Time course of Fos and Fras expression in the hypothalamic supraoptic neurons during chronic osmotic stimulation

Molecular Brain Research 90 (2001) 39–47 www.elsevier.com / locate / bres

Research report

Time course of Fos and Fras expression in the hypothalamic supraoptic neurons during chronic osmotic stimulation Seiji Miyata*, Hideki Tsujioka, Masanobu Itoh, Wataru Matsunaga, Hirofumi Kuramoto, Toshikazu Kiyohara Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606 -8585, Japan Accepted 20 February 2001

Abstract The Fos family comprises Fos and several subtypes of Fos-related proteins (Fras) such as FosB, Fra-1, Fra-2, DFosB, and chronic Fras. Changes in the expression of Fos family proteins with time are not well elucidated, particularly during chronic stimulation. In the present experiments, we investigated quantitatively the time course changes in Fos, FosB and Fras immunoreactivity in the magnocellular neurons of the supraoptic nucleus (SON) during acute and chronic osmotic stimulation. A small number of Fos- and FosB-positive neurons were observed in the SON of control rats, while many Fras-positive neurons were seen in control animals. Significant increases in the numbers of Fos-, FosB-, and Fras-positive neurons were observed 2 h after acute osmotic stimulation by intraperitoneal (i.p.) injection of 3% NaCl solution. Although the number of Fos-positive neurons returned to the control level 4 h after i.p. injection, a significant number of FosBand Fras-positive neurons were still observed 8 h after i.p. injection. During chronic osmotic stimulation by giving 2% NaCl solution for 2 and 5 days, a large number of Fos-positive neurons were observed, but the cessation of chronic osmotic stimulation by normal water drinking immediately decreased the number of Fos-positive neurons to the control level within 2 h. The number of FosB-positive neurons was increased with period of chronic osmotic stimulation, and a significant number were observed 2–8 h after the cessation of the stimulation. The number of Fras-positive neurons was also significantly higher during chronic osmotic stimulation, and this number was significantly high 2–8 h after the cessation of the stimulation. RT-PCR analysis demonstrated the persistent expression of c-fos mRNA in the SON during chronic osmotic stimulation. These results suggest that c-fos mRNA and Fos protein are constitutively elevated during chronic osmotic stimulation and the time course changes in Fos are different from those seen in FosB and Fras.  2001 Elsevier Science B.V. All rights reserved. Theme: Endocrine and autonomic regulation Topic: Osmotic and thermal regulation Keywords: Oxytocin; Vasopressin; Osmolarity; Immediate early gene; Dehydration

1. Introduction Immediate early genes including c-fos are induced in neurons by a variety of extracellular stimuli and are considered to link such acute stimuli with subsequent changes in gene expression by acting as third messengers during signal transduction [35]. In the neuronal cells, the basal level of c-fos expression is relatively low, although *Corresponding author. Tel.: 181-75-724-7796; fax: 181-75-7247760. E-mail address: [email protected] (S. Miyata).

there are some exceptional circumstances in which neurons express relatively high levels of them [10]. It is now established that many types of stimuli, some linked to neuronal excitation, elicit a transient induction of c-fos mRNA and protein. In addition to Fos, a set of Fos-related proteins (Fras) are induced by many of the agents and conditions [16]. Several Fras have now been identified; FosB at 45 kDa [61], Fra-1 at 41 kDa [7], and Fra-2 at 41 kDa [38]. DFosB (33 kDa) is known to be a splice variant of fosB with a truncated C-terminal of a FosB [36]. Chronic Fras at 35–37 kDa are products of the fosB gene and specifically isoforms of DFosB [15].

0169-328X / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0169-328X( 01 )00072-9

40

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

Fos family proteins are shown to form stable heterodimers with the members of the Jun family proteins to regulate transcription of other genes by binding to the specific nucleotide sequence, AP-1 sites (TGACTCA). The functional significance of the expression of multiple Fos, Jun proteins and their complexes is explained partly by the difference of their expression time course and binding affinity [16]. Acute stimuli such as immobilization stress [8,19,47], seizures [22], and noxious stimulation [37], are well known to induce a transient time course of c-fos expression in the various brain regions. After administration of cocaine, maximal induction of Fos is observed at 2 h, but several Fras are maximally expressed at 4 h in the striatum and nucleus accumbens [60]. Moreover, chronic administration of cocaine desensitizes the induction of Fos, FosB, Fra-1, and Fra-2, but instead induces chronic Fras [18,39,40]. The neurohypophysial hormones, oxytocin and arginine–vasopressin (AVP), are chiefly synthesized in the hypothalamic magnocellular neurons of the supraoptic (SON) and paraventricular nuclei (PVN) [54]. Both hormones are secreted into the blood circulation from the nerve endings in the posterior pituitary with increased demands of hormones [9]. In the hypothalamic SON and PVN, many studies have reported that c-fos expression is induced by acute stimuli such as hemorrhage [44], parturition [12,25,26], noxious stimuli [53], restraint stress [31], IL1-b injection [43], cholecystkinin injection [57], and LPS administration [29,45]. In these acute stimulations, the time course of c-fos expression exclusively shows a transient pattern; Fos protein expression generally reaches a peak 1–2 h after the onset of stimulation and then quickly declines to basal level within several hours. The osmotic regulation in the SON and PVN has been extensively used to study the stimulation coupled activation of the c-fos transcription cascade in the central nervous system, since much physiological evidence has shown the changes in the osmolarity, plasma hormonal level, and expression of various genes after acute osmotic stimulation and during chronic osmotic stimulation [5,24,34,49]. Many studies have demonstrated that osmotic stimulation evokes c-fos expression in the hypothalamic nuclei, the SON and PVN [5,11,12,21,27,32, 34,46,48,50,52,58]. However, the time course of expression pattern of Fos family proteins has not been conclusively elucidated, particularly during chronic osmotic stimulation. Therefore, the present experiments were designed using hypothalamic magnocellular SON neurons of rats as follows: (1) the comparison of time course changes in the expression of Fos, FosB, and Fras immunoreactivity during acute and chronic osmotic stimulation by the quantitative immunohistochemistry, (2) RT-PCR analysis of c-fos expression in the chronically stimulated rats to demonstrate the persistent expression of c-fos mRNA.

2. Materials and methods

2.1. Animals Wistar male rats (9–10 weeks old) were used in the experiments. The rats were housed under temperaturecontrolled (24618C), light-controlled (14:10 h, light / dark cycle) conditions, with food and water available ad libitum. All experimental protocols were performed according to the guideline for animal care of the Japan Society of Physiology.

2.2. Experimental treatment For observation of the time course change in Fos, FosB, and Fras expression, rats were treated with acute and chronic osmotic stimulation. Acute osmotic stimulation was performed by intraperitoneal (i.p.) injection of 3% NaCl solution (1 ml / 100 g b.w.), and the stimulated animals were fixed 2, 4, and 8 h after the onset of stimulation. Chronic osmotic stimulation was done by giving 2% NaCl hypertonic solution instead of normal drinking water and the stimulated animals were fixed at 2 and 5 days after the onset of saline drinking. In some experiments, the rats were allowed to drink water for 2, 4, and 8 h and fixed following chronic osmotic stimulation for 5 days. At appropriate time, the rats were anesthetized with Nembutal (70 mg / kg, i.p.) and perfused intracardially with 150 ml of 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer following heparinized phosphate-buffered saline (PBS) for immunohistochemistry. The brains were dissected out and postfixed with 4% PFA in 0.1 M phosphate buffer for 2 days at 48C. Fixed brains were then immersed in 25% sucrose in PBS for cryoprotectant.

2.3. Immunohistochemistry For Fos immunohistochemistry, frozen sections of the brain blocks containing the SON and pyriform cortex were cut at a thickness of 25 mm with a cryostat (CRYOCUT II, American Optical Co, Buffalo, USA). The immunohistochemical methods were performed according to our previous papers [30,33]. Free-floating sections were pretreated with 0.1% H 2 O 2 in PBS for 20 min, and incubated with 2% goat, horse, and rabbit serum in PBS containing 0.3% Triton X-100 (PBST) overnight at 48C. Sections were incubated with a rabbit anti-Fos (sc-52, Santa Cruz Biotechnology, CA, dilution 1:5000), a rabbit anti-Fos (Ab-5, Oncogene Science, dilution 1:3000), a sheep anti-Fos (AB1428, Chemicon, 1:500), a goat anti-FosB (sc-48, Santa Cruz Biotechnology, dilution 1:2000), or a rabbit anti-Fras (sc-253, Santa Cruz Biotechnology, dilution, 1:5000) antibody in PBST containing 0.5% normal serum for 2 days at 48C. The sc-52 and Ab-5 rabbit Fos antibodies were obtained by immunizing N-terminal pep-

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

tides (3–16 and 4–17 amino acids, respectively) of Fos. The AB1428 sheep Fos antibody was made by N-terminal peptides (2–17 amino acids) of Fos. The FosB antibody was raised against 102–117 amino acids of the FosB that is present in all of full-length FosB, DFos, and chronic Fras [15]. The Fras antibody was produced by 128–152 amino acids of highly conserved domain of Fos family proteins. After incubation with the primary antibody, the sections were then incubated with biotinylated goat antirabbit IgG, rabbit anti-sheep IgG, or horse anti-goat IgG (Vector Labs, Burlingame, CA, dilution 1:200) for 2 h, and with ABC elite kit solution (Vector Labs, dilution 1:300) for 2 h. Visualization of antibody was performed with 0.02% 3,39 diaminobenzidine (DAB) and 0.01% H 2 O 2 in 0.05 M Tris–HCl buffer (pH 7.4).

2.4. Quantitative analysis A total of 49 rats were used in the quantitative immunohistochemistry. The sections of the SON were identified according to the rat brain stereotaxic atlas [42]. The sections were viewed with an Olympus BH-2 microscope connected to a Kodak DC120 zoom digital camera. Fospositive nuclei were identified when the structure of the appropriate size and shape demonstrated a clear increase in immunoreactivity compared with the background level according to our previous papers [25,32]. Two to three sections were chosen from each animal for quantitative analysis and their microscopic images were downloaded to a Digital PC computer. Quantitative analysis of the Fospositive cells was performed with Windows software (Win ROOF Ver. 3.13, Mitani, Japan). The numbers of Fospositive cells were expressed as mean number (6S.E.) per section in the SON. The number of Fos-positive cells in each region was compared with a one-way analysis of variance (ANOVA) and Fisher’s test. The null hypothesis was rejected at the 5% level of confidence.

2.5. RT-PCR The brain was removed from decapitated rat and the SON was dissected by razor and fine forceps in ice-cold PBS under a microscope. Total RNA extraction was performed with RNeasy mini kit (QIAGEN K.K., Tokyo, Japan) from the SON of control (n515), and chronically stimulated rats by drinking 2% NaCl solution for 2 days (n515) and 5 days (n515). The mRNA was purified from the above total RNA by using an OligotexE-dT30 ksuperl mRNA purification kit (Takara Biomedical, Tokyo Japan). The cDNA synthesis was performed with a ReverTra Dash RT-PCR kit (TOYOBO, Tokyo, Japan) according to the manufacturer’s recommendations. The RT reaction was performed using the mixtures (20 ml) containing 1 ml of ReverTra Ace reverse transcriptase solution, 2 ml of dNTP mixture (each of 10 mM), 1 ml of Oligo (dT)20 primer (10

41

pmol / ml), 1 ml of RNase inhibitor (10 U / ml), 10 ml of mRNA sample solution, 4 ml of RT buffer, and 1 ml of RNase free H 2 O. The reaction mixture was incubated for 20 min at 428C, 5 min at 998C, and 5 min at 48C. The cDNA were further amplified by using c-fos- or G3PDHspecific primers: c-fos: forward primer; GGTCATCGGGGATCTTGC, reverse primer; GGGCTCTCCTGTCAAC [59]; G3PDH: forward primer; ACCACAGTCCATGCCATCAC, backward primer, TCCACCACCCTGTTGCTGTA. The PCR mixture (100 ml) included 20 ml of the above cDNA mixture, 1 ml each of forward and reverse primers (10 pmol / ml), 1 ml of KOD Dash enzyme solution, 10 ml of PCR buffer, and 67 ml of RNase free H 2 O. PCR for G3PDH was carried out with the following profile: 10 s denaturing at 988C, 2 s annealing at 638C, and 60 s elongation at 748C. PCR for c-fos was performed as follows: 20 s denaturing at 958C, 5 s annealing at 588C, and 30 s elongation at 728C. The amplification products were electrophoretically separated on a 1.75% agarose gel containing 1 mg / ml ethidium bromide, and amplified products were visualized with a UV-transilluminater. Thermal control for cDNA synthesis and PCR reactions were carried out with a programmable thermal cycler (PTC-150, Mj Research, Inc., USA).

3. Results In control rats, no or only a few neurons with nuclei showing Fos labeling were present in the SON using the sc-52 Fos antibody (Fig. 1A). A small number of FosBpositive neurons (Fig. 1D) and numerous Fras-positive neurons (Fig. 1G) were observed in the SON of control rats. A large number of Fos-positive neurons was seen 2 h after the onset of acute osmotic stimulation by i.p. injection of 3% NaCl solution (Fig. 1B). Chronic osmotic stimulation by giving 2% NaCl solution for 5 days also induced a great number of Fos-positive neurons (Fig. 1C). A large number of FosB-positive neurons was observed in the rats treated with acute (Fig. 1E) and chronic osmotic stimulation (Fig. 1F) compared with the control (Fig. 1D). Both acute (Fig. 1H) and chronic osmotic stimulation (Fig. 1I) caused a significant increase in the number of Fraspositive neurons, as the control level of the expression was high (Fig. 1G). Fos-, FosB-, and Fras-positive neurons of chronically stimulated rats were apparently larger in nuclear size compared with 3% NaCl injected rats and control rats. Fos-, FosB-, and Fras-positive neurons in the SON were quantitatively analyzed to examine their differences in number by control, acute, and chronic osmotic stimulation (Fig. 2). Acute stimulation by i.p. injection of 3% NaCl solution caused a significant increase in the number of Fos-positive neurons in the SON, but this expression was transient and thereby the number of Fos-positive neurons

42

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

Fig. 1. Photomicrographs representing the sections immunostained with the sc-52 anti-Fos (A–C), anti-FosB (D–F), and anti-Fras (G–I) antibodies in the SON of the rat hypothalamus. A–C: A few Fos-positive neurons were observed in the control animal (A), while many Fos-positive neurons were seen 2 h after acute osmotic stimulation by i.p. injection of 3% NaCl solution (B) and with chronic osmotic stimulation by 2% NaCl drinking for 5 days (C). D–F: There were several FosB-positive neurons of control animals (D), and the acute (E) and chronic osmotic stimulation (F) induced a large number of FosB-positive neurons. G–I: Many Fras-positive neurons were observed in the control rat (G), and the acute (H) and chronic osmotic stimulation (I) increased the number of Fras-positive neurons. oc, optic chiasma. Scale bar550 mm.

returned to the control level 4 h after the onset of stimulation (Fig. 2A). The number of FosB-positive neurons also increased with acute osmotic stimulation and its level was maintained 8 h after the onset of stimulation. The increase in the number of FosB-positive neurons was lower compared with that of Fos-positive neurons. Similarly, the number of Fras-positive neurons was significantly increased with acute osmotic stimulation and a significant level was retained 8 h after the onset of stimulation. Chronic osmotic stimulation by drinking 2% NaCl solution significantly increased the number of Fos-positive neurons, whereas its number rapidly decreased to reach the control level 2 h after the cessation of chronic osmotic stimulation (Fig. 2B). The number of FosB-positive neu-

rons was also higher during chronic osmotic stimulation compared with the control level. Interestingly, the number of FosB-positive neurons in the rats stimulated for 5 days was significantly higher than that in the animals stimulated for 2 days. The cessation of chronic osmotic stimulation slightly decreased its number and retained relatively higher levels even at 4 and 8 h. The number of Fras-positive neurons was also higher compared with that of control rats during chronic osmotic stimulation. The cessation of chronic osmotic stimulation moderately decreased the number of Fras-positive neurons, but still maintained higher levels at 2, 4, and 8 h. No Fos-positive neurons were seen in the pyriform cortex of control rats (Fig. 3A), whereas numerous FosB-

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

43

chronically stimulated rats for 5 days (Fig. 3D), although control rats had a few neurons with weak Fos immunoreactivity (Fig. 3C). The same result was obtained when the AB1428 Fos antibody was used for immunostaining (data not shown). To examine whether the persistent Fos expression is due to increased levels of c-fos mRNA, we performed the semi-quantitative analysis of c-fos mRNA in the SON using RT-PCR (Fig. 4). We used the same amounts of template RNA and cDNA, and identical PCR cycling parameters to compare between control and chronically stimulated rats (for 2 and 5 days). The low level of c-fos mRNA in the chronically stimulated rats was detected from 22 PCR cycles, whereas that in control rats was observed from 25 PCR cycles. In all three PCR conditions with different cycle numbers, 22, 25, and 28, c-fos mRNA levels expressed in the rats with chronic osmotic stimulation for 2 and 5 days were higher than those found in controls.

4. Discussion

Fig. 2. Time course changes in the expression of Fos-, FosB-, and Fras-positive neurons in the SON after acute osmotic stimulation by i.p. injection of 3% NaCl solution (A), and during and after chronic osmotic stimulation by giving 2% NaCl solution (B). A, The number of Fospositive neurons (d) was increased to peak levels 2 h after i.p. injection and then quickly declined to the control level. The numbers of FosB- (h) and Fras-positive (n) neurons were increased with peak levels 2 h after i.p. injection and their increased numbers were maintained even 4 and 8 h after the onset of stimulation. B, During chronic osmotic stimulation, the numbers of Fos-positive neurons (d) were significantly higher compared with that of control rats. The cessation of chronic stimulation by giving water progressively decreased the number of Fos-positive neurons to reach the control level within 2 h. The numbers of FosB- (h) and Fras-positive (n) neurons were at a significantly higher level compared with that of control during chronic osmotic stimulation. The cessation of chronic osmotic stimulation decreased their numbers but still retained significantly higher numbers even 2–8 h after the cessation. A total of 10 sections from four rats were examined for each time point. Statistically significant if P,0.05 using ANOVA and Fisher’s test. *P,0.05; **P, 0.01.

positive neurons were observed in this area (Fig. 3B). These immunostaining patterns were similar to those previously reported [4]. To confirm the persistent expression of Fos immunoreactivity in the SON during chronic osmotic stimulation, we used two other polyclonal Fos antibodies (Ab-5 and AB1428) in addition to the sc-52 Fos antibody. The Ab-5 Fos antibody also showed numerous neurons with strong immunoreactivity in the SON of

The major finding in the present experiments is the persistent expression of c-fos mRNA and Fos protein in the SON during chronic osmotic stimulation using the quantitative immunohistochemistry and semi-quantitative RT-PCR. It has been suggested that the time course of c-fos mRNA expression is temporal with a half life of 15–30 min and Fos protein has a much longer half-life than the mRNA with detectable levels generally lasting hours [16]. Therefore, it has been generally accepted that the time course of Fos expression presents a transient pattern after the onset of a stimulation. Indeed, many kinds of physiological stimulation have so far been shown to induce a transient Fos expression pattern. However, the present experiments revealed the persistent expression of Fos during chronic stimulation. In addition, the expression of FosB and Fras immunoreactivity lasted for a longer period compared with that of Fos with both acute and chronic osmotic stimulation, suggesting that each Fos family protein has a unique expression pattern of time course. The present study demonstrated the persistent expression of c-fos mRNA and Fos protein in the SON during chronic osmotic stimulation. The experiments were carefully performed and results were confirmed in different ways; First, as for specificity of the antibodies, we used Fos specific antibodies that recognized the N-terminal amino acids of Fos and did not cross-react with any other Fos family proteins [16]. Moreover, the persistent expression of Fos was observed by using three Fos antibodies from different commercial sources. Significant Fos immunoreactivity was not observed in the pyriform cortex, compared with strong FosB immunoreactivity in this region. Therefore, the Fos antibody did not cross-react with Fras. Second, as for the

44

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

Fig. 3. Photomicrographs represent the sections immunostained with the anti-Fos (A, C, and D) antibody, in the pyriform cortex and SON, and the anti-FosB (B) in the pyriform cortex. A, B: In the pyriform cortex of control, only a few Fos-positive neurons were observed using the sc-52 Fos antibody (A) but many FosB-positive neurons were seen (B). C, D: In the SON, a few Fos-positive neurons were observed in the sections of control rats using the Ab-5 Fos antibody (C), while many Fos-positive neurons were seen in the rats that were stimulated by drinking 2% NaCl solution for 5 days (D). oc, optic chiasma. Scale bar550 mm.

Fig. 4. Expression of c-fos and G3PDH mRNA in the SON of control rats and rats with chronic osmotic stimulation for 2 and 5 days. The samples for c-fos mRNA underwent 22, 25, and 28 PCR cycles, and those of G3PDH 20, 25, and 30 PCR cycles. Using specific primers, the amplification products of 450 bp (G3PDH) and 510 bp (c-fos) were obtained. Although 25 PCR cycles were necessary to detect c-fos mRNA of control animals, 22 PCR cycles were enough to detect c-fos mRNA of rats with chronic osmotic stimulation. In the control experiment, the expression levels of G3PDH mRNA were the same between the rats with and without chronic osmotic stimulation.

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

time course of Fos family protein expression, we observed that Fos was transiently expressed in the SON after the onset of i.p. injection of hypertonic saline [32,34], injection of LPS [29], restraint stress [31], and parturition [25]. These results are in good agreement with the general concept that acute stimulation induces a transient Fos expression. The present study further showed that disappearance of Fos immunoreactivity after the cessation of chronic osmotic stimulation was as fast as that seen in the i.p. injected animals. In contrast, the cessation of chronic osmotic stimulation did not rapidly eliminate FosB and Fras immunoreactivity. Finally, in addition to the quantitative Fos immunohistochemistry, we detected the persistent expression of c-fos mRNA in the SON during chronic osmotic stimulation using the semi-quantitative RT-PCR experiment. Taken together, the present observation that c-fos mRNA and Fos protein are constitutively expressed in the SON during chronic osmotic stimulation is the first example to demonstrate the persistent expression of Fos during chronic stimulation. So far, many investigations have been performed on the analyses of Fos expression in the hypothalamic magnocellular neurons of the SON and PVN. Expression of c-fos is induced by acute stimuli such as hemorrhage [44], parturition [12,25,26], noxious stimuli [53], restraint stress [31], LPS-injection [29,45], IL1-b injection [43], and cholecystkinin injection [57]. All these stimulations are shown to induce a transient pattern of Fos expression in the hypothalamic magnocellular neurons. As for osmoregulation, it has also been shown that acute administration of hypertonic saline induces a transient expression of c-fos mRNA and protein [5,27,32,34,48,58]. Chronic osmotic stimulation such as water deprivation and drinking of hypertonic saline has also been shown to increase Fos immunoreactivity [12,32,34,46,48,52]. The expression of Fos-like immunoreactivity during chronic osmotic stimulation has been considered to come from the expression of Fras rather than Fos. However, the present immunohistochemical and RT-PCR experiments demonstrated the persistent expression of Fos during chronic osmotic stimulation. Acute osmotic stimulations are accompanied by a transient increase in plasma osmolarity and AVP level, and a subsequent rise in the mRNAs of AVP, CRF, and nitric oxide synthetase [28,51,55]. Chronic osmotic stimulation is accompanied by daily increases in the plasma osmolarity, AVP and OXT levels, and mRNAs of AVP, OXT, neuropeptide-Y, dynorphin, enkephalin, CRF, SNAP-25, and calmodulin in the SON and PVN [20,23,24,34,41,49]. The daily increase in cell size of AVP and OXT magnocellular neurons is also demonstrated with period of chronic osmotic stimulation [34]. Thus, chronic osmotic stimulation is accompanied by the gradual and daily increases in number of the magnocellular mRNAs with period of chronic osmotic stimulation. Taken together, it is concluded that acute osmotic stimulation induces a transient

45

Fos expression to trigger the temporal increases in numerous other gene mRNAs, whereas chronic osmotic stimulation causes the persistent expression of Fos to activate the gradual increase in many kinds of mRNAs. In the present experiments, a transient expression pattern of Fos in the SON was observed with acute osmotic stimulation, although the expression of FosB and Fras lasted for a longer period. These results coincided well with those obtained by studies with acute stress in the spinal cord with nociception [14], in the hippocampus with bicuculine-induced seizures [13], in all brain areas with water immersion [8] and in the PVN with immobilization stress [17,19,47]. When the same stressor (homotypical) is repeated, and the desensitizing of the ACTH responses to repeated homotypical stimulus is observed in the case of cold exposure and immobilization and preservation of the responses are found with foot shock and hypertonic saline injection [1,3]. The adaptation mechanisms with these homotypical stimuli are likely associated with the activation of the hypothalamic–pituitary–adrenal axis [1]. Interestingly, it is shown that a single stress experience causes long-lasting changes in the steady state of AVP and CRF mRNA expression [2], and that repeated stress diminishes the expression of Fos in the PVN [6,56]. Therefore, acute stress would be accompanied by a transient Fos expression pattern and repeated homotypical stressor diminishes Fos expression because of long-lasting changes in brain mRNAs with single stress. At the present time, expression patterns of Fos family proteins during chronic stimulation are not well understood. Chronic administration of cocaine desensitizes the induction of Fos, FosB, Fra-1, and Fra-2, alternatively it induces DFosB and chronic Fras [18,40,60]. These proteins, which are not induced after acute exposure to cocaine, exhibit prolonged half-lives (more than 7 days) and AP-1 binding levels remain elevated for at least 2 weeks, whereas the persistent expression of both Fos and Fras was observed in the SON during chronic osmotic stimulation. The reasons why the above two chronic stimuli displayed a different pattern of Fos family protein expression are possibly due to the differences of stimuli; a repeated cocaine administration is a homotypical stimulation and the chronic osmotic stimulation is a daily increasing stimulation with period of chronic stimulation. In conclusion, it is probable that Fos expression is necessary for promoting other gene mRNA expression, and alternatively, many Fras are possibly needed for the maintenance of a high level of other gene expression.

Acknowledgements This work was supported in part by grants from the Japan Society for the Promotion of Science (No. 11640663).

46

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

References [1] G. Aguilera, Regulation of pituitary ACTH secretion during chronic stress, Front. Neuroendocrinol. 15 (1994) 321–350. [2] J.M. Aubry, V. Bartanusz, D. Jezova, D. Beling, J.Z. Kiss, Single stress induces long-lasting elevations in vasopressin mRNA levels in CRF hypophysiotrophic neurones, but repeated stress is required to modify AVP immunoreactivity, J. Neuroendocrinol. 11 (1999) 377– 384. [3] S. Bhatnagar, J.B. Mitchell, K. Betito, P. Boksa, M.J. Meaney, Effects of chronic intermittent cold stress on pituitary adrenocortical and sympathetic adrenomedullary functioning, Physiol. Behav. 57 (1995) 633–639. [4] J.R. Brown, H. Ye, R.T. Bronson, P. Dikkes, M.E. Greenberg, A defect in nurturing in mice lacking the immediate-early gene FosB, Cell 86 (1996) 297–309. [5] D.A. Carter, D. Murphy, Regulation of c-fos and c-jun expression in the rat supraoptic nucleus, Cell. Mol. Neurobiol. 10 (1990) 435– 445. [6] X. Chen, J. Herbert, Regional changes in c-fos expression in the basal forebrain and brainstem during adaptation to repeated stress: correlations with cardiovascular, hypothermic and endocrine responses, Neuroscience 64 (1995) 675–685. [7] C.R. Cohen, T. Curran, fra-1 : a serum inducible, cellular immediate-early gene that encodes a Fos-related antigen, Mol. Cell. Biol. 8 (1988) 2063–2069. [8] W.E. Cullinan, J.P. Herman, D.F. Battaglia, H. Akil, S.J. Watson, Pattern and time course of immediate-early gene expression in rat brain following acute stress, Neuroscience 64 (1995) 477–505. [9] E.T. Cunningham, P.E. Sawchenko, Reflex control of magnocellular vasopressin and oxytocin secretion, Trends Neurosci. 14 (1991) 406–411. [10] T. Curran, B.R. Franza Jr, Fos and Jun: AP-1 connection, Cell 55 (1988) 395–397. [11] J.M. Ding, W.C. Carver, L. Terracio, J. Buggy, Proto-oncogene c-fos and the regulation of vasopressin gene expression during dehydration, Mol. Brain Res. 21 (1994) 247–255. [12] V.S. Fenelon, D.A. Poulain, D.T. Theodosis, Oxytocin neuron activation and Fos expression: a quantitative immunocytochemical analysis of the effect of lactation, parturition, osmotic and cardiovascular stimulation, Neuroscience 53 (1993) 77–89. [13] P. Gass, T. Herdegen, R. Bravo, M. Kiessling, Induction of immediate early gene encoded proteins in the rat hippocampus after bicuculine seizures: differential expression of Krox-24, Fos and Jun proteins, Neuroscience 48 (1992) 315–324. [14] T. Herdegen, K. Kovary, J. Leah, R. Bravo, Specific temporal and spatial distribution of Jun, Fos, and KROX-24 proteins in spinal neurons following noxious transsynaptic stimulation, J. Comp. Neurol. 313 (1991) 178–191. [15] N. Hiroi, J.R. Brown, C.N. Haile, H. Ye, M.E. Greenberg, E.J. Nestler, FosB mutant mice: loss of chronic cocaine induction of Fos-related proteins and heightened sensitivity to cocaine’s psychomotor and rewarding effects, Proc. Natl. Acad. Sci. USA 94 (1997) 10397–10402. [16] G.E. Hoffman, A.Z. Murphy, Antomical markers of activity in hypothalamic systems, in: P.M. Conn, M.E. Freeman (Eds.), Neuroendocrinology in Physiology and Medicine, Humana Press, Totowa, NJ, 1999, pp. 541–552. ¨ [17] J. Honkaniemi, J. Kononen, T. Kainu, I. Pyykonen, M. PeltoHuikko, Induction of multiple immediate early genes in rat hypothalamic paraventricular nucleus after stress, Mol. Brain Res. 25 (1994) 234–241. [18] B.T. Hope, H.E. Nye, M.B. Kelz, D.W. Self, M.J. Iadarola, Y. Nakabeppu, R.S. Duman, E.J. Nestler, Induction of a long-lasting AP-1 complex composed of altered Fos-like proteins in brain by chronic cocaine and other chronic treatments, Neuron 13 (1994) 1235–1244.

[19] T. Imaki, T. Shibasaki, M. Hotta, H. Demura, Early induction of c-fos precedes increased expression of corticotropin-releasing factor messenger ribonucleic acid in the paraventricular nucleus after immobilization stress, Endocrinology 131 (1992) 240–246. [20] G. Jacobson, A.J. Bean, B. Meister, Isoform-specific exocytotic protein mRNA expression in hypothalamic magnocellular neurons: regulation after osmotic challenge, Neuroendocrinology 70 (1999) 392–401. [21] M. Lafarga, M.T. Berciano, F.J. Martinez-Guijarro, M.A. Andres, B. Mellstrom, C. Lopez-Garcia, J.R. Naranjo, Fos-like expression and nuclear size in osmotic stimulated supraoptic nucleus neurons, Neuroscience 50 (1992) 867–875. [22] P. Lanaud, R. Maggio, K. Gale, D. Grayson, Temporal and spatial patterns of expression of c-fos, zif / 268, c-jun and junB mRNAs in rat brain following seizures evoked focally from the deep prepiriform cortex, Exp. Neurol. 119 (1993) 20–31. [23] P.J. Larsen, D.S. Jessop, H.S. Choedrey, S.L. Lightman, Neuropeptide Y messenger ribonucleic acid in the magnocellular hypothalamo–neurohypophysial system of the rat is increased during osmotic stimulation, Neurosci. Lett. 138 (1992) 23–26. [24] S.L. Lightman, W.S. Young III, Vasopressin, oxytocin, dynorphin, enkephalin and corticotropin-releasing factor mRNA stimulation in the rat, J. Physiol. 394 (1987) 23–39. [25] S-H. Lin, S. Miyata, W. Matsunaga, T. Kawarabayashi, T. Nakashima, T. Kiyohara, Metabolic mapping of the brain in pregnant, parturient and lactating rats using Fos immunohistochemistry, Brain Res. 787 (1998) 226–236. [26] S.M. Luckman, I. Antonijevic, G. Leng, S. Dye, A.J. Douglas, J.A. Russel, R.J. Bicknell, The maintenance of normal parturition in the rat requires neurohypophysial oxytocin, J. Neuroendocrinol. 5 (1993) 7–12. [27] S.M. Luckman, R.E.J. Dyball, G. Leng, Induction of c-fos expression in hypothalamic magnocellular neurons requires synaptic activation and not simply increased spike activity, J. Neurosci. 14 (1994) 4825–4830. [28] X-M. Ma, G.T. Aguilera, Transcriptional responses of the vasopressin and corticotropin-releasing hormone genes to acute and repeated intraperitoneal hypertonic saline injection in rats, Mol. Brain Res. 68 (1999) 129–140. [29] W. Matsunaga, S. Miyata, R. Takamata, H. Bun, T. Nakashima, T. Kiyohara, LPS-induced Fos expression in oxytocin and vasopressin neurons of the rat hypothalamus, Brain Res. 858 (2000) 9–18. [30] S. Miyata, N. Funatsu, W. Matsunaga, T. Kiyohara, Y. Sokawa, S. Maekawa, Expression of the IgLON cell adhesion molecules Kilon and OBCAM in hypothalamic magnocellular neurons, J. Comp. Neurol. 424 (2000) 74–85. [31] S. Miyata, T. Itoh, S-H. Lin, M. Ishiyama, T. Nakashima, T. Kiyohara, Temporal changes of c-fos expression in oxytocinergic magnocellular neurons of rat the rat hypothalamus with restraint stress, Brain Res. Bull. 37 (1995) 391–395. [32] S. Miyata, W. Matsunaga, H. Mondoh, T. Nakashima, T. Kiyohara, Effect of AV3V lesions on Fos expression and cell size increases in magnocellular neurons of the rat hypothalamus during chronic dehydration, Neurosci. Res. 26 (1996) 149–156. [33] S. Miyata, O. Matsushima, G.I. Hatton, Taurine in rat posterior pituitary; localization in astrocytes and selective release by hypoosmotic stimulation, J. Comp. Neurol. 381 (1997) 513–523. [34] S. Miyata, T. Nakashima, T. Kiyohara, Expression of c-fos immunoreactivity in the hypothalamic magnocellular neurons during chronic osmotic stimulations, Neurosci. Lett. 175 (1994) 63–66. [35] J.I. Morgan, T. Curran, Stimulus-transcription coupling in neurons: role of cellular immediate-early genes, Trends Neurosci. 12 (1989) 459–462. [36] Y. Nakabeppu, D. Nathans, A naturally occurring truncated form of FosB that inhibits Fos / Jun transcriptional activity, Cell 64 (1991) 751–759. ¨ M. Achaval, P. Sassone-Corsi, Molecu[37] J.R. Naranjo, B. Mellstrom,

S. Miyata et al. / Molecular Brain Research 90 (2001) 39 – 47

[38]

[39]

[40]

[41]

[42] [43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

lar pathways of pain: Fos / Jun-mediated activation of a noncanonical AP-1 site in the prodynorphin gene, Neuron 6 (1991) 607–617. H. Nishina, H. Sato, T. Suzuki, M. Sato, H. Iba, Isolation and characterization of Fra-2, an additional member of the fos gene family, Proc. Natl. Acad. Sci. USA 87 (1990) 3619–3623. H.E. Nye, B.T. Hope, M.B. Kelz, M. Iadarola, E.J. Nestler, Pharmacological studies of the regulation of chronic FOS-related antigen induction by cocaine in the striatum and nucleus accumbens, J. Pharmacol. Exp. Ther. 275 (1996) 1671–1680. H.E. Nye, E.J. Nestler, Induction of chronic Fos-related antigens in rat brain by chronic morphine administration, Mol. Pharmacol. 49 (1996) 636–645. A. Palfi, K. Gulya, Water deprivation upregulates the three calmodulin genes in exclusively the supraoptic nucleus of the rat brain, Mol. Brain Res. 74 (1999) 111–116. G. Paxinos, C. Watson, The Rat Brain in Stereotaxic Coordinates, Academic Press, Sydney, 1986. S. Rivest, N. Laflamme, Neuronal activity and neuropeptide gene transcription in the brains of immune-challenged rats, J. Neuroendocrinol. 7 (1995) 501–525. M.M. Roberts, A.G. Robinson, M.D. Fitzsimmons, F. Grant, W-S. Lee, G.E. Hoffman, c-fos expression in vasopressin and oxytocin neurons reveals functional heterogeneity within magnocellular neurons, Neuroendocrinology 57 (1993) 388–400. S.M. Sagar, K.J. Price, N.W. Kasting, F.R. Sharp, Anatomic patterns of Fos immunostaining in rat brain following systemic endotoxin administration, Brain Res. Bull. 36 (1995) 381–392. S.M. Sagar, F.R. Sharp, T. Curran, Expression of c-fos protein in brain: metabolic mapping at the cellular level, Science 240 (1988) 1328–1331. E. Senba, S. Umemoto, Y. Kawai, K. Noguchi, Differential expression of fos family and jun family mRNAs in the hypothalamo– pituitary–adrenal axis after immobilization stress, Mol. Brain Res. 24 (1994) 283–294. F.R. Sharp, S.M. Sagar, K. Hicks, D. Lowenstein, K. Hisanaga, C-fos mRNA, Fos, and Fos-related antigen induction by hypertonic saline and stress, J. Neurosci. 11 (1991) 2321–2331. T.G. Sherman, O. Civelli, J. Douglass, E. Herbert, S. Watson, Coordinate expression of hypothalamic pro-dynorphin and provasopressin mRNAs with osmotic stimulation, Neuroendocrinology 44 (1986) 222–228. P.J. Shiromani, M. Magner, S. Winston, M.E. Charness, Time course

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

47

of phosphorylated CREB and Fos-like immunoreactivity in the hypothalamic supraoptic nucleus after salt loading, Mol. Brain Res. 29 (1995) 163–171. M. Shoji, T. Kimura, Y. Kawarabayashi, K. Ota, M. Inoue, T. Yamamoto, K. Sato, M. Ohta, T. Funyu, T. Sonoyama, K. Abe, Effects of acute salt loading on vasopressin mRNA level in the rat brain, Am. J. Physiol. 266 (1994) R1591–R1595. C.D. Sladek, J.A. Olschowka, Dehydration induces Fos, but not increased vasopressin mRNA in the supraoptic nucleus of aged rats, Brain Res. 652 (1994) 207–215. D.W. Smith, T.A. Day, c-fos expression in hypothalamic neurosecretory and brainstem catecholamine cells following noxious somatic stimuli, Neuroscience 58 (1994) 765–775. D.F. Swaab, F. Nijveldt, C.W. Pool, Distribution of oxytocin and vasopressin in the rat supraoptic and paraventricular nucleus, J. Endocrinol. 67 (1975) 461–467. Y. Ueta, A. Levy, S.L. Lightman, Y. Hara, R. Serino, M. Nomura, I. Shibuya, Y. Hattori, H. Yamashita, Hypovolemia upregulates the expression of neuronal nitric oxide synthase gene in the paraventricular and supraoptic nuclei of rats, Brain Res. 790 (1998) 25–32. S. Umemoto, K. Noguchi, Y. Kawai, E. Senba, Repeated stress reduces the subsequent stress-induced expression of Fos in rat brain, Neurosci. Lett. 167 (1994) 101–104. J.G. Verbalis, E.M. Stricker, A.G. Robinson, G.E. Hoffman, Cholecystokinin activates c-fos expression in hypothalamic oxytocin and corticotropin-releasing hormone neurons, J. Neuroendocrinol. 3 (1991) 205–213. K. Wang, S.E.F. Guldenaar, J.T. McCabe, Fos and Jun expression in rat supraoptic nucleus neurons after acute vs. repeated osmotic stimulation, Brain Res. 746 (1997) 117–125. K. Yang, X.S. Mu, J.J. Xue, J.R. Perez-Polo, R.L. Hayes, Regional and temporal profiles of c-fos and nerve growth factor mRNA expression in rat brain after lateral cortical impact injury, J. Neurosci. Res. 42 (1995) 571–578. S.T. Young, L.J. Porrino, M.J. Iadarola, Cocaine induces striatal c-Fos-immunoreactive proteins via dopaminergic D1 receptors, Proc. Natl. Acad. Sci. USA 88 (1991) 1291–1295. M. Zerial, L. Toschi, R-P. Ryseck, M. Schuermann, R. Muller, R. Bravo, The product of a novel growth factor activated gene, fosB, interacts with JUN proteins enhancing their DNA binding activity, EMBO J. 8 (1989) 805–813.