Tick-borne encephalitis virus natural foci emerge in western Sweden

ARTICLE IN PRESS

International Journal of Medical Microbiology 298 (2008) S1, 73–80 www.elsevier.de/ijmm

Tick-borne encephalitis virus natural foci emerge in western Sweden Catherine Brinkleya,, Peter Nolskogb, Irina Golovljovac, ( Ake Lundkvistc, Tomas Bergstro¨ma a

Department of Virology, University of Go¨teborg, Guldhedsgatan 10B, S-413 46 Go¨teborg, Sweden Department of Infectious Diseases, Skovde Hospital, Skovde, Sweden c Swedish Institute for Infectious Disease Control, Stockholm, Sweden b

Accepted 9 December 2007

Abstract There has been an emergence of tick-borne encephalitis (TBE) cases in western Sweden over the past 10 years. Human cases cluster in distinct regions around major bodies of water, raising the question of TBE prevalence in ticks within these defined localities. This study was based on a collection of 7120 questing nymphs, 510 questing adults, and 132 fed female ticks from cows in 4 suspected TBE foci, based on human cases, and 2 non-endemic areas of western Gotaland. All tick pools were screened with Real-Time RT-PCR targeting the non-coding 30 -region. Prevalence in ticks in the endemic areas ranged from 0.1% to 0.42%, which is comparable with other more established TBE endemic regions in Europe. Of the 18 positive pools, viral copy numbers ranged from 500 to 3.7  109 copies/pool. Sequence data from a TBE patient in western Gotaland confirmed that the western European subtype of TBEV has spread to western Sweden. r 2008 Elsevier GmbH. All rights reserved. Keywords: Flavivirus; Tick-borne encephalitis virus; RT-PCR; Ticks; Molecular epidemiology

Introduction The tick-borne encephalitis virus (TBEV) belongs to the family of Flaviviridae. The TBE complex shares 77–98% amino acid similarity in the E protein, making this protein region a prime target for sequencing in phylogeny studies (Gao et al., 1993; Mandl et al., 1993). There are three subtypes of TBE: Far Eastern (FE), Siberian (Sib), and West-European (WE) (Wallner et al., 1996; Gritsun et al., 2003b; Pogodina et al., 2004). In Corresponding author. Tel.: +46 7 0458 9295; fax: +46 31 342 4860. E-mail address: [email protected] (C. Brinkley).

1438-4221/$ - see front matter r 2008 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2007.12.005

Europe and Siberian Russia, TBEV is a high-impact CNS pathogen with approximately 12,000 diagnoses annually (Gu¨nther and Haglund, 2005). The virus causes a variety of clinical manifestations, with neurological manifestations in up to 30% of the patients (Gustafson et al., 1993). Lethality of WE-TBEV found in Europe is o2%, but post-encephalitic syndrome is seen in over 40% of the infected patients, often severely impairing their quality of life (Gu¨nther et al., 1997). Antiviral treatment is currently lacking, although two vaccines are available that effectively prevent TBEV infection (Heinz et al., 1980; Klockmann et al., 1991). In Scandinavia, the first reports of TBE from Sweden, Finland, Denmark, and Norway date back to 1954, 1956, 1963, and 1997, respectively (Skarpaas et al.,

ARTICLE IN PRESS 74

C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

2006). In Sweden, routine TBEV surveillance since 1956 and neutralizing antibody assays of TBEV on cattle sera in the 1950s placed most TBE natural foci around Stockholm though recent years have seen TBE spread north and west (von Zeipel et al., 1959; Lindgren and Gustafson, 2001; Haglund, 2002). Annually, Sweden reports 4100 cases each year, and that number is rising. In the western Gotaland region, situated at the southwestern part of Sweden, TBE was previously a nonexistent or unnoticed human disease. During the last decade, however, a growing number of cases have been diagnosed, making TBEV one of the most threatening emerging diseases in the investigated region. TBEV in Sweden is transmitted largely by Ixodes ricinus hard ticks, which can live for 2–5 years. TBEV spreads to ticks when they feed either on viremic or nonviremic animals (Labuda et al., 1993a, 1997; Randolph et al., 1999; Gritsun et al., 2003a). Vertical transstadial and sexual transmission can occur among both ticks and warm-blooded hosts (Molnarova and Mayer, 1980; Khozinsky et al., 1985). Once infected, the tick remains infected throughout its life cycle (Kozˇuch and Nosek, 1980; Nosek et al., 1986; Rosa et al., 2003). The low-endemic region of western Gotaland is wellsuited for studies on the epidemiology of TBEV. In addition to routine surveillance of TBE cases and seroprevalence studies, determining TBEV prevalence in free-living tick populations and quantities of TBEV RNA in ticks helps verify TBE foci, assess the transmission risk from a tick bite, and predict the epidemiology of the disease for immunoprophylactic strategies. For this purpose, samples of ticks were collected from different parts of western Gotaland, the front of the epidemic. Additionally, TBEV from western Gotaland was phylogenetically analyzed to trace the origin of the TBEV spread in that region.

Materials and methods Collection of ticks All TBE locations were selected on the basis of interviews with TBE patients about suspected areas where they had contracted TBE (Table 1). Four different locations were chosen from areas where more than 5 patients had contracted TBE in the past 10 years (Fig. 1). In total, 4 TBE locations were sampled and 2 control areas (Fig. 1). Areas where pools of questing ticks were collected are detonated with ‘T’, while ticks taken from cows were labeled ‘C’ (Fig. 1). Annual precipitation was in the range of 600–1000 mm/year for all sites. Host composition for each of the areas included small mammals, foxes, badgers, elk, and roe deer. Cattle were present in the tick spots T2 and C1–3.

Table 1. Geographical coordinates and environmental description for each of the sample areas

T1

GPS coordinates

Environmental description

Lat: N 571520 4400

Forest undergrowth located adjacent to a shallow pond and golf course

Long: E 111460 2300 T2

Lat: N 581340 4200

Forest undergrowth close to a footpath

Long: E 121590 400 T3

Lat: N 581470

Forest undergrowth along logging paths

Long: E 131450 T4

Lat: N 581400 4200

Forest undergrowth near large lake

Long: E 131390 5000 C1

Lat: N 571530 3500

Clear-cut cow pasture bordering a forest

Long: E 111500 2900 C2

Lat: N 581150

Forest undergrowth and pastures

Long: E 111350 C3

Lat: N 571330 3600

Forest undergrowth and pastures

Long: E 121260 5300

With the exception of ticks collected from T4 in 2004, all other ticks were collected between May and September 2006. Ticks were collected by dragging a 1 m2 white flannel cloth through forest and meadow vegetation. Ticks were pooled accordingly: 20 nymphs, 10 females, or 10 males. Feeding ticks were collected from cows in two nonendemic areas (C2, C3, Fig. 1) and the TBE location C1 (Fig. 1), 1 km away from the collection site for questing ticks (T1, Fig. 1). Feeding ticks were thought to be a more sensitive TBEV assay (Su¨ss et al., 2004, 2006). Each partially or fully fed tick was processed individually, while male ticks found with the feeding females were pooled as mentioned above. After collection, ticks were stored at 70 1C.

Extraction of TBEV RNA Frozen tick pools were transferred to tubes of MagNA Lyser Green Beads (Roche, Mannheim, Germany), and

ARTICLE IN PRESS C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

Fig. 1. Human tick-borne encephalitis cases in western Gotaland (western Sweden) 1997–2006. Sampling spots (T1–4 for unfed questing ticks, C1–3 for ticks feeding on cows) are denoted with circles over each area.

then 1 ml of sterile PBS was added to each tube. Immediately after adding buffer, tubes were transferred to the MagNA Lyser instrument (Roche Diagnostics Scandinavia AB, Stockholm). Samples were homogenized for 50 s at 6000 rpm, and then cooled for 1 min in the MagNA Lyser Rotor Cooling Block (Roche Diagnostics Scandinavia AB). Homogenization and cooling were repeated once. One hundred microliters of homogenized tick solution was added to 250 ml of lysate buffer and incubated at room temperature for 30 min before extracting RNA with the MagNA Pure LC Isolation station (Roche Diagnostics Scandinavia AB). Total RNA was isolated from ticks using the MagNA Pure LC RNA Isolation Kit III for Tissue (Roche Diagnostics Scandinavia AB) and eluted at a volume of 100 ml according to the supplier’s protocol. This procedure includes a DNase step to remove excess DNA.

TaqMan one-step quantitative RT-PCR assay As controls, the following European subtypes of TBEV were used: Hochosterwitz, isolated from a tick in

75

Carinthia, Austria, in 1971 (Heinz and Kunz, 1981), and the Far Eastern subtype TBEV strain Sofyn (Pletnev et al., 1990). Quantification of TBEV wild-type RNA was accomplished using a plasmid serial dilution from 8000 to 106 copies per reaction as a standard. A synthetic fragment corresponding to the amplified region of the TBEV wildtype was cloned into the pUC57 cloning vector containing a lacZ promoter for in vitro transcription (GenScript Corp, NJ, USA). Lyophilized plasmid was diluted to desired concentrations using carrier Poly-deoxy-inosinicdeoxy-cytidylic acid (Roche, Sweden) with a Ct value of 27 corresponding to 1,000,000 genetic equivalents/ml according to the supplier’s protocol. One genetic equivalent is regarded as one viral RNA copy. For RT-PCR of TBEV a method described by Schwaiger and Cassinotti (2003) was used, with minor modifications to enhance Tm values (melting temperatures) of the oligonucleotides: forward primer TGGGCGGTTCTTGTTCTCC, reverse primer TCACACATCACCTCCTTGTCAGA, and TaqMan probe FAMCTGAGCCACCATCACCCAGACACAG-TAMRA (FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetrametylrhodamine). This method targets a part of the 30 non-coding region of the TBEV genome that is conserved in essentially all TBEV subtypes, and the amplicon is located at nt 11054–11123 of the Neudoerfl (European) subtype of TBEV (accession number U27495). A PCR for a tick house-keeping gene, 16S Ixodes tick RNA, was run in parallel as an overall control for RNA extraction and amplification as previously described by Schwaiger and Cassinotti (2003). All primers and probes were synthesized by MWG-Biotech AG (Ebersberg, Germany). RT-PCR was done with TaqMan one-step RT-PCR Mastermix Reagents Kit from Applied Biosystems (Branchburg, NJ, USA). RT-PCR mixtures consisted of 50 ml reaction volumes each containing 25 ml AmpliTaq Gold DNA Polymerase Mix (2  ), 1.25 ml RT enzyme mix, 350 nM of the forward primer and reverse primer, and 250 nM of the TaqMan probe. About 20 ml of RNA tick extract was used for TBEV RT-PCR and 2 ml was used for tick 16S RT-PCR with corresponding primers and probes. The remaining volume of each reaction was filled with RNase-free sterile water (Invitrogen, Stockholm). All one-step PCR reactions were carried out in a 96-well plate, which was centrifuged for 1 min at 1000g at room temperature in a swing-out rotor (Rotina 48R; Hettich, Tuttlingen, Germany) to remove small air bubbles in the reaction vessels. Amplification and detection were carried out as a one-step RT-PCR including a 30 min RT step at 48 1C, followed by incubation at 95 1C for 10 min prior to two-step amplification (95 1C 15 s, 60 1C 60 s, 45 cycles) on an ABI 7300 Sequence Detection System (Applied Biosystems).

ARTICLE IN PRESS 76

C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

Statistical analysis At the 95% confidence interval, sample size and realized prevalence of each location was used to find the recommended number of pools collected in order to statistically prove prevalence in a perfect test (Segeant, 2007). The adjusted prevalence and confidence intervals were calculated based on pool size and a perfect test using the pooled prevalence calculator (Segeant, 2007).

Phylogenetic analysis The partial E-gene sequence of TBE patient sera from location T2 was named ‘Vinninga’. The sequence data were aligned using ClustalW (V. 1.83) with the following sequences: the TBEV strains Oshima C1 (accession number: AB022294), Oshima 5–10 (AB022292), Japan (AB022292), KH98-10 (AB022297), Sofjin (X03870), Vasilchenko (AF069066), Lat 1-96 (AJ415565), Greek goat encephalitis virus (X77732), TBEV strain Turkey (L01265), Omsk hemorrhagic fever virus (X66694), Powassan virus (L06436), Kyasanur forest disease virus (X74111), Langat virus (AF253419), Spanish sheep encephalitis virus (X77470), louping ill virus (Y07863), TBEV strain Est-2546 (DQ393779), Negishi virus (M94956), the TBEV strains Kumlinge-A52 (X60286), Neudoerfl (U27495), Hypr (U39292), Kokkola-118 (DQ451296) and Kokkola-102 from Finland (DQ451295), Norway (Skarpaas et al., 2006), Denmark (Skarpaas et al., 2006), the Swedish TBEV strain Toro-2003 (DQ401139) (Melik et al., 2007), TBE-263 (U27491), and yellow fever virus (NC_002031). Phylogenetic analyses excluded sequence regions containing gaps. The PHYLIP program package (Felstein, 1993) was used to generate 100 bootstrap replicates of the sequence data (seqboot, consense). Maximum likelihood (dnaml) and parsimony (dnapars) methods were compared. Trees were rooted using the yellow fever virus strain.

Results

Previous studies (Schwaiger and Cassinotti, 2003) have shown that there is no inhibition of RNA in tick samples. This was verified by dilution studies in TBEVpositive samples. Likewise, the tick-specific extraction control, 16S rRNA, was successfully amplified in all samples and showed no signs of inhibitory factors based on dilution tests. However, when run without the RT step, 16S rRNA was amplified on average 5 cycles after samples with the RT step, indicating that DNA constitutes approximately 3% of the quantity of 16S rRNA samples. 16S rRNA is therefore a total nucleic acid quality control step as opposed to being solely an RNA quality control. For unfed, questing ticks, 16S rRNA had Ct value range of 16–25 with a mean of 22. For ticks feeding on cows, tick 16S rRNA had a Ct value range of 19–27 with a mean of 24. The higher 16S rRNA Ct value for ticks feeding on cows (which corresponds to less 16S rRNA in these samples) can be explained in that less of the sample make-up was derived from processed tick, and instead most of the sample consisted of the feeding tick’s meal of compressed erythrocytes from cow blood, thereby giving a lower tick-specific16S rRNA reading. The MagNA Lyser method proved superior to traditional hand-grinding methods. When compared to traditional hand-grinding methods, the MagNA Lyser yielded tick 16S rRNA which could be detected 2–3 Ct values lower, which corresponds to 5–10 times more copies of tick RNA. This finding was in spite of the fact that the MagNA Lyser rarely fully homogenized the tick exoskeleton, though all the internal organs were homogenized. Presumably, the enclosed MagNA Lyser system had less potential for contamination and retained more sample throughout the processing. The success of detecting tick 16s rRNA by RT-PCR at relatively low Ct values verified that the RNA extraction procedure worked well. Additionally, dilutions of control strains Horowitz and Sofjin could be detected as low as 10 copies/well with reproducibility; thus showing the sensitivity of the assay. It was therefore concluded that the RNA extraction and TaqMan PCR procedures gave an optimal viral copy count.

PCR methodology Prevalence The methodology used to detect TBEV RNA in the tick population was found to be reliable, sensitive, and yielded optimal results when compared to other methods. Such sensitivity is key as the amount of virus present may be extremely low at the time of testing due to freezing and thawing of the samples, replication cycle of the virus, or the decrease in viral copy numbers depending on the developmental stage in ticks (Kozˇuch and Nosek, 1985; Puchhammer-Sto¨ckl et al., 1995).

All positive results were reconfirmed from an independent aliquot of the same sample. As routinely noticed, frozen and thawed samples typically had Ct values 2–3 cycles higher than the original value, indicating a decrease in total viral copy count. Such a decrease could indicate that initial freezing methods decreased viral copy numbers by 5–10% as well, suggesting that initial viral concentration is somewhat higher in the tick than has been measured.

ARTICLE IN PRESS C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

77

Viral copy number in the positive samples had a range spanning 5  102–3.7  109 copies/pool. The majority of samples were weakly positive. Of the 5 positive nymphal pools from T1, 4 were weakly positive (500–650 copies/ pool) while one pool contained 26,000 copies/pool. Feeding ticks taken from cows in the same region (C1) were negative for TBEV. The 4 positive pools from T2 were strongly positive with an average of 109 copies/pool (range: 9.5  104 to 3.7  109 copies/pool). The two male pools from T2 had 3.8  108 and 3.7  109 copies/pool. Both T3 nymphal pools were weakly positive. Of the seven positive pools from T4, most were weakly positive with the exception of two pools, one adult pool with 7.2  106 and one nymphal pool containing 5  107 copies. All pools except T3 and C1 reflect the true prevalence according to statistical analysis. All collected ticks from both control sites (C2, C3), although statistically insignificant, were negative for TBEV.

WE-TBEV subtypes, with one strain each from Sweden, Norway, and Denmark. The 451 nt length region covers part of the E gene, which allows the virus to bind to the host cell and is therefore involved in the development of epitopes that may cause neurovirulence (Mandl, 2005). It is also believed that this region is under evolutionary pressure when the virus circulates to new regions, hosts, or biotopes as it would determine the virus ability to bind to new host cells. Maximum likelihood and parsimony methods both placed Vinninga, the western Gotaland region strain of TBEV, in the WE-TBEV subtype. The three distinct subtypes of TBE as well as the louping ill viruses cluster accordingly. All Scandinavian strains fell into the WETBEV cluster, relating them closely to Neudoerfl. Furthermore, the Vinninga strain is most closely related to the Lativa-811 strain with a bootstrap support of 81.

Phylogeny

Discussion

In order to gain insight on the relationship of the TBEV found in western Sweden with the other Scandinavian strains of TBEV, a phylogenetic tree was produced (Fig. 2). The phylogenetic analysis included 17

This is the first time to our knowledge that TBEV copy numbers have been recorded in ticks by RT-PCR. The extreme range of viral copy numbers, from 500 to over 109, may give clues to why some TBE cases are

Fig. 2. Maximum likelihood tree based on E gene encoding nucleotide sequences of tick-borne encephalitis virus (nt 1354–1805 in strain Neudoerfl). The tree is rooted by the yellow fever virus. All horizontal branch lengths are drawn to scale. Only bootstrap values 470% are shown (Sib: Siberian subtype; FE: Far-Eastern subtype; Eu: Western subtype; LI: louping ill).

ARTICLE IN PRESS 78

C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

more severe than others. One can assume that a tick with high TBEV copy numbers would have a higher likelihood of infecting a human and could possibly transmit disease with higher neurovirulence. There could be several factors that affect how ticks could acquire such high viral copy numbers: recent feeding on a viremic host, developmental stage of the tick, or TBEV possibly replicating in the tick. As expected, TBEV prevalence was low for these newly developed TBEV foci, 0.10–0.42% (Table 2). Unexpectedly, the TBEV prevalence data in ticks were comparable to PCR-detected TBEV prevalence in Ixodes ricinus from countries with more established TBEV endemic regions, 0.04–0.48%, with the exception of Latvia (Tables 2 and 3). The similarities in prevalence to more well-established European TBEV foci indicate the rapidity and magnitude with which TBEV foci may become established. These data also suggest that there may exist threshold levels for TBEV circulation in tick populations in that only a small percentage of ticks may get infected with the virus and retain it or survive. This hypothesis is supported by surveillance of field-collected ticks in Germany from 1997 to 2002, which show steady TBEV prevalence figures (Su¨ss et al., 2004). Prevalence in the questing tick population correlated with the clustering of human TBE cases, but did not correlate to the numbers of TBE cases in each of the Table 2.

T1 T2 T3 T4 C1 C2 C3

regions. There cannot be a direct correlation between prevalence and incidence as prevention by vaccination, extent of exposure to ticks, uneven distribution of TBEV, and more severe TBE in elderly people (Kunze et al., 2006) can distort the amount of TBE cases. Control samples, though all negative, included too few ticks to conclusively say that TBEV does not exist in these areas. However, the old mainstay of evidence that new TBE foci are not newly emerged, but instead are the result of increased awareness can be largely discounted in western Sweden as there is a long history of TBE surveillance and NT antibody experiments from the 1950s. Natural foci confirmed recently by human cases in southern Sweden in Skane (Fa¨lt et al., 2006) and those wellknown TBE-endemic areas around Stockholm had been predicted as early as the 1950s by neutralizing antibodies to TBEV in cow sera (von Zeipel et al., 1959). However, although the sample areas in western Sweden were surveyed in the 1950s, no NT antibodies to TBEV were found at the time in the selected regions with the exception of one positive serum sample from T3. The emergence of TBEV in these areas most likely marks the spread of the virus to new endemic regions, thus prompting a call for stricter surveillance and vaccination programs in western Sweden. Phylogenetic analysis places Vinninga (the western Gotaland strain) closest to Latvia-811, Toro-2003 (the

Tick-borne encephalitis virus in Ixodes ricinus ticks in low endemic areas of western Gotaland (western Sweden) Nymphal pools

Female pools

Male pools

Total ticks

Positive pools

Adjusted prevalence (%)

Confidence interval (%)

61 66 92 137 0 0 0

1 11 10 7* (1) 42 27 63

1 12 (2) 9

1240 1550 2030 2810 43 28 63

5 4 2 7 0 0 0

0.42 0.26 0.10 0.27 0 0 0

0.15–0.90 0.08–0.61 0.02–0.31 0.11–0.51 0 0 0

(5) (2) (2) (6)

1 1 0

Numbers in parentheses indicate numbers of positive pools. For C1–3, female numbers signify individual ticks. All other counts are the numbers of pools consisting of 10 adults or 20 nymphs. *Adults in region T4 were not sexed, 7 represents the total male and female ticks collected.

Table 3.

Tick-borne encephalitis virus in Ixodes ricinus ticks as confirmed by PCR methods

Country

Prevalence (%)

No. of ticks tested

Reference

Italy Lithuania Norway Finland Czech Republic Austria Germany Latvia

0.04 0.19 0.25 0.34 0.4 0.44 0.41N, 0.6A 2.4N, 3.0A

13,885 3234 810 589 491N 3404 18,360N, 3350A 175N, 350A

Hudson et al. (2001) Han et al. (2005), Juceviciene et al. (2005) Skarpaas et al. (2006) Han et al. (2002) Danielova´ et al. (2006) Labuda et al. (1993b) Su¨ss et al. (2004, 2006) Su¨ss et al. (2002)

N: nymphs; A: adults. All studies used a nested-PCR technique, and prevalence percentages range from zero to the below listed value depending on the region within the country.

ARTICLE IN PRESS C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

Swedish strain), and the Norwegian strain, with total homogeneity of 97% in the nucleic acid sequence of these four strains. These strains were also closely related to the Austrian isolated Neudoerfl strain, which is also found in the Czech Republic, Germany, Latvia, and Lithuania (Lundkvist et al., 2001; Mickiene et al., 2001; Su¨ss et al., 2004; Weidmann et al., 2006). This supports the theory that TBEV spread from Central Europe to Sweden and subsequently to Norway as opposed to spread of the virus from Finland or Russia. The origins of TBE in western Gotaland could also be correlated to their locations. TBEV foci in western Gotaland exist around bodies of water, indicating that perhaps TBEV spread from ticks attached to migratory water birds, though there is also the possibility of livestock with ticks transported to these areas for farming. One further explanation is that TBEV spread across Sweden but only certain patches could support the life cycles of ticks, hosts, and virus; and as a result, these patches are where we see TBE cases today. Further analysis of longer sections of the Swedish TBE strains are needed to give more insight into how TBEV is spreading across low-endemic regions and establishing new TBEV regions. In conclusion, these newly described natural foci have been verified in the tick population and show a distinct migration of the virus to the western parts of Sweden.

Acknowledgments We thank Sirkka Vene for technical advice; the detection and quantification department of Sahlgrenska Hospital for technical assistance; Jan Carlsson, Reiman Franksson, and Stro¨mmaskolan for assistance with cows; and Oskar Roshed and Inger Karlsson for help in tick collecting. Financial support was received from the Va¨straGo¨taland Research Fund.

References Danielova´, V., Rudenko, N., Daniel, M., Holubova, J., Materna, J., Golovchenko, M., Schwarzova, L., 2006. Extension of Ixodes ricinus ticks and agents of tick-borne diseases to mountain areas in the Czech Republic. Int. J. Med. Microbiol. 296 (Suppl. 40), 48–53. ( Alsterlund, R., Carlsson, B., Eliasson, Fa¨lt, J., Lundgren, A., ( Vene, S., Settergren, B., I., Haglund, M., Lundkvist, A., 2006. Tick-borne encephalitis (TBE) in Skane, southern Sweden: a new TBE endemic region? Scand. J. Infect. Dis. 38, 800–804. Felstein, J., 1993. PHYLIP, Version 3.66. Department of Genetics. University of Washington, Seattle, USA. Gao, G.F., Hussain, M.H., Reid, H.W., Gould, E.A., 1993. Classification of a new member of the TBE flavivirus

79

subgroup by its immunological, pathogenetic and molecular characteristics: identification of subgroup-specific pentapeptides. Virol. Res. 30, 129–144. Gritsun, T.S., Lashkevich, V.A., Gould, E.A., 2003a. Tickborne encephalitis. Antivir. Res. 57, 129–146. Gritsun, T.S., Nuttall, P.A., Gould, E.A., 2003b. Tick-borne flaviviruses. Adv. Virol. Res. 61, 317–371. Gu¨nther, G., Haglund, M., 2005. Tick-borne encephalopathies: epidemiology, diagnosis, treatment and prevention. CNS Drugs 19, 1009–1032. Gu¨nther, G., Haglund, M., Lindquist, L., Sko¨ldenberg, B., Forsgren, M., 1997. Intrathecal IgM, IgA and IgG antibody response in tick-borne encephalitis. Long-term follow-up related to clinical course and outcome. Clin. Diag. Virol. 8, 17–29. Gustafson, R., Forsgren, M., Gardulf, A., Granstro¨m, M., Svenungsson, B., 1993. Clinical manifestations and antibody prevalence of Lyme borreliosis and tick-borne encephalitis in Sweden: a study in five endemic areas close to Stockholm. Scand. J. Infect. Dis. 25, 595–603. Haglund, M., 2002. Occurrence of TBE in areas previously considered being non-endemic: Scandinavian data generate an international study by the International Scientific Working Group for TBE (ISW-TBE). Int. J. Med. Microbiol. 291, 50–54. Han, X., Aho, M., Vene, S., Brummer-Korvenkontio, M., Juceviciene, A., Leinikki, P., Vaheri, A., Vapalahti, O., 2002. Studies on TBE epidemiology in Finland (and Lithuania). Int. J. Med. Microbiol. 291, 48–49. Han, X., Juceviciene, A., Uzcategui, N.Y., BrummerKorvenkontio, H., Zygutiene, M., Jaaskelainen, A., Leinikki, P., Vapalahti, O., 2005. Molecular epidemiology of tick-borne encephalitis virus in Ixodes ricinus ticks in Lithuania. J. Med. Virol. 77, 249–256. Heinz, F.X., Kunz, C., 1981. Homogeneity of the structural glycoprotein from European isolates of tick-borne encephalitis virus: comparison with other flaviviruses. J. Gen. Virol. 57, 263–274. Heinz, F.X., Kunz, C., Fauma, H., 1980. Preparation of a highly purified vaccine against tick-borne encephalitis by continuous flow zonal ultracentrifugation. J. Med. Virol. 6, 213–221. Hudson, P.J., Rizzoli, A., Rosa, R., Chemini, C., Jones, L.D., Gould, E.A., 2001. Tick-borne encephalitis virus in northern Italy: molecular analysis, relationships with density and seasonal dynamics of Ixodes ricinus. Med. Vet. Entomol. 15, 304–313. Juceviciene, A., Zygutiene, M., Leinikki, P., BrummerKorvenkontio, H., Salminen, M., Han, X., Vapalahti, O., 2005. Tick-borne encephalitis virus infections in Lithuanian domestic animals and ticks. Scand. J. Infect. Dis. 37, 742–746. Khozinsky, V.V., Semenov, B.F., Gresı´ kova´, M., Chunikhin, S.P., Sekeyova, M., Kozˇuch, O., 1985. Role of macrophages in the pathogenesis of experimental tick-borne encephalitis in mice. Acta Virol. 29, 194–202. Klockmann, U., Bock, H.L., Kwasny, H., Praus, M., Cihlova, V., Tomkova, E., Krivanec, K., 1991. Humoral immunity against tick-borne encephalitis virus following manifest disease and active immunization. Vaccine 9, 42–46.

ARTICLE IN PRESS 80

C. Brinkley et al. / International Journal of Medical Microbiology 298 (2008) S1, 73–80

Kozˇuch, O., Nosek, J., 1980. Experimental transmission of tick-borne encephalitis (TBE) virus by Haemaphysalis concinna ticks. Acta Virol. 24, 377. Kozˇuch, O., Nosek, J., 1985. Replication of tick-borne encephalitis (TBE) virus in Ixodes ricinus ticks. Folia Parasitol. 32, 373–375. Kunze, U., Baumhackl, U., Bretschneider, R., Chmelik, V., Grubeck-Loebenstein, B., Haglund, M., Heinz, F., Kaiser, R., Kimmig, P., Kunz, C., Kunze, M., Mickiene, A., MisicMajerus, L., Randolph, S., Rieke, B., Stefanoff, P., Su¨ss, J., Wimmer, R., 2006. The golden agers and tick-borne encephalitis. Conference report and position paper of the International Scientific Working Group on Tick-borne encephalitis. Vaccine 24, 1236–1237. Labuda, M., Danielova´, V., Jones, L.D., Nuttall, P.A., 1993a. Amplification of tick-borne encephalitis virus infection during co-feeding of ticks. Med. Vet. Entomol. 7, 339–342. Labuda, M., Stu¨nzner, D., Kozˇuch, O., Sixl, W., Kocianova, E., Schaffler, R., Vyrostekova, V., 1993b. Tick-borne encephalitis virus activity in Styria, Austria. Acta Virol. 37, 187–190. Labuda, M., Kozˇuch, O., Zuffova, E., Eleckova, E., Hails, R.S., Nuttall, P.A., 1997. Tick-borne encephalitis virus transmission between ticks cofeeding on specific immune natural rodent hosts. Virology 235, 138–143. Lindgren, E., Gustafson, R., 2001. Tick-borne encephalitis in Sweden and climate change. The Lancet 358, 16–18. ( Vene, S., Golovljova, I., Mavtchoutko, V., Lundkvist, A., Forsgren, M., Kalnina, V., Plyusnin, A., 2001. Characterization of tick-borne encephalitis virus from Latvia: evidence for co-circulation of three distinct subtypes. J. Med. Virol. 65, 730–735. Mandl, C.W., 2005. Steps of the tick-borne encephalitis virus replication cycle that affect neuropathogenesis. Virus Res. 111, 161–174. Mandl, C.W., Holzmann, H., Kunz, C., Heinz, F.X., 1993. Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses. Virology 194, 173–184. Melik, W., Nilsson, A.S., Johansson, M., 2007. Detection strategies of tick-borne encephalitis virus in Swedish Ixodes ricinus reveal evolutionary characteristics of emerging tickborne flaviviruses. Arch. Virol. 152, 1027–1034. Mickiene, A., Vene, S., Golovljova, I., Laiskonis, A., Lindquist, L., Plyusnin, A., Lundkvist, A., 2001. Tickborne encephalitis virus in Lithuania. Eur. J. Clin. Microbiol. Infect. Dis. 20, 886–888. Molnarova, A., Mayer, V., 1980. Experimental infection of pregnant mice with viruses of the tick-borne encephalitis (TBE) complex. Acta Virol. 24, 297. Nosek, J., Chunikhin, S.P., Gresı´ kova´, M., Korolev, M.B., Kozˇuch, O., Stefutkina, L.F., Ivannikova, T.I., 1986. Peculiarities of tick-borne encephalitis virus reproduction in Haemaphysalis inermis ticks and their explants. Acta Virol. 30, 396–401. Pletnev, A.G., Yamshchikov, V.F., Blinov, V.M., 1990. Nucleotide sequence of the genome and complete amino

acid sequence of the polyprotein of tick-borne encephalitis virus. Virology 174, 250–263. Pogodina, V.V., Bochkova, N.G., Karan, L.S., Trukhina, A.G., Levina, L.S., Malenko, G.V., Druzhinina, T.A., Lukashenko, Z.S., Dul’keit, O.F., Platonov, A.E., 2004. The Siberian and Far-Eastern subtypes of tick-borne encephalitis virus registered in Russia’s Asian regions: genetic and antigen characteristics of the strains. Vopr. Virusol. 49, 20–25 (in Russian). Puchhammer-Sto¨ckl, E., Kunz, C., Mandl, C.W., Heinz, F.X., 1995. Identification of tick-borne encephalitis virus ribonucleic acid in tick suspensions and in clinical specimens by a reverse transcription-nested polymerase chain reaction assay. Clin. Diagn. Virol. 4, 321–326. Randolph, S.E., Miklisova, D., Lysy, J., Rogers, D.J., Labuda, M., 1999. Incidence from coincidence: patterns of tick infestations on rodents facilitate transmission of tick-borne encephalitis virus. Parasitology 118, 177–186. Rosa, R., Pugliese, A., Norman, R., Hudson, P.J., 2003. Thresholds for disease persistence in models for tick-borne infections including non-viraemic transmission, extended feeding and tick aggregation. J. Theor. Biol. 224, 359–376. Schwaiger, M., Cassinotti, P., 2003. Development of a quantitative real-time RT-PCR assay with internal control for the laboratory detection of tick borne encephalitis virus (TBEV) RNA. J. Clin. Virol. 27, 136–145. Segeant, E., 2007. /http://www.ausvet.com.au/pprev/S. Skarpaas, T., Golovljova, I., Vene, S., Ljostad, U., Sjursen, H., Plyusnin, A., Lundkvist, A., 2006. Tickborne encephalitis virus, Norway and Denmark. Emerg. Infect. Dis. 12, 1136–1138. Su¨ss, J., Schrader, C., Abel, U., Bormane, A., Duks, A., Kalnina, V., 2002. Characterization of tick-borne encephalitis (TBE) foci in Germany and Latvia (1997–2000). Int. J. Med. Microbiol. 291, 34–42. Su¨ss, J., Schrader, C., Falk, U., Wohanka, N., 2004. Tickborne encephalitis (TBE) in Germany – epidemiological data, development of risk areas and virus prevalence in field-collected ticks and in ticks removed from humans. Int. J. Med. Microbiol. 293, 69–79. Su¨ss, J., Klaus, C., Diller, R., Schrader, C., Wohanka, N., Abel, U., 2006. TBE incidence versus virus prevalence and increased prevalence of the TBE virus in Ixodes ricinus removed from humans. Int. J. Med. Microbiol. 296, 63–68. Wallner, G., Mandl, C.W., Ecker, M., Holzmann, H., Stiasny, K., Kunz, C., Heinz, F.X., 1996. Characterization and complete genome sequences of high- and low-virulence variants of tick-borne encephalitis virus. J. Gen. Virol. 77, 1035–1042. Weidmann, M., Schmidt, P., Hufert, F.T., Krivanec, K., Meyer, H., 2006. Tick-borne encephalitis virus in Clethrionomys glareolus in the Czech Republic. Vector Borne Zoonotic Dis. 6, 379–381. von Zeipel, G., Svedmyr, A., Zetterberg, B., 1959. The geological distribution in Sweden of viruses belonging to the Russian spring-summer-louping-ill group; serological survey of antibodies in cow sera. Arch. Ges. Virusforsch. 9, 449–459.