot, G.K., Dransfield, I., Grand, R.J., Perry, S.V., 1986. Distribution of isoforms of the myofibrillar proteins in myoid cells of thymus. J. Muscle Res. Cell Motil. 7, 351 – 360. Egwuagu, C.E., Charukamnoetkanok, P., Gery, I., 1997. Thymic expression of autoantigens correlates with resistance to autoimmune disease. J. Immunol. 159, 3109 – 3112. Fuhrer, C., Gautam, M., Sugiyama, J.E., Hall, Z.W., 1999. Roles of rapsyn and agrin in interaction of postsynaptic proteins with acetylcholine receptors. J. Neurosci. 19, 6405 – 6416. Gautam, M., Noakes, P.G., Mudd, J., Nichol, M., Chu, G.C., Sanes, J.R., Merlie, J.P., 1995. Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature 377, 232 – 236. Grady, R.M., Merlie, J.P., Sanes, J.R., 1997. Subtle neuromuscular defects in utrophin-deficient mice. J. Cell Biol. 136, 871 – 882. Guyon, T., Levasseur, P., Truffault, F., Cottin, C., Gaud, C., BerrihAknin, S., 1994. Regulation of acetylcholine receptor alpha subunit variants in human myasthenia gravis. Quantification of steady-state levels of messenger RNA in muscle biopsy using the polymerase chain reaction. J. Clin. Invest. 94, 16 – 24. Guyon, T., Wakkach, A., Poea, S., Mouly, V., Klingel-Schmitt, I., Levasseur, P., Beeson, D., Asher, O., Tzartos, S., Berrih-Aknin, S., 1998. Regulation of acetylcholine receptor gene expression in human myasthenia gravis muscles. Evidences for a compensatory mechanism triggered by receptor loss. J. Clin. Invest. 102, 249 – 263. Heath, V.L., Moore, N.C., Parnell, S.M., Mason, D.W., 1998. Intrathymic expression of genes involved in organ specific autoimmune disease. J. Autoimmun. 11, 309 – 318. Hoch, W., McConville, J., Helms, S., Newsom-Davis, J., Melms, A., Vincent, A., 2001. Auto-antibodies to the receptor tyrosine kinase MuSK in patients with myasthenia gravis without acetylcholine receptor antibodies. Nat. Med. 7, 365 – 368. Kaminski, H.J., Fenstermaker, R.A., Abdul Karim, F.W., Clayman, J., Ruff, R.L., 1993. Acetylcholine receptor subunit gene expression in thymic tissue. Muscle Nerve 16, 1332 – 1337. Klein, L., Kyewski, B., 2000. Self-antigen presentation by thymic stromal cells: a subtle division of labor. Curr. Opin. Immunol. 12, 179 – 186. Lindstrom, J.M., Seybold, M.E., Lennon, V.A., Whittingham, S., Duane, D.D., 1976. Antibody to acetylcholine receptor in myasthenia gravis. Prevalence, clinical correlates, and diagnostic value. Neurology 26, 1054 – 1059.
105
Luther, M.A., Schoepfer, R., Whiting, P., Casey, B., Blatt, Y., Montal, M.S., Montal, M., Linstrom, J., 1989. A muscle acetylcholine receptor is expressed in the human cerebellar medulloblastoma cell line TE671. J. Neurosci. 9, 1082 – 1096. Mitsui, T., Kawajiri, M., Kunishige, M., Endo, T., Akaike, M., Aki, K., Matsumoto, T., 2000. Functional association between nicotinic acetylcholine receptor and sarcomeric proteins via actin and desmin filaments. J. Cell. Biochem. 77, 584 – 595. Nakano, S., Engel, A.G., 1993. Myasthenia gravis: quantitative immunocytochemical analysis of inflammatory cells and detection of complement membrane attack complex at the end-plate in 30 patients. Neurology 43, 1167 – 1172. Navaneetham, D., Penn, A.S., Howard, J.F., Conti-Fine, B.M., 2001. Human thymuses express incomplete sets of muscle acetylcholine receptor subunit transcripts that seldom include the delta subunit. Muscle Nerve 24, 203 – 210. Pagel, C.N., Morgan, J.E., Gross, J.G., Partridge, T.A., 2000. Thymic myoid cells as a source of cells for myoblast transfer. Cell Transplant 9, 531 – 538. Perry, S.V., 1998. Troponin T: genetics, properties and function. J. Muscle Res. Cell Motil. 19, 575 – 602. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, E45. Rasmussen, R., 2001. Quantification on the light cycler. In: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real-time PCR, Methods and Applications. Springer, Heidelberg, pp. 21 – 34. Rimmer, J.J., 1980. Myoid cells and myasthenia gravis: a phylogenetic overview. Dev. Comp. Immunol. 4, 385 – 394. Romi, F., Skeie, G.O., Aarli, J.A., Gilhus, N.E., 2000. Muscle autoantibodies in subgroups of myasthenia gravis patients. J. Neurol. 247, 369 – 375. Roxanis, I., Micklem, K., McConville, J., Newsom-Davis, J., Willcox, N., 2002. Thymic myoid cells and germinal center formation in myasthenia gravis; possible roles in pathogenesis. J. Neuroimmunol. 125, 185 – 197. Salmon, A.M., Bruand, C., Cardona, A., Changeux, J.P., Berrih-Aknin, S., 1998. An acetylcholine receptor alpha subunit promoter confers intrathymic expression in transgenic mice. Implications for tolerance of a transgenic self-antigen and for autoreactivity in myasthenia gravis. J. Clin. Invest. 101, 2340 – 2350. Schluep, M., Willcox, N., Vincent, A., Dhoot, G.K., Newsom-Davis, J., 1987. Acetylcholine receptors in human thymic myoid cells in situ: an immunohistological study. Ann. Neurol. 22, 212 – 222. Spuler, S., Marx, A., Kirchner, T., Hohlfeld, R., Wekerle, H., 1994. Myogenesis in thymic transplants in the severe combined immunodeficient mouse model of myasthenia gravis. Differentiation of thymic myoid cells into striated muscle cells. Am. J. Pathol. 145, 766 – 770. Wakkach, A., Guyon, T., Bruand, C., Tzartos, S., Cohen-Kaminsky, S., Berrih-Aknin, S., 1996. Expression of acetylcholine receptor genes in human thymic epithelial cells: implications for myasthenia gravis. J. Immunol. 157, 3752 – 3760. Wakkach, A., Poea, S., Chastre, E., Gespach, C., Lecerf, F., De La Porte, S., Tzartos, S., Coulombe, A., Berrih-Aknin, S., 1999. Establishment of a human thymic myoid cell line. Phenotypic and functional characteristics. Am. J. Pathol. 155, 1229 – 1240. Wakkach, A., Chastre, E., Bruand, C., Cohen-Kaminsky, S., Emami, S., Gespach, C., Berrih-Aknin, S., 2001. Phenotypic and functional characterization of human thymic stromal cell lines. Cell. Mol. Biol. 47, 167 – 178 (Noisy-le-grand). Wong, A., Garrett, K.L., Anderson, J.E., 1999. Myoid cell density in the thymus is reduced during mdx dystrophy and after muscle crush. Biochem. Cell. Biol. 77, 33 – 40.