Tie2 ligands angiopoietin-1 and angiopoietin-2 are coexpressed with vascular endothelial cell growth factor in growing human bone

Bone Vol. 28, No. 1 January 2001:65–71

Tie2 Ligands Angiopoietin-1 and Angiopoietin-2 Are Coexpressed With Vascular Endothelial Cell Growth Factor in Growing Human Bone A. HORNER,1 S. BORD,1 A. W. KELSALL,2 N. COLEMAN,3 and J. E. COMPSTON1 1 Department of Medicine and 2Department of Paediatrics, University of Cambridge School of Clinical Medicine,, and 3Department of Pathology, University of Cambridge, Addenbrooke’s Hospital, Cambridge, UK

Introduction

Angiogenesis is essential for bone growth and repair. Recent studies have shown that the endothelial-specific mitogen vascular endothelial growth factor (VEGF) is a key regulator of vascular invasion into the growth plate in infant and adolescent animals. In order to identify mechanisms regulating VEGF-induced angiogenesis in growing bone, we have investigated the expression of the angiopoietins (Ang-1 and Ang-2) in human neonatal ribs. Ang-1 and Ang-2 exhibited similar patterns of staining in the growing rib. In the cartilage, expression of Ang-1 and Ang-2 increased with chondrocyte maturation. Ang-1, Ang-2, and VEGF were not detected in the resting zone except adjacent to vascular canals, and maximum expression was detected at the cartilage bone interface. In the cartilage, Ang-2 was more highly expressed than Ang-1 or VEGF, with staining observed in the proliferating, hypertrophic, and mineralized zones. In the bone, Ang-1, Ang-2, and VEGF were detected in modeling and remodeling sites. Ang-1 was detected in the majority of osteoblasts, osteoclasts, and in some marrow space cells. Ang-2 was expressed at variable levels by osteoblasts and osteoclasts in modeling and remodeling bone. VEGF was detected in cells at bone surfaces and in the marrow spaces. Strong staining for VEGF was observed in osteoblasts and osteoclasts in modeling and remodeling bone. In the perichondrium, Ang-1, Ang-2, and VEGF were most highly expressed adjacent to the hypertrophic zone and at sites of bone collar formation. In the periosteum, Ang-1, Ang-2, and VEGF expression colocalized with alkaline phosphatase expression. These observations provide the first evidence for the expression of the angiopoietins in growing human bone in vivo. The distribution of Ang-1, Ang-2, and VEGF indicate these factors may play key roles in the regulation of angiogenesis at sites of endochondral ossification, intramembranous ossification, and bone turnover in the growing human skeleton. (Bone 28:65–71; 2001) © 2001 by Elsevier Science Inc. All rights reserved. Key Words: Angiogenesis.

Angiopoietin;

VEGF;

Human;

It is well established that angiogenesis is essential for the replacement of cartilage by bone during skeletal growth and repair. Recently, we and others5,9,14 described the site-specific expression of vascular endothelial growth factor (VEGF) in growing bone. Inhibition of VEGF was found to result in a failure of endochondral ossification and bone growth in infant and adolescent animals, indicating that VEGF is an essential coordinator of bone growth.5,8,14 In addition to VEGF, recent studies have shown that ligands for the endothelial tyrosine kinase receptor, Tie2, are key regulators of angiogenesis and postangiogenic blood vessel maturation.1,3,11,15 There are two ligands for Tie2, angiopoietin (Ang)-1 and Ang2.3,11,14 Ang-1 and Ang-2 are highly homologous secreted peptides of approximately 75 kDa and bind to Tie2 with similar affinity.11 However, their binding to Tie2 induces different responses. Ang-1 stimulates rapid receptor autophosphorylation,3 which is not induced after the binding of Ang-2.11 In addition, a dose-dependent inhibition of Ang-1 binding to Tie2 by Ang-2 suggests that Ang-2 acts as an antagonist of Tie2 in endothelial cells.11 Ang-1 and Ang-2 have been shown to have opposing roles in the regulation of angiogenesis and vascular stabilization.11 Ang-1 stimulates pericyte recruitment and stabilization of cellcell and cell-matrix interaction. Absence of Ang-1 leads to embryonic lethality due to a failure of blood vessel maturation.7,10,13,15 A similar phenotype was observed in the Tie2 knockout animal.4 In contrast, Ang-2 induces destabilization of cell-cell and cell-matrix interactions. This is thought to facilitate access and response to inducers of angiogenesis such as VEGF.1,6,7,11,13 In the absence of growth and/or survival signals, this destabilization of matrix and cell interactions is believed to induce endothelial cell apoptosis.1,6,7,11 Transgenic overexpression of Ang-2 results in a phenotype similar to that seen in the Tie2 and Ang-1 knockout animals.11 The angiopoietins are key regulators of angiogenesis in many tissues but their role in the regulation of vascular growth in the skeleton has not been established. Here, we have investigated the expression and distribution of Ang-1, Ang-2, and VEGF in growing human bone in order to define their distribution at sites of endochondral and intramembranous ossification.

Bone;

Address for correspondence and reprints: Dr. Alan Horner, University of Cambridge, School of Clinical Medicine, Dept. of Medicine, Box 157, Level 5, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 2QQ, UK. E-mail: [email protected] © 2001 by Elsevier Science Inc. All rights reserved.

Methods Neonatal ribs were obtained at postmortem from infants born at full term (37– 42 weeks, n ⫽ 4) with no evidence of growth 65

8756-3282/01/$20.00 PII S8756-3282(00)00422-1

66

A. Horner et al. Coexpression of Ang-1, Ang-2, and VEGF in growing bone

Table 1. Primer sets used for RT-PCR analysis

Primer (5⬘-3⬘) Ang-1 Ang-2 VEGF

G3PDH

CAGCGCCGAAGTCCAGAAAAC CACATGTTCCAGATGTTGAAG GACGGCTGTGATGATAGAAATAGG GACTGTAGTTGGATGATGTGCTTG CGAAGTGGTGAAGTTCATGGATG TTCTGTATTCAGTCTTTCCTGGTGAG CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCACC

Bone Vol. 28, No. 1 January 2001:65–71

Immunolocalization Product size (bp) 204 264 403 535 607 658 600

(VEGF121) (VEGF165) (VEGF189) (VEGF206)

retardation or skeletal abnormalities. All samples were collected with parental consent and approval by the Local Research Ethics Committee. Ribs were halved longitudinally. For frozen sections, half was embedded in cryo-M-bed (Bright Instruments). Before RNA isolation, the other half was freed of connective tissue and the bone and cartilage separated into fractions of cartilage, cartilage/bone interface, primary modeling bone, and secondary remodeling bone.

Expression of Ang-1, Ang-2, VEGF, and the endothelial cell marker CD34 was assessed by indirect immunofluorescence and enzyme-linked immunohistochemistry. Localization of Ang-1 and Ang-2 was performed using affinity-purified goat polyclonal antibodies raised against peptides corresponding to the amino acid sequences mapping to the amino terminus of Ang-1 (N-18) and the carboxy terminus of Ang-2 (C-19) (Santa Cruz Biotechnology Inc.). These antibodies have previously been shown by the manufacturer not to cross-react with Ang-2 or Ang-1, respectively. Localization of VEGF and endothelial cells was performed as previously described9 using the affinity-purified rabbit polyclonal antibody A-20 (Santa Cruz Biotechnology Inc.) for VEGF and the anti-CD34 mouse monoclonal antibody Qbend10 (SeroTec) for endothelial cells. Frozen sections were fixed for 5 min in neutral buffered formalin and washed three times in phosphate-buffered saline (PBS). Nonspecific peroxidase activity was blocked with Immuno Pure Peroxidase Suppressor (Pierce, Chester, UK) for 22 min. Before the addition of the primary antibody, nonspecific binding was blocked by incubating the sections for 15 min in PBS containing 1% blocking reagent (Roche) and 10% fetal calf serum (blocking buffer). Excess blocking

Figure 1. Immunolocalization of Ang-1, Ang-2, and VEGF in cartilage canals in the resting zone of the cartilage. (a) Localization of vascular endothelium in the resting zone using the monoclonal antibody Qbend 10 (anti-CD34). (Arrows) Stained vascular endothelium. (b) Ang-1. Arrows indicate Ang-1-stained cells. (c) Ang-2. Arrows indicate Ang-2-stained cells. (d) VEGF. Arrows indicate VEGF-stained cells. (e) High-power view of b. Arrows indicate Ang-1-stained cells. (f) High-power view of c. Arrows indicate Ang-2-stained cells. (g) High-power view of d. Arrows indicate VEGF-stained cells. Original magnification: a– d, ⫻100; e– g, ⫻400.

Bone Vol. 28, No. 1 January 2001:65–71

A. Horner et al. Coexpression of Ang-1, Ang-2, and VEGF in growing bone

67

performed using FITC-conjugated rabbit anti-goat and TRITCconjugated swine anti-rabbit secondary antibodies (Dako). Primary antibodies were applied simultaneously, anti-VEGF and anti-Ang1 or anti-VEGF and anti-Ang-2, and incubated overnight at 4°C. The sections were washed three times in PBS and the antigens visualized by addition of a TRITC-conjugated swine anti-rabbit (VEGF) for 1 h, washing three times in PBS, and then the addition of a FITC-conjugated rabbit anti-goat (Ang-1 and Ang-2) for 1 h. Sections were then washed three times in PBS and mounted in Dako fluorescent mounting medium. Specificity of the reactions was confirmed by substituting the primary antibodies for nonimmune goat or rabbit IgG for the angiopoietins and VEGF and an isotype-matched mouse monoclonal antibody for CD34 at the same concentrations as the primary antibodies. In addition, reactivity of the antiangiopoietin and anti-VEGF antisera was also confirmed by preadsorption of the primary antibodies with corresponding immunizing peptide. The TRITC swine anti-rabbit and the FITC rabbit anti-goat secondary antibodies were also shown not to cross-react with goat or rabbit immunoglobulins, respectively. Alkaline Phosphatase Cytochemistry Alkaline phosphatase (ALP) was detected in unfixed frozen sections using ␣-naphthyl acid phosphate and Fast Red TR, following the method described by Bradbeer et al.2 Sections were counterstained with methyl green and mounted in glycerol/PBS (50:50 v/v). Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)

Figure 2. Immunolocalization of Ang-1, Ang-2, and VEGF in the growing human neonatal rib. (a) Low-power view showing Ang-1 expression (bar ⫽ 500 ␮m). (b) High-power view showing Ang-1 expression in hypertrophic zone chondrocytes (bar ⫽ 50 ␮m). (c) Low-power view showing Ang-2 expression (bar ⫽ 500 ␮m). (d) High-power view showing Ang-2 expression in hypertrophic zone chondrocytes (bar ⫽ 50 ␮m). (e) Low-power view showing VEGF expression (bar ⫽ 500 ␮m). (f) High-power view showing VEGF expression in hypertrophic zone chondrocytes (bar ⫽ 50 ␮m). (g) Control, normal goat IgG (bar ⫽ 500 ␮m). C ⫽ cartilage, B ⫽ bone, Pr ⫽ proliferating zone, H ⫽ hypertrophic zone, Pc ⫽ perichondrium, Po ⫽ periosteum; arrows indicate positively stained cells.

buffer was rinsed off and the primary antibody applied at a concentration of 0.5 ␮g/mL (Ang-1 and Ang-2), 2 ␮g/mL (VEGF), and 1 ␮g/mL (CD34) in PBS containing 1% blocking reagent (antibody diluent) and incubated overnight at 4°C in a humidified chamber. Excess antibody was removed by washing three times in PBS. Nonspecific binding was blocked by incubating for 15 min in blocking buffer, excess blocking buffer was removed, and the second biotinylated anti-goat (Ang-1, Ang-2), anti-rabbit (VEGF), or anti-mouse (CD34) antiserum applied. After washing, sections were incubated for 30 min in the presence of avidin biotin complex (ABC reagent; Vecta Labs). Free ABC was removed by washing and the immunoreactivity visualised using diaminobenzidine (DAB). Sections were counterstained with hematoxylin, dried, and mounted in DePeX. Colocalization of VEGF and Ang1 and VEGF and Ang-2 was

RNA was isolated from the four fractions of the growing rib using Trizol reagent (Gibco). Tissue samples were weighed, snap frozen, and ground with a mortar and pestle in Trizol reagent, then allowed to warm to room temperature. Total RNA was isolated by two extractions with Trizol reagent and the yield measured spectrophotometrically. RNA was then treated with RNase-free DNase 1 to remove any contaminating DNA. One microgram of total RNA was reverse transcribed using Expand reverse transcriptase (Roche) and oligo (dT)15 primers. PCR was performed using 4 ␮L of the cDNA and primers specific for Ang-1, Ang-2, VEGF, or the house-keeping gene G3PDH. Primer sequences are shown in Table 1. The primers for VEGF were designed to span the alternate splicing sites, thereby detecting all four spliced variants of VEGF.13 PCR products were separated on 2% agarose gels and visualized by ethidium bromide staining. Images were captured using an Eagle Eye transilluminator (Stratagene) and density values assessed using the National Institutes of Health Image Analysis freeware (http://rsb.info.nih.gov/nih-image/). The identity of PCR products was confirmed by sequencing. PCR reactions were performed employing a “hot start” (94°C for 5 min and cooling to 80°C) before the addition of the Taq DNA polymerase. Ang-1 and Ang-2 were amplified for 31, 33, and 35 cycles under the following conditions: 94°C for 60 sec, 55°C for 60 sec, and 72°C for 60 sec, with a final extension for 10 min at 72°C. VEGF and G3PDH were amplified under the following conditions: 94°C for 40 sec, 58°C for 40 sec, and 72°C for 60 sec for 31, 33, and 35 cycles, with a final extension for 10 min at 72°C.

68

A. Horner et al. Coexpression of Ang-1, Ang-2, and VEGF in growing bone

Bone Vol. 28, No. 1 January 2001:65–71

Figure 3. Immunolocalization of Ang-1, Ang-2, and VEGF in osteoblasts and osteoclasts in modeling and remodeling bone. (a,b) Coexpression of Ang-1 (a) and VEGF (b) by osteoblasts in remodeling bone. Arrows indicate osteoblast surface. (c,d) Coexpression of Ang-1 (e) and VEGF (f) in osteoclasts. Arrow indicates an osteoclast. (e,f) Coexpression of Ang-2 (c) and VEGF (d) by osteoblasts in modeling bone. Arrows indicate osteoblast surface. (g,h) Coexpression of Ang-2 (g) and VEGF (h) in osteoclasts. Arrow indicates an osteoclast. (i) Control, nonimmune rabbit serum. (j) Control, nonimmune goat serum. B ⫽ bone; bar ⫽ 20 ␮m; original magnification ⫻600.

Results Immunolocalization Cartilage and bone. In the cartilage, no staining for Ang-1, Ang-2, or VEGF was detected in the resting zone chondrocytes except in cells adjacent to blood vessels (Figure 1). Figure 1a demonstrates two vascular canals within the resting zone of cartilage. Adjacent sections were stained for Ang-1, Ang-2 and VEGF (Figure 1b– g). Ang-1 was expressed in a minority of chondrocytes adjacent to the invading vasculature (Figure 1b&e) whereas Ang-2 and VEGF were detected in the majority of cells adjacent to the vascular canal (Figure 1c,d,f,g). In the cartilage adjacent to the vascular canal, VEGF and Ang-1 were not detected and only occasional chondrocytes stained for Ang-2. Staining for Ang-1, Ang-2, and VEGF increased with chondrocyte maturation (Figure 2a,c,e). In the proliferating zone, Ang-1 was weakly expressed by a minority of chondrocytes. The number and intensity of cells staining increased with chondrocyte hypertrophy, maximum staining being observed in the lower hypertrophic and mineralized zones of the cartilage (Figure 2b). Expression of Ang-2 increased through the proliferating zone

and was greatest in hypertrophic and mineralized zone chondrocytes, where the majority of chondrocytes were stained (Figure 2d). As previously reported,10 VEGF was absent from the proliferating zone and expression increased through the hypertrophic zone with maximum staining observed in the lower hypertrophic and mineralized zone chondrocytes (Figure 2f). No staining was observed when the primary antibodies were substituted for nonimmune IgG (Figure 2g). In the primary and secondary bone, all three factors were detected in osteoblasts and osteoclasts (Figure 3). Ang-1 and VEGF were coexpressed by the majority of osteoblasts and osteoclasts (greater than 75%) (Figure 3a– d), whereas Ang-2 was only weakly expressed in both cell types, approximately 25% of cells showing clear immunoreactivity compared with nonimmune IgG controls (Figure 3e,g). All Ang-2-positive osteoblasts and osteoclasts identified also stained for VEGF (Figure 3e– h). No staining was observed when the primary IgG was substituted for nonimmune IgG (Figure 3h,i). Perichondrium and periosteum. Expression of Ang-1, Ang-2, and VEGF was restricted to vascular structures in the

Bone Vol. 28, No. 1 January 2001:65–71

A. Horner et al. Coexpression of Ang-1, Ang-2, and VEGF in growing bone

69

Figure 5. Ethidium bromide-stained gel showing RT-PCR products for Ang-1, Ang-2, and G3PDH in dissected rib fractions after 33 cycles of PCR. (A) Ang-1 expression. (B) Ang-2 expression. (C) G3PDH expression. C ⫽ cartilage, C/B ⫽ cartilage/bone interface, 1° ⫽ primary modeling bone, 2° ⫽ secondary remodeling bone, Mr ⫽ marker ladder.

Expression of Ang-1, Ang-2, and VEGF mRNA

Figure 4. Immunolocalization of Ang-1, Ang-2, and VEGF in the perichondrium and periosteum. (a) Ang-1 expression at sites of primary bone collar formation. (b) Ang-2 expression at sites of primary bone collar formation. (c) VEGF expression at sites of primary bone collar formation. (d) Alkaline phosphatase expression at sites of primary bone collar formation. (e) Control normal rabbit IgG. (f) Ang-1 expression in the periosteum. (g) Ang-2 expression in the periosteum. (h) VEGF expression in the periosteum. (i) Alkaline phosphatase expression in the periosteum. (j) Control (normal goat IgG). C ⫽ cartilage, B ⫽ bone, Pc ⫽ perichondrium, Po ⫽ periosteum, arrows ⫽ positive staining, bar ⫽ 250 ␮m.

perichondrium adjacent to the resting zone. The intensity and number of cells staining for all three factors in the perichondrium increased adjacent to the proliferating, transitional, and hypertrophic zones (Figure 4a– c). VEGF was detected in the perichondrium adjacent to the upper proliferating zone and preceded Ang-1, Ang-2, and ALP expression. Ang-1 and Ang-2 expression increased in the perichondrium adjacent to the lower proliferating and transitional zones and coincided with ALP expression. However, expression of VEGF, Ang-1, and Ang-2 was highest at sites of bone collar formation and colocalized with ALP expression (Figure 4a– d). In the periosteum, staining for Ang-1, Ang-2, and VEGF was observed in cells within the fibrous tissue and at the bone surface (Figure 4f– h) and colocalized with ALP expression (Figure 4i).

Ang-1 and Ang-2 mRNA were detected in all fractions of the dissected ribs (Figure 5). Relative to the house-keeping gene G3PDH, Ang-1 mRNA had the lowest level of expression in the cartilage. Ang-1 expression almost doubled in the cartilage/bone interface fraction, with similar levels observed in the primary modeling and secondary remodeling bone fractions (Table 2), Figure 5A). Ang-2 mRNA was highly expressed in the cartilage and cartilage/bone interface fractions with a decrease of approximately 50% in the primary modeling bone fraction (Table 2, Figure 5A). RT-PCR of VEGF demonstrated that VEGF165 was the most abundant spliced variant in the growing rib (Figure 6). In the cartilage, cartilage/bone interface, and modeling bone fractions, only a single band corresponding to VEGF165 was detected (Figure 6). In the secondary remodeling bone, two bands were observed corresponding to VEGF165 and VEGF204, with VEGF165 being the most abundant (Figure 6). VEGF121 and VEGF189 were not detected.

Table 2. Mean arbitrary density values for Ang-1 and Ang-2 corrected for the house keeping gene G3PDH

Fraction Ang-1 Cartilage Cartilage/bone interface Modeling bone Remodeling bone Ang-2 Cartilage Cartilage/bone interface Modeling bone Remodeling bone

Mean density (n⫽3)

Range

0.654 1.028 0.901 0.971

0.508–0.788 0.935–1.155 0.848–0.990 0.797–1.136

0.890 1.104 0.518 0.726

0.802–0.981 1.014–1.159 0.458–0.576 0.614–0.876

Values obtained from PCR reactions run for 33 cycles.

70

A. Horner et al. Coexpression of Ang-1, Ang-2, and VEGF in growing bone

Figure 6. Ethidium bromide-stained gel showing RT-PCR products for VEGF-spliced variants in the dissected rib fractions. Lane 1 ⫽ marker; 2– 4 ⫽ cartilage; 5–7 ⫽ cartilage bone interface; 8 –10 ⫽ primary modeling bone; 11–13 ⫽ secondary remodeling bone; 2,5,8,11 ⫽ VEGF; 3,6,9,12 ⫽ negative control; 4,7,10,13 ⫽ G3PDH.

Discussion Recent studies have shown that VEGF-induced angiogenesis is a key step in the regulation of endochondrial ossification.5,14 However, the molecular mechanisms regulating VEGF-induced angiogenesis in growing bone have yet to be established. Here, we demonstrate that VEGF165 is the major spliced variant expressed in growing human bone. Also, we show that the regulatory molecules Ang-1 and Ang-2 (ligands for the endothelial receptor Tie-2) coexpressed with VEGF at sites of endochondral and intramembranous ossification and bone modeling and remodeling in growing human bone. Ang-1, Ang-2, and VEGF exhibited similar patterns of expression. This increased with chondrocyte maturation, and all three factors were detected at sites of bone modeling and remodeling. In the cartilage, Ang-1 and Ang-2 protein and mRNA expression increased with chondrocyte differentiation. However, unlike most other tissues in which Ang-1 predominates,6,11,13,17 Ang-2 was most highly expressed, particularly in the proliferating and upper hypertrophic zones. The functional significance of the high expression of Ang-2 in growth plate cartilage remains to be determined. However, transgenic overexpression of Ang-2 resulted in failure of angiogenesis and normal vascular development due to disruption of endothelial-pericyte interactions.11 In addition, high levels of Ang-2 and low levels of VEGF (as seen in the proliferating and upper hypertrophic zones) result in vascular regression during physiological angiogenesis in the ovarian corpus luteum.6,11 Consequently, high levels of Ang-2 expression in the proliferating and upper hypertrophic zones of the cartilage may serve to inhibit premature vascular invasion from the perichondrium where VEGF, Ang-1, and Ang-2 are highly expressed. In this respect, it is interesting to note that vascular invasion of the cartilage from the perichondrium was only observed in the resting zone, with focal expression of Ang-1, Ang-2, and VEGF in chondrocytes adjacent to the invading vascular canals. At the cartilage/bone interface, Ang-1, Ang-2, and VEGF were readily detected. The RT-PCR and immunolocalization data indicated that Ang-2 was predominantly expressed by chondrocytes with decreased expression in the primary modeling bone, whereas VEGF and Ang-1 were expressed by hypertrophic chondrocytes and bone cells. Polarized expression of Ang-2 and the balance between Ang-1 and Ang-2 at the cartilage/bone interface may regulate the rate and direction of vascular growth, with Ang-1 stimulating endothelial cell migration and vascular stabilization and Ang-2 increasing vessel destabilization and responsiveness to angiogenic factors.1,11,15,16 In the bone, all three factors were detected at sites of bone modeling and remodeling, indicating that vascular growth is an integral part of bone turnover in the growing skeleton. The variable intensity of staining and focal expression of Ang-2 by osteoblasts and osteoclasts is consistent with the pattern of expression observed for Ang-2 in other tissues,11,13,17 and indi-

Bone Vol. 28, No. 1 January 2001:65–71

cates a role in the regulation of vascular growth within the remodeling unit. The more consistent expression of Ang-1 by osteoblasts and osteoclasts is in keeping with its role in endothelial cell survival, the recruitment of pericytes, and the formation of stable vascular structures.1,3,6,11,15 In the perichondrium, expression of VEGF, Ang-1, and Ang-2 preceded alkaline phosphatase expression and/or bone collar formation. This indicates that vascular proliferation may precede osteoblast recruitment and/or maturation at sites of intramembranous ossification. However, it is worth noting that the highest levels of VEGF, Ang-1, and Ang-2 expression colocalized with ALP expression and bone formation, indicating that vascular growth and maintenance are an integral part of intramembranous ossification. In conclusion, these observations demonstrate that VEGF, Ang-1, and Ang-2 are expressed at sites of bone formation and turnover in the growing skeleton. Their distribution in growing bone indicates that vascular growth and maintenance may, at least in part, be regulated in an interdependent manner by VEGF, Ang-1, and Ang-2. Acknowledgments: This work was funded by The Wellcome Trust.

References 1. Asahara, T., Chen, D. H., Takahashi, T., Fujikawa, K., Kearney, M., Magner, M., Yancopoulos, G. D., and Isner, J. M. Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2 modulate VEGF-induced postnasal neovascularisation. Circulation Res 83:233–240; 1998. 2. Bradbeer, J., Lindsay, P. C., and Reeve, J. Fluctuation of mineral apposition rate at individual bone remodelling sites in human iliac cancellous bone: independent correlations with osteoid width and osteoblastic alkaline phosphatase activity. J Bone Miner Res 9:1670 –1686; 1994. 3. Davis, S., Aldrich, T. H., Jones, P. F., Acheson, A., Compton, D. L., Jain, V., Ryan, T. E., Bruno, J., Radziejewski, C., Maisonpierre, P. C., and Yancoppolos, G. D. Isolation of Angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 87:1161–1169; 1996. 4. Dumont, D. J., Gradwohl, G., Fong, G. H., Puri, M. C., Gertsenstein, M., Auerbach, A., and Breitman, M. L. Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, Tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev 8:1897–1909; 1994. 5. Gerber, H. P., Vu, T. H., Ryan, A. M., Kowalski, J., Werb, Z., and Ferrara, N. VEGF couples hypertrophic cartilage remodelling, ossification and angiogenesis during endochondral ossification. Nature Med 5:623– 628; 1999. 6. Goede, V., Schmidt, T., Kimmina, S., Kozian, D., and Augustin, H. G. Analysis of blood vessel maturation processes during cyclic ovarian angiogenesis. Lab Invest 78:1385–1394; 1998. 7. Hanahan, D. Signalling vascular morphogenesis and maintenance. Science 2777:48 –50; 1997. 8. Harper, J., and Klagsbrun, M. Cartilage to bone-Angiogenesis leads the way. Nature Med 5:617– 618; 1999. 9. Horner, A., Bishop, N. J., Bord, S., Beeton, C., Kelsall, A. W., Coleman, N., and Compston, J. E. Immunolocalisation of vascular endothelial growth factor (VEGF) in human neonatal growth plate cartilage. J Anat 194:519 –524; 1999. 10. Kwak, H. J., So, J. N., Lee, S. J., Kim, I., and Koh, G. Y. Angiopoietin-1 is an apoptosis survival factor for endothelial cells. FEBS Lett 448:249 –253; 1999. 11. Maisonpierre, P. C., Suri, C., Jones, P. F., Bartunkova, S., Wiegand, S., Radziejewski, C., Compton, D., McClain, J., Aldrich, T. H., Papadopoulos, N., Daly, T. J., Davis, S., Sato, T. N., and Yancopoulos, G. D. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277:55– 60; 1997. 12. Morii, K., Tanaka, R., Washiyama, K., Kumanishi, T., and Kuwano, R. Expression of vascular endothelial growth factor in capillary hemangioblastoma. Biochem Biophys Res Comm 194:749 –755; 1993. 13. Papapetropoulos, A., GarciaCareena, G., Dengler, T. J., Maisonpierre, P. C., Yancopoulos, G. D., and Sessa, W. C. Direct actions of angiopoietin -1 on human endothelium: Evidence for network stabilisation, cell survival, and interaction with other angiogenic factors. Lab Invest 79:213–223; 1999. 14. Ryan, A. M., Eppler, D. B., Hagler, K. E., Bruner, R. H., Thomford, P. J., Hall,

Bone Vol. 28, No. 1 January 2001:65–71 R. L., Shop, G. M., and O’Neil, C. A. Preclinical safety evaluation of rhuMabVEGF, an antiangiogenic humanized monoclonal antibody. Toxicol Pathol 27:78 – 86; 1999. 15. Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C., Davis, S., Sato, T. N., and Yancopoulos, G. D. Requisite role of angiopoietin-1, a ligand for Tie2 receptor, during embryonic angiogenesis. Cell 87:1171–1180; 1996. 16. Witzenbichler, B., Maisonpierre, P. C., Jones, P., Yancopoulos, G. D., and Isner, J. M. Chemotactic properties of angiopoietin-1 and -2, ligands for the endothelial-specific receptor tyrosine kinase Tie2. J Biol Chem 273:18514 – 18521; 1998.

A. Horner et al. Coexpression of Ang-1, Ang-2, and VEGF in growing bone

71

17. Yuan, H. T., Suri, C., Yancopoulos, G. D., and Woolf, A. S. Expression of angiopoietin-1, angiopoietin-2, and the Tie2 receptor tyrosine kinase during mouse kidney maturation. J Am Soc Nephrol 10:1722–1736; 1999.

Date Received: January 6, 2000 Date Revised: July 19, 2000 Date Accepted: August 23, 2000