Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori

Arthropod Structure & Development xxx (2017) 1e11

Contents lists available at ScienceDirect

Arthropod Structure & Development journal homepage: www.elsevier.com/locate/asd

Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori Aurora Montali a, Davide Romanelli a, Silvia Cappellozza b, Annalisa Grimaldi a, Magda de Eguileor a, Gianluca Tettamanti a, * a b

Department of Biotechnology and Life Sciences, University of Insubria, 21100 Varese, Italy CREA e Honey Bee and Silkworm Research Unit, Padua Seat, 35143 Padova, Italy

a r t i c l e i n f o

a b s t r a c t

Article history: Received 10 February 2017 Accepted 19 May 2017 Available online xxx

Over the years, the silkworm, Bombyx mori, has been manipulated by means of chemical and genetic approaches to improve silk production both quantitatively and qualitatively. The silk is produced by the silk gland, which degenerates quickly once the larva has finished spinning the cocoon. Thus, interfering with this degeneration process could help develop new technologies aimed at ameliorating silk yield. To this end, in this work we studied the cell death processes that lead to the demise of the posterior silk gland of B. mori, directing in particular our attention to autophagy and apoptosis. We focused on this portion of the gland because it produces fibroin, the main component of the silk thread. By using multiple markers, we provide a morphological, biochemical and molecular characterization of the apoptotic and autophagic processes and define their timing in this biological setting. Our data demonstrate that the activation of both autophagy and apoptosis is preceded by a transcriptional rise in key regulatory genes. Moreover, while autophagy is maintained active for several days and progressively digests silk gland cells, apoptosis is only switched on at a very late stage of silk gland demise. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Apoptosis Autophagy Bombyx mori Metamorphosis Programmed cell death Silk gland

1. Introduction The silk gland of Bombyx mori is a highly specialized organ that produces the silk cocoon to protect the pupa during metamorphosis. Knowledge of silk gland physiology is of primary importance and represents the starting platform to conceive new technologies for improving silk production and quality. To this aim, numerous attempts have been made in past years to increase the size of the silk gland and/or the duration of the juvenile period (fifth instar). In particular, larval treatments with juvenile hormone (Sehnal and Akai, 1990), juvenile-hormone analogues (Miranda et al., 2002), or insect growth regulators (Leonardi et al., 1996) were used to delay spinning of the cocoon, thus obtaining heavier larvae and increasing silk production. More recently, attention has been focused on transgenic approaches. Ma and colleagues demonstrated that the conditional expression of RAS gene in the

* Corresponding author. Department of Biotechnology and Life Sciences, University of Insubria, Via J. H. Dunant, 3, 21100 Varese, Italy. Fax: þ39 0332 421300. E-mail address: [email protected] (G. Tettamanti).

silk gland increased the size and the yield of silk in the transgenic larvae (Ma et al., 2011). Finally, this organ has been also used to produce recombinant proteins by using tissue-specific promoters (Kojima et al., 2007; Kurihara et al., 2007; Wang et al., 2016). The silk gland is divided into three distinct anatomical regions with different structures and functions, namely, the posterior, medium and anterior silk gland. The posterior silk gland (PSG) secretes fibroin, the main component of the silk thread, that is later coated by sericin in the medium part of the gland (middle silk gland, MSG). The anterior silk gland (ASG) is a duct that allows silk extrusion but does not produce any specific components of the silk filament (Akai, 1983). The silk gland grows slowly during the early larval stage, rapidly increases in weight during the fifth larval instar and, once the cocoon is formed, degenerates (Sehnal and Akai, 1990). The degeneration of larval organs during metamorphosis is a common feature among Lepidoptera. In fact, at this developmental stage, most tissues and organs are deeply remodeled or completely removed to allow the adult structures to form. In this setting, tissue degeneration is accomplished via programmed cell death (PCD) processes that are under hormonal control. In particular, autophagy

http://dx.doi.org/10.1016/j.asd.2017.05.003 1467-8039/© 2017 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

2

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

and apoptosis have been reported to coexist in different tissues of Lepidoptera during metamorphosis (Müller et al., 2004; Tettamanti et al., 2007a,b,2008; Goncu and Parlak, 2008; Goncu and Parlak, 2009; Malagoli et al., 2010; Sumithra et al., 2010; Franzetti et al., 2012; Khoa and Takeda, 2012a,b; Khoa et al., 2012; Tian et al., 2012, 2013; Romanelli et al., 2014, 2016). These studies demonstrated that the timing for the activation of autophagy and apoptosis, as well as their roles, appears to be organ-dependent. Accordingly, while in the midgut autophagy precedes apoptosis by 24e48 h (Romanelli et al., 2016), activation of the two processes is inverted in the fat body so that activation of apoptosis precedes autophagy by 48e72 h (Tian et al., 2012, 2013). In relation to the function, it has been proposed that autophagy promotes lipolysis in the larval fat body during metamorphosis (Tian et al., 2013), while it has a pro-survival role in the larval midgut to provide trophic support to the epithelial cells (Franzetti et al., 2015; Romanelli et al., 2016). Collectively, this evidence corroborates the idea that, while in Drosophila melanogaster autophagy can act as an alternative PCD process (“cell death by autophagy”) (Berry and Baehrecke, 2007), autophagy has never been demonstrated to be directly linked to cell death in Lepidoptera but instead simply accompanies the death process without having an active role in it (“cell death with autophagy”) (Kroemer and Levine, 2008). In addition to the midgut and the fat body, the silk gland of B. mori could help to unravel some key aspects related to the role of autophagy and apoptosis as well as to their relationship in lepidopteran organs. However, our knowledge of these two processes in PSG is still incomplete. In fact, data on apoptosis in this district of the gland are scarce (Kawamoto et al., 2014; Li et al., 2010) and information on autophagy is fragmentary: whereas early studies in the 1960s and the 1970s focused on the cytolytic processes that intervene in this organ during metamorphosis (Matsuura et al., 1968, 1976; Tashiro et al., 1976), describing the appearance of various types of autophagic compartments and increasing lysosomal activity in silk gland cells of larvae approaching metamorphosis, the involvement of chaperonmediated autophagy was proposed more recently (Shiba et al., 2016). To extend our understanding, we performed a morphofunctional characterization of the changes that occur in PSG from larval to pupal stage: by using different morphological and molecular means, as suggested by the current guidelines in the field, we provide undisputed evidence for macroautophagy (hereafter termed autophagy) and apoptosis, and unravel their temporal occurrence. Moreover, we analyzed some aspects related to the metabolism of the gland during degeneration. This work not only provides a detailed characterization of the autophagic and apoptotic processes in PSG, but also sets the stage for future functional studies on cell death in this organ by means of hormones, chemicals, or genetic tools.

2.2. Light microscopy and transmission electron microscopy (TEM) After dissection, PSG were immediately immersed in the fixing solution (4% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.4) and stored overnight at 4  C. Samples were then postfixed in 1% osmium tetroxide solution for 1 h at room temperature. Specimens were dehydrated in cold ethanol (70%, 90%, and pure ethanol, 30 min each), embedded in an Epon/Araldite 812 mixture, and incubated overnight at 70  C for resin polymerization. Semi-thin (0.75-mm) and thin (70-nm) sections were obtained with a Leica Reichert Ultracut S (Leica, Nussolch, Germany). Semi-thin sections were stained with basic fuchsin and crystal violet and then observed with an Eclipse Ni-U microscope (Nikon, Tokyo, Japan) equipped with a digital camera (Nikon DS-5M-L1). Thin sections were stained with lead citrate and uranyl acetate and observed with a JEM-1010 transmission electron microscope (Jeol, Tokyo, Japan). TEM images were acquired with a Morada digital camera (Olympus). 2.3. Histochemistry Dissected PSG were immediately embedded in polyfreeze cryostat embedding medium and stored at 80  C until use. The 8to 10-mm-thick cryosections were obtained with a Leica CM 1850 cryostat, and slides were stored at 20  C. Bio-Optica Histopatological kit (Bio-Optica, Milano, Italy) was used to localize NADHdehydrogenase (NADH-TR) activity in the silk gland. To detect acid phosphatase activity, cryosections were incubated for 90 min at 37  C in a 0.1 M sodium acetateeacetic acid buffer pH 5.2, containing 0.01% naphthol phosphate AS-BI (SigmaeAldrich, St. Louis, USA), 2% N-N-dimethylformamide, 0.06% fast red violet LB (SigmaeAldrich) and 0.5 mM MnCl2. Lipids were evidenced by incubating the cryosections with Baker's fixative (5% formaldehyde, 0.32 M saccarose, 0.15 M sodium cacodylate, 90 mM CaCl2) for 10 min and subsequently in Oil Red O (O.R.O.) solution (Bio-Optica) for 15 min. For Periodic Acid-Schiff (PAS) reaction, PSG were isolated and immersed in a solution containing 4% paraformaldehyde for 3 h at room temperature. Samples were dehydrated in cold ethanol (70%, 90%, and pure ethanol, 2 h each) and then embedded in paraffin. Sections (8- to 10-mm-thick) obtained with a Jung Multicut 2045 microtome (Leica) were deparaffinized with xylene and rehydrated in 100%, 96%, 90%, 70%, and 30% ethanol (5 min each) at room temperature. They were then processed for Periodic acid-Schiff (PAS) staining in combination with diastase (PAS-D), which breaks down glycogen, according to the manufacturer's instructions (Bio-Optica Histopathological kit). Slides were examined with a Nikon Ni-U microscope equipped with a digital camera system. 2.4. Morphometric analysis

2. Materials and methods 2.1. Experimental animals B. mori four-way polyhybrid strain (126  57) (70  90) larvae were provided by CREA - Honey Bee and Silkworm Research Unit (Padova, Italy). The larvae were maintained at 25 ± 0.5  C, 70% relative humidity, under a 12:12-h light:dark period and fed on artificial diet as described by Cappellozza et al. (2005). Fifth instar larvae were staged and synchronized according to the morphological and behavioral features reported in Table 1. Silkworms were anesthetized with CO2 prior to dissecting the larva and isolating PSG. In each experiment, PSG isolated from at least three larvae were examined, unless otherwise specified.

The diameter of the gland at each developmental stage was estimated by measuring three cross-sections per gland, collected from three larvae. For each gland section, eight line segments, each corresponding to a diameter of the PSG, were randomly selected and their length was measured by using ImageJ software (NIH, Bethesda, USA). The method reported in Gundersen et al. (1988) was used to evaluate the nucleus-to-cytoplasm ratio (N:C). Briefly, a grid (spacing of points 8.6 mm) was randomly placed on optical microscope images of silk gland cross-section (50 magnification). Nine images in total (three larvae; three sections per gland) were evaluated for each developmental stage. The sections were at a minimum distance of 50 mm from each other, to avoid counting the

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

3

Table 1 Definition and description of the developmental stages of the silkworm used in this study.

Last larval instar Wandering-prepupal phase

Pupal stage

Stage

Definition

Morphological and behavioral features

L5D5 W

Fifth larval instar day 5 (0e24 h) Wandering stage (0e24 h)

SD1 SD2 PP P1-0 P1-12

Spinning stage day 1 (24e48 h) Spinning stage day 2 (48e72 h) Prepupal stage (72e96 h) Pupal day 1 (0e2 h) Pupal day 1 (10e12 h)

The larva actively feeds The larva stops feeding; spinneret pigmentation and gut purging occurs The larva starts spinning the cocoon Cocoon spinning is completed The transition from larva to pupa occurs Early pupa

same cells twice. For each section the number of points falling on nucleus or cytoplasm was counted and the ratio was calculated. 2.5. Immunohistochemistry Paraffin sections were obtained as described above ( Section 2.3). After xylene treatment to remove paraffin, sections were rehydrated in 100%, 96%, 90%, 70%, and 30% ethanol (5 min each) at room temperature. They were immersed in 10 mM sodium citrate buffer (pH 6.0) for 13 min in a microwave oven for antigen retrieval and subsequently treated with 3% H2O2 for 1 min to inhibit endogenous peroxidases. Sections were incubated for 30 min with a blocking solution (2% BSA, 0.01% Tween 20 in PBS) and, subsequently, with an anti-Gabarap/BmAtg8 antibody (dilution 1:100; Abcam, Cambridge, UK) for 2 h at room temperature. Specimens were then washed and incubated with an anti-rabbit HRP-conjugated secondary antibody (dilution 1:200; Jackson Immuno Research Laboratories, West Grove, PA, USA) for 1 h at room temperature. Nuclei were revealed by DAPI staining. Localization of secondary antibody was detected by using the HRP substrate 3,30 Diaminobenzidine (DAB, SigmaeAldrich). Specimens were examined with a Nikon Ni-U microscope. 2.6. qRT-PCR PSG were dissected on ice, cleansed of residues of tracheae and fat body, frozen in liquid nitrogen, and stored at 80  C. RNA was extracted from 30 to 50 mg of tissue with Trizol Reagent (Life Technologies, Carlsbad, CA, USA). TURBO DNA-free Kit (Life Technologies) was used to remove genomic DNA contamination. RNA quality was assessed through gel electrophoresis. Retrotranscription was performed with M-MLV reverse transcriptase (Life Technologies). Primers used for qRT-PCR are listed in Table 2. BmRP49, whose expression is reported to be stable during metamorphosis in the silkworm (Tian et al., 2013; Romanelli et al., 2016), was selected as the housekeeping gene to calculate the relative expression of the genes of interest. Real-Time PCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) and a CFX Connect Real-Time PCR Detection System (Bio-

Table 2 Sequence of primers used in this study. Gene name

Accession number

Primer sequences

BmATG1

NM_001309546.1

BmATG8

NM_001046779.1

BmCASPASE-1

NM_001043585

BmCASPASE-5

NM_001195467.1

BmRP49

NM_001098282.1

F: CCCCGCCTATGTCTATGTTG R: ATCTGATGGGTGGGAGTACG F: CCAGATCGCGTTCCTGTAAT R: GAGACCCCATTGTTGCAGAT F: GCCTGTCGAAAGATACGCTC R: CACAGCAACCAGCAGACAAT F: TCGCCATCCCGTGCTTTC R: GTTGACCCCGTCCCTGTTG F: AGGCATCAATCGGATCGCTATG R: TTGTGAACTAGGACCTTACGGAATC

Rad). Relative expression of the genes was calculated with the 2DDCt method. The efficiency of the amplification reactions of each gene was adjusted to be in the range of 90e105%. Each value was the result of experiments performed on five series of samples. Statistical analysis was performed using ANOVA followed by Tukey's HSD test. 2.7. Western blot analysis PSG were dissected and stored as described above (Section 2.6). Tissue samples (15e30 mg) were homogenized with a T10 basic ULTRA-TURRAX (IKA, Staufen, Germany) in 5 ml RIPA buffer (150 mM NaCl, 2% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris, pH 8.0) per milligram of tissue. Protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA, USA) and phosphatase inhibitors (5 mM sodium fluoride; 1 mM sodium orthovanadate) were added to RIPA buffer just prior to use. The tissue homogenates were cleared by centrifugation (15,000  g for 15 min at 4  C) and final protein concentration was determined using the Bradford assay (Bradford, 1976). Proteins were denatured by heating at 98  C for 5 min. For SDS-PAGE 40 mg of protein per lane were loaded on a 12% Tris-glycine gel. The proteins were then transferred to a 0.45-mm PVDF membrane (Merck Millipore, Billerica, MA, USA). After saturation for 1 h at room temperature with a blocking solution (5% milk), the membranes were incubated for 2 h at room temperature with anti-Gabarap/BmAtg8 antibody (Abcam) diluted 1:3000. An anti-rabbit HRP-conjugated secondary antibody (Jackson Immuno Research Laboratory) diluted 1:7500 was used to reveal antigens. Immunoreactivity was detected using LiteAblot Plus ECL (Euroclone, Pero, Italy). An anti-GAPDH antibody (Proteintech, Rosemont, IL, USA) diluted 1:2500 was used to detect the housekeeping protein. 2.8. Cellular and biochemical assays PSG were dissected and stored as previously described (Section 2.6). Samples were homogenized in 5 ml/mg tissue of extraction buffer (100 mM mannitol, 10 mM HEPES-Tris, pH 7.2). A protease inhibitor cocktail (Thermo Fisher Scientific) was added to the buffer prior to use. Homo-genates were clarified by centrifugation (15,000  g for 15 min at 4  C). The protein concentration was determined using the Bradford method (Bradford, 1976). Homogenates were used for the following three assays. 2.8.1. Acid phosphatase activity assay Acid phosphatase activity was assayed by incubating the homogenates for 30 min at 25  C in 7.6 mM 4-nitrophenyl phosphate in citrate buffer (45.9 mM, pH 4.9) (Moss, 1983). The reaction was blocked by adding 0.1 M NaOH. Absorbance at 405 nm was measured using a Tecan Infinite F200 96-well microplate reader €nnedorf, Switzerland). Each value was the result of (Tecan, Ma

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

4

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

measurements performed on three series of PSG. ANOVA followed by Tukey's HSD test was used for statistical analysis.

performed on three series of PSG. Statistical analysis was performed using ANOVA followed by Tukey's HSD test.

2.8.2. Evaluation of ATP content Protein concentration was adjusted to 1 mg/ml with homogenization buffer. ATP levels were quantified by using the ATP Bioluminescence Assay Kit (Roche, Mannheim, Germany), following the manufacturer's instructions. Briefly, 12.5 mg cytosolic protein, 12.5 ml of extraction buffer and 25 ml of reagents were added to a white-walled, 96-well plate and the light signal was immediately read with a Tecan microplate reader. Each experiment was performed at least in triplicate on PSG samples from five series of animals. Statistical analysis was performed using ANOVA followed by Tukey's HSD test.

2.9. DNA fragmentation analysis PSG were dissected and stored as described above (Section 2.6). Genomic DNA was extracted from 15 mg of PSG tissue using the PureLink Genomic DNA kit (Life Technologies) according to the manufacturer's instructions. After spectrophotometric quantification, 200 ng of genomic DNA were loaded on 1% agarose gel to which ethidium bromide was added for DNA staining. Electrophoresis was performed at 100 V for about 45 min and the gel was then observed with a UV transilluminator. 3. Results

2.8.3. Effector caspase activity assay Homogenates were diluted to 1 mg/ml with extraction buffer. Caspase activity was determined with the Caspase-Glo 3/7 kit (Promega, Madison, WI, USA) according to the manufacturer's instructions. The reaction was set up using 10 mg of protein, 40 ml of extraction buffer and 50 ml of substrate. After incubation at 25  C for 30 min the luminescence emitted was measured with a Tecan microplate reader. Each value was the result of experiments

3.1. Morphofunctional analysis of silk gland degeneration during larva-pupa transition 3.1.1. Morphological study of PSG modifications To evaluate the changes that occur in PSG during larva-pupa transition, until complete degeneration, we performed a morphological analysis of PSG from larval to early pupa stage by light

Fig. 1. Degeneration of PSG during larva-pupa transition. (aen) Semithin cross-sections of PSG at L5D5 (a, b), W (c, d), SD1 (e, f), SD2 (g, h), PP (i, j), P1-0 (k, l), and P1-12 (m, n) stage. (o) Mean diameter of PSG from L5D5 to P1-12, showing a strong reduction in size of the gland after SD2 stage. (p) The measurement of the nucleus-to-cytoplasm ratio in PSG cells at L5D5, SD2 and P1-0 stage shows a significant reduction of the cytoplasm. Statistically significant differences are denoted with different letters (p < 0.05). L: lumen; E: epithelium; arrowheads: nuclei; arrows: invaginations of the basal lamina.

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

5

Fig. 2. Ultrastructural analysis of PSG. (aed) TEM images of the nuclei in the PSG cells at L5D5 (a), PP (b), P1-0 (c), and P1-12 (d) stage show a gradual condensation of the chromatin. (eeg) TEM images of the basal region of the PSG epithelium at L5D5 (e), SD1 (f), and P1-0 (g) demonstrate the maintenance of the ultrastructure of the basal lamina during PSG degeneration. (a′) is a detail at higher magnification of (a). N: nucleus; E: epithelial cells; BL: basal lamina; arrowheads: fibroin globules; arrows: RER.

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

6

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

Fig. 3. Metabolic activity of PSG. (aec) NADH-TR staining for mitochondrial activity at L5D5 (a), SD2 (b), and P1-0 (c) stage demonstrates the presence of high metabolic activity in the epithelium during the degeneration process. (def) O.R.O. staining at L5D5 (d), SD2 (e), and P1-0 (f) stage shows the absence of lipid droplets in the gland cells. (gei) PAS staining of L5D5 (g), SD2 (h), and P1-0 (i) stage shows the depletion of glycogen stores (arrowheads) in the gland epithelium during the spinning stage; glycogen deposits disappear after the treatment with diastase (g′). (j) Amount of ATP in PSG cells does not significantly change during larval and spinning stage; a decrease is observed only after prepupal stage. Different letters indicate significant differences among stages (p < 0.05). L: lumen; E: epithelium.

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

(Fig. 1) and electron (Fig. 2) microscopy. During the last day of the fifth larval instar (L5D5) the PSG showed a roundish cross-section (mean diameter: 765 mm) (Fig. 1a,o). A monolayered epithelium, formed by secretory cells with irregular-shaped nuclei, surrounded the lumen (Fig. 1a,b). TEM analysis showed the presence of abundant rough endoplasmic reticulum and fibroin globules in the cytoplasm of the epithelial cells (Fig. 2a,a0 ). At W (Fig. 1c,d) and SD1 (Fig. 1e,f) stage, during cocoon spinning, the overall structure of this organ appeared similar to that of the larval one. Starting from SD2 stage the morphology of the silk gland changed (Fig. 1g,h): small invaginations of the basal lamina (BL) (Fig. 1h) and an increase in the N:C ratio (Fig. 1p) were observed. At PP stage, the diameter of PSG was significantly reduced (Fig. 1i,o) and the gland cross-section showed an irregular profile with marked invaginations of the BL (Fig. 1j). At subsequent stages (P1-0 and P1-12), the morphological changes were even more pronounced. At P1-0, the gland showed a highly irregular crosssection (Fig. 1k,l), the diameter was reduced to one-fourth of that in the larval stage (Fig. 1k,o), and the cells underwent a further increase in the N:C ratio (Fig. 1p). During P1-12 stage the lumen border could not be detected, the cytoplasm appeared extremely disorganized, and condensed nuclei were visible (Fig. 1m,n). TEM analysis clearly demonstrated the gradual condensation of the chromatin during prepupal (Fig. 2b) and P1-0 (Fig. 2c) stage, while at P1-12 stage almost all nuclei were highly condensed and fragmented (Fig. 2d). Conversely, no substantial alteration of the ultrastructure of the basal lamina could be observed during the whole process of PSG degradation (Fig. 2eeg). PSG degeneration completed at P1-12 stage and no PSG remnants could be identified in the hemocoel at P2 stage. 3.1.2. Metabolic characterization of the PSG Since the PSG structure was modified during larval-pupal transition, a developmental phase when the larva does not feed, we evaluated three aspects related to the metabolism of the gland, i.e., mitochondrial activity, long-term energy storage nutrients, and ATP production. The activity of the mitochondrial enzyme NADHdehydrogenase could be detected in silk gland cells at all the analyzed stages (Fig. 3aec), indicating that a high metabolic activity was retained in the tissue during the degeneration process. The distribution of glycogen and lipids was evaluated to assess longterm energy storage molecules. No lipid droplets were observed in the PSG tissue at any of the analyzed stages (Fig. 3def). Conversely, PAS staining demonstrated the presence of glycogen deposits in the gland epithelium at L5D5 (Fig. 3g). Specificity of the PAS reaction towards glycogen was confirmed by treatment with diastase (Fig. 3g0 ). During the spinning stage the amount of PASpositive granules quickly decreased (Fig. 3h) and no glycogen deposits could be observed after SD2 (Fig. 3i). High levels of ATP in PSG cells were measured from L5D5 to PP stage, while a decrease was observed at P1-0 (Fig. 3j). 3.2. Analysis of cell death-related processes involved in the degeneration of PSG To obtain a detailed characterization of the cell death processes that intervene during the removal of the PSG and to gain insights into the timings of their occurrence, we used different markers specific for autophagy and apoptosis. 3.2.1. Autophagy We first evaluated the levels of expression of two ATG (autophagy-related) genes from L5D5 to P1-0: i) BmATG1, that codes for an autophagy-regulating factor, responsible for autophagosome biogenesis; and ii) BmATG8, that codes for a protein specifically

7

linked to the autophagosome membrane. The expression pattern of the two genes was similar, with a significant increase in mRNA levels from SD1-SD2 stage (Fig. 4a,b). These results demonstrated that transcriptional activation of ATG genes started at the spinning stage. To confirm the activation of autophagy, we analyzed the expression of the protein BmAtg8-PE, by using a commercial antiGabarap antibody able to recognize both the unmodified and lipidated BmAtg8 protein (Romanelli et al., 2016). BmAtg8-PE levels increased significantly during the spinning stage and peaked at SD2 (Fig. 4c). Moreover, at PP and P1-0 stage, BmAtg8-PE levels remained higher than at larval stage (Fig. 4c) indicating that autophagy was active until the late phase of PSG degeneration. Immunostaining of BmAtg8 showed a scattered signal in the cytoplasm of PSG cells during L5D5, while BmAtg8 was mainly localized in puncta during SD2 and P1-0, confirming the presence of autophagosomes in the silk gland at these stages (Fig. 4def). This result was corroborated by TEM analysis that showed the presence of autophagosomes in the PSG tissues of larvae at spinning stage (Fig. 4g,h). We also measured the activity of acid phosphatase by spectrophotometric (Fig. 4i) and histochemical (Fig. 4jel) assays. Since the lysosomal pathway is activated concomitantly with autophagy in most biological settings, this enzyme is often used as an indirect autophagic marker. Our analysis showed an increased activity for acid phosphatase from spinning stage onwards (Fig. 4iel). These data demonstrate that autophagy is switched on at spinning stage and is maintained active until the first day of the pupal stage. 3.2.2. Apoptosis Since we observed the presence of condensed and fragmented nuclei during the late stage of the gland degradation (P1-0/12) (Fig. 2c,d), we verified the occurrence of apoptosis in PSG cells. As for autophagy, we first measured the expression levels of two apoptotic genes: i) BmCASPASE-5, which codes for an initiator caspase homologue of Drosophila Dronc (Courtiade et al., 2011) that is involved in developmental apoptosis (Cakouros et al., 2004; Daish et al., 2004); and ii) BmCASPASE-1, which is considered the main effector caspase in Lepidoptera and codes for a homologue of the Drosophila proteins Drice and Dcp-1 (Courtiade et al., 2011). The levels of expression of the two genes showed a similar pattern with a significant increase starting from SD2 and a maximum during P1-0 stage (Fig. 5a,b). These data confirmed the occurrence of strong transcriptional activation of apoptotic factors in the PSG during degeneration. The levels of effector caspase activity were very low until the pre-pupal stage, but strikingly increased at P1 stage (Fig. 5c), thus confirming the activation of apoptosis. Moreover, DNA ladder analysis showed a significant DNA degradation only at late stage of silk gland degeneration (P1-12) (Fig. 5d), concomitantly with caspase activation and nuclear condensation. From these data we can conclude that the onset of apoptosis occurs at a very late stage of silk gland degeneration. Summarizing, autophagy is activated during the spinning stage and remains active during the subsequent developmental phases, while apoptosis is activated at early pupa stage, just before the PSG has completely degenerated. 4. Discussion During the metamorphosis of holometabolous insects, larval organs are consistently remodeled through tissue degeneration and regeneration. This complex series of events is needed in order for the adult structures to develop. In B. mori the processes that lead to the demise of the larval tissues have been studied in different

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

8

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

9

Fig. 5. Apoptosis is activated at the end of PSG degeneration. (a, b) qRT-PCR analysis of BmCASPASE-5 (a) and BmCASPASE-1 (b) mRNA levels. (c) Measurement of effector caspase activity indicates that apoptosis is activated only at pupal stage. (d) Ladder analysis of genomic DNA from PSG cells at L5D5, SD2, and P1-12 stage. Values represent mean ± s.e.m. Different letters indicate significant differences among stages (p < 0.05).

organs as the fat body, the midgut, and the silk gland (Matsuura et al., 1968; Goncu and Parlak, 2008; Tettamanti et al., 2011; Tian et al., 2012, 2013; Romanelli et al., 2016). However, these mechanisms have tissue-specific features (Khoa and Takeda, 2012b; Romanelli et al., 2014; Romanelli et al., 2016; Tian et al., 2013): thus, additional knowledge about these or other larval organs is of paramount importance. The major aim of the present study was to extend the information on the morphofunctional modifications of silkworm PSG during larva-pupa transition and to investigate the timing of the apoptotic and autophagic processes that intervene during degeneration of this portion of the silk gland. Our analysis showed that the morphology of the PSG changes starting from the end of the spinning stage. The degeneration process, which involves a strong reduction in size of the gland, is completed at the beginning of the pupal stage and PSG cannot be identified at later stages (P2 stage onwards). This is in accordance with data reported by Kawamoto et al. (2014) and Shiba et al. (2016). Loss of cell organization, presence of condensed and fragmented nuclei, and alteration of N:C ratio are all features typical of PCDrelated processes. We focused our attention on apoptosis and autophagy as both widely occur in larval organs of Lepidoptera (Müller et al., 2004; Tettamanti et al., 2007a; Goncu and Parlak,

2008; Goncu and Parlak, 2009; Sumithra et al., 2010; Franzetti et al., 2012; Khoa and Takeda, 2012b; Khoa et al., 2012; Tian et al., 2012, 2013) and Drosophila (Berry and Baehrecke, 2007; Denton et al., 2009; Zirin et al., 2013) during metamorphosis. To analyze the timing of autophagy and apoptosis activation, different direct and indirect markers were used, as recommended by the most recent guidelines (Galluzzi et al., 2012; Klionsky et al., 2016). We demonstrated that transcription of ATG genes is activated at the spinning stage (SD1-SD2) and high mRNA levels can be detected until the early pupa stage. Autophagy is activated concomitantly with the onset of the transcriptional rise (SD1), with higher levels at SD2 stage, as shown by Atg8-PE protein expression. This marker, as well as acid phosphatase activity, confirm that autophagy is maintained active until the end of the gland degeneration. The onset of autophagy at the beginning of metamorphosis was observed in other silkworm tissues, such as the fat body and the midgut. This event was linked to the physiological rise in 20hydroxyecdysone (20E) titer in the hemocoel of the larva (Tian et al., 2013; Romanelli et al., 2016) and it is likely that a similar regulation affects PSG. On the other hand, autophagy is maintained active throughout the PSG degeneration process, differently from what has been reported in the midgut (Romanelli et al., 2016), probably due to a differential regulation of this process or, more likely, to its role in this organ. In this regard, our analysis

Fig. 4. Autophagy is activated during the degeneration of PSG. (a, b) qRT-PCR analysis of BmATG1 (a) and BmATG8 (b) mRNA levels. (c) Western blot analysis of BmAtg8ePE protein shows the activation of autophagy in the PSG epithelium from the spinning stage. (def) Immunohistochemistry of BmAtg8 in PSG epithelium at L5D5 (d), SD2 (e), and P1-0 (f) stage: positive puncta in the cytoplasm occur concomitantly with the activation of autophagy (eef). (g, h) TEM images of autophagosomes (arrowheads) at SD2 stage; the double limiting membrane is clearly visible in (h). (iel) Spectrophotometric (i) and histochemical (j-l) analysis of acid phosphatase activity in the PSG. (e′) is a detail at higher magnification of (e). E: epithelium; L: lumen. Values represent mean ± s.e.m. Different letters indicate significant differences among stages (p < 0.05).

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

10

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11

demonstrates three aspects that are worthy of consideration: i) a progressive decrease in cytoplasmic volume of PSG cells is observed concomitantly with autophagy occurrence; ii) PSG cells remain metabolically active during the degeneration process; and iii) autophagy is activated concomitantly with the depletion of glycogen stores. We thus hypothesize that mobilization of the glycogen stores and consistent degradation of cytoplasmic components by autophagy are necessary to produce the energy the gland cells need to stay alive during the spinning process. This hypothesis is supported by the fact that high ATP levels are maintained in PSG cells throughout the whole spinning phase, although the larva has been dealing with nutrient starvation since wandering stage, and decrease only after spinning activity is completed. Interestingly, PSG cannot cope with prolonged starvation by exclusively relying on the mobilization of long-term energy storage nutrients, as occurs in other silkworm midgut subjected to short starvation periods (Franzetti et al., 2016): for this reason, autophagy is activated in PSG to support the high metabolic demand of the cells. Thus, in this context, autophagy likely consumes cytoplasmic components to temporarily restore cellular nutrient and energy balance. Concerning apoptosis, we showed that the timing of the transcriptional activation of apoptotic genes is similar to that of ATG genes: the transcription of caspases is upregulated starting from the spinning stage and their expression levels remain high until the pupal stage. On the other hand, neither activation of caspases nor DNA degradation was observed before the pupal stage. Apoptosis intervenes only once the PSG volume is drastically reduced and, once activated, PSG completely disappears. Interestingly, a delay between caspase transcription and activation has already been reported during the metamorphic degeneration of the silkworm midgut (Romanelli et al., 2016). In that case, it was demonstrated that inactive caspases are stored in the cytoplasm and their activation is triggered by the pupal 20E increase. Although Li's (2010) demonstration that BmEcR expression in PSG increases during larva-pupa transition suggests that apoptosis could be regulated in this tissue as in the midgut, further studies are needed to confirm this hypothesis. In conclusion, our data demonstrate that: i) both autophagy and apoptosis are triggered during the developmental degeneration of PSG. We showed that autophagy is activated before apoptosis, according to Li's hypothesis (Li et al., 2010), and similarly to what has been described in the midgut of the silkworm (Franzetti et al., 2012; Romanelli et al., 2016). In contrast, apoptosis is reported to precede autophagy in the fat body of the silkworm (Tian et al., 2012, 2013). Our results thus reinforce the hypothesis that both the sequence and the timing of activation of autophagy and apoptosis are context-dependent and strictly linked to their role in each setting; ii) the mobilization of glycogen reserves and the cytoplasmic degradation of PGS cells by autophagy are needed to produce ATP in the silk gland until cocoon spinning is completed, thus keeping the gland cells alive; and iii) apoptosis is activated at a later stage, once the cocoon has been formed and the gland is no longer useful to the larva, and leads cells to death. Conversely to the larval midgut, where the apoptotic process is completed by secondary necrosis (Franzetti et al., 2015), the apoptotic bodies generated by the death of PSG cells are likely removed by phagocytes in the larval hemocoel. Acknowledgements The authors wish to thank Dr. Eleonora Franzetti and Dr. Barbara Casati who participated in early experiments. We thank Sherryl Sundell for English editing. This work was partially supported by FAR 2015 (University of Insubria) to GT.

References Akai, H., 1983. The structure and ultrastructure of the silk gland. Experientia 39, 443e449. Berry, D.L., Baehrecke, E.H., 2007. Growth arrest and autophagy are required for salivary gland cell degradation in Drosophila. Cell 131, 1137e1148. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 7, 248e254. Cakouros, D., Daish, T.J., Kumar, S., 2004. Ecdysone receptor directly binds the promoter of the Drosophila caspase dronc, regulating its expression in specific tissues. J. Cell Biol. 165, 631e640. Cappellozza, L., Cappellozza, S., Saviane, A., Sbrenna, G., 2005. Artificial diet rearing system for the silkworm Bombyx mori (Lepidoptera: Bombycidae): effect of vitamin C deprivation on larval growth and cocoon production. Appl. Entomol. Zool. 40, 405e412. Courtiade, J., Pauchet, Y., Vogel, H., Heckel, D.G., 2011. A comprehensive characterization of the caspase gene family in insects from the order Lepidoptera. BMC Genom. 12, 357. Daish, T.J., Mills, K., Kumar, S., 2004. Drosophila caspase DRONC is required for specific developmental cell death pathways and stress-induced apoptosis. Dev. Cell 7, 909e915. Denton, D., Shravage, B., Simin, R., Mills, K., Berry, D.L., Baehrecke, E.H., Kumar, S., 2009. Autophagy, not apoptosis, is essential for midgut cell death in Drosophila. Curr. Biol. 19, 1741e1746. Franzetti, E., Casartelli, M., D'Antona, P., Montali, A., Romanelli, D., Cappellozza, S., Caccia, S., Grimaldi, A., de Eguileor, M., Tettamanti, G., 2016. Midgut epithelium in molting silkworm: a fine balance among cell growth, differentiation, and survival. Arthropod Struct. Dev. 45, 368e379. Franzetti, E., Huang, Z.J., Shi, Y.X., Xie, K., Deng, X.J., Li, J.P., Li, Q.R., Yang, W.Y., Zeng, W.N., Casartelli, M., Deng, H.M., Cappellozza, S., Grimaldi, A., Xia, Q., Feng, Q., Cao, Y., Tettamanti, G., 2012. Autophagy precedes apoptosis during the remodeling of silkworm larval midgut. Apoptosis 17, 305e324. Franzetti, E., Romanelli, D., Caccia, S., Cappellozza, S., Congiu, T., Rajagopalan, M., Grimaldi, A., de Eguileor, M., Casartelli, M., Tettamanti, G., 2015. The midgut of the silkmoth Bombyx mori is able to recycle molecules derived from degeneration of the larval midgut epithelium. Cell Tissue Res. 361, 509e528. Galluzzi, L., Vitale, I., Abrams, J.M., et al., 2012. Molecular definitions of cell death subroutines: recommendations of the nomenclature committee on cell death. Cell Death Differ. 19, 107e120. Goncu, E., Parlak, O., 2008. Some autophagic and apoptotic features of programmed cell death in the anterior silk glands of the silkworm, Bombyx mori. Autophagy 4, 1069e1072. Goncu, E., Parlak, O., 2009. Morphological changes and patterns of ecdysone receptor B1 immunolocalization in the anterior silk gland undergoing programmed cell death in the silkworm, Bombyx mori. Acta Histochem. 111, 25e34. Gundersen, H.J., Bendtsen, T.F., Korbo, L., Marcussen, N., Møller, A., Nielsen, K., Nyengaard, J.R., Pakkenberg, B., Sørensen, F.B., Vesterby, A., et al., 1988. Some new, simple and efficient stereological methods and their use in pathological research and diagnosis. APMIS 96, 379e394. Kawamoto, K., Kawamoto, T., Shiba, H., Hosono, K., 2014. A histochemical study of the posterior silk glands of Bombyx mori during metamorphosis from larvae to pupae using frozen sections. Biotech. Histochem. 89, 145e152. Khoa, D.B., Takeda, M., 2012a. Expression analysis of inhibitor of apoptosis and related caspases in the midgut and silk gland of the greater wax moth, Galleria mellonella, during metamorphosis and under starvation. Gene 510, 133e141. Khoa, D.B., Takeda, M., 2012b. Expression of autophagy 8 (Atg8) and its role in the midgut and other organs of the greater wax moth, Galleria mellonella, during metamorphic remodelling and under starvation. Insect Mol. Biol. 21, 473e487. Khoa, D.B., Trang, L.T., Takeda, M., 2012. Expression analyses of caspase-1 and related activities in the midgut of Galleria mellonella during metamorphosis. Insect Mol. Biol. 21, 247e256. Klionsky, D.J., Abdalla, F.C., Abeliovich, H., et al., 2016. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 12, 1e222. Kojima, K., Kuwana, Y., Sezutsu, H., Kobayashi, I., Uchino, K., Tamura, T., Tamada, Y., 2007. A new method for the modification of fibroin heavy chain protein in the transgenic silkworm. Biosci. Biotechnol. Biochem. 71, 2943e2951. Kroemer, G., Levine, B., 2008. Autophagic cell death: the story of a misnomer. Nat. Rev. Mol. Cell Biol. 9, 1004e1010. Kurihara, H., Sezutsu, H., Tamura, T., Yamada, K., 2007. Production of an active feline interferon in the cocoon of transgenic silkworms using the fibroin H-chain expression system. Biochem. Biophys. Res. Commun. 355, 976e980. Leonardi, M.G., Cappellozza, S., Ianne, P., Cappellozza, L., Parenti, P., Giordana, B., 1996. Effects of the topical application of an insect growth regulator (fenoxycarb) on some physiological parameters in the fifth instar larvae of the silkworm Bombyx mori. Comp. Biochem. Physiol. 113B, 361e365. Li, Q., Deng, X., Yang, W., Huang, Z., Tettamanti, G., Cao, Y., Feng, Q., 2010. Autophagy, apoptosis, and ecdysis-related gene expression in the silk gland of the silkworm (Bombyx mori) during metamorphosis. Can. J. Zool. 88, 1169e1178. Ma, L., Xu, H., Zhu, J., Ma, S., Liu, Y., Jiang, R.J., Xia, Q., Li, S., 2011. Ras1(CA) overexpression in the posterior silk gland improves silk yield. Cell Res. 21, 934e943. Malagoli, D., Abdalla, F.C., Cao, Y., Feng, Q., Fujisaki, K., Gregorc, A., Matsuo, T., Nezis, I.P., Papassideri, I.S., Sass, M., Silva-Zacarin, E.C., Tettamanti, G., Umemiya-

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003

A. Montali et al. / Arthropod Structure & Development xxx (2017) 1e11 Shirafuji, R., 2010. Autophagy and its physiological relevance in arthropods: current knowledge and perspectives. Autophagy 6, 575e588. Matsuura, S., Morimoto, T., Nagata, S., Tashiro, Y., 1968. Studies on the posterior silk gland of the silkworm, Bombyx mori. II. Cytolytic processes in posterior silk gland cells during metamorphosis from larva to pupa. J. Cell Biol. 38, 589e603. Matsuura, S., Shimadzu, T., Tashiro, Y., 1976. Lysosomes and related structures in the posterior silk gland cells of Bombyx mori. II. In prepupal and early pupal stadium. Cell Struct. Funct. 1, 223e235. Miranda, J.E., de Bortoli, S.A., Takahashi, R., 2002. Development and silk production by silkworm larvae after topical application of methoprene. Sci. Agric. 59, 585e588. Moss, W.D., 1983. Acid phosphatases. In: Bergmeyer, J., Grassi, M. (Eds.), Esterases, Glycosidases, Lyases, Ligases, vol. 4. Verlag-Chemie, Weinheim, pp. 92e106. Müller, F., Adori, C., Sass, M., 2004. Autophagic and apoptotic features during programmed cell death in the fat body of the tobacco hornworm (Manduca sexta). Eur. J. Cell Biol. 83, 67e78. Romanelli, D., Casartelli, M., Cappellozza, S., de Eguileor, M., Tettamanti, G., 2016. Roles and regulation of autophagy and apoptosis in the remodelling of the lepidopteran midgut epithelium during metamorphosis. Sci. Rep. 6, 32939. Romanelli, D., Casati, B., Franzetti, E., Tettamanti, G., 2014. A molecular view of autophagy in Lepidoptera. Biomed. Res. Int. 2014, 902315. Sehnal, F., Akai, H., 1990. Insect silk glands: their types, development and function, and effects of environmental factors and morphogenetic hormones on them. Int. J. Insect Morphol. Embryol. 19, 79e132. Shiba, H., Yabu, T., Sudayama, M., Mano, N., Arai, N., Nakanishi, T., Hosono, K., 2016. Sequential steps of macroautophagy and chaperone-mediated autophagy are involved in the irreversible process of posterior silk gland histolysis during metamorphosis of Bombyx mori. J. Exp. Biol. 219, 1146e1153.

11

Sumithra, P., Britto, C.P., Krishnan, M., 2010. Modes of cell death in the pupa perivisceral fat body tissue of silkworm Bombyx mori. Cell Tissue Res. 339, 349e358. Tashiro, Y., Shimadzu, T., Matsuura, S., 1976. Lysosomes and related structures in the posterior silk gland cells of Bombyx mori. I. In late larval stadium. Cell Struct. Funct. 1, 205e222. Tettamanti, G., Cao, Y., Feng, Q., Grimaldi, A., de Eguileor, M., 2011. Autophagy in Lepidoptera: more than old wine in new bottle. Invert. Surviv. J. 8, 5e14. Tettamanti, G., Grimaldi, A., Casartelli, M., Ambrosetti, E., Ponti, B., Congiu, T., Ferrarese, R., Rivas-Pena, M.L., Pennacchio, F., de Eguileor, M., 2007a. Programmed cell death and stem cell differentiation are responsible for midgut replacement in Heliothis virescens during prepupal instar. Cell Tissue Res. 330, 345e359. Tettamanti, G., Grimaldi, A., Pennacchio, F., de Eguileor, M., 2007b. Lepidopteran larval midgut during prepupal instar: digestion or self-digestion? Autophagy 3, 630e631. , E., Gonz vez, C., Felix, D.A., Grimaldi, A., de Eguileor, M., Tettamanti, G., Salo alez-Este 2008. Autophagy in invertebrates: insights into development, regeneration and body remodeling. Curr. Pharm. Des. 14, 116e125. Tian, L., Liu, S., Liu, H., Li, S., 2012. 20-hydroxyecdysone upregulates apoptotic genes and induces apoptosis in the Bombyx fat body. Arch. Insect Biochem. Physiol. 79, 207e219. Tian, L., Ma, L., Guo, E., Deng, X., Ma, S., Xia, Q., Cao, Y., Li, S., 2013. 20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body. Autophagy 9, 1172e1187. Wang, H., Wang, Y., Wu, C., Tao, H., Chen, X., Yin, W., Sima, Y., Wang, Y., Xu, S., 2016. Changes in 30K protein synthesis during delayed degeneration of the silk gland by a caspase-dependent pathway in a Bombyx (silkworm) mutant. J. Comp. Physiol. B 186, 689e700. Zirin, J., Cheng, D., Dhanyasi, N., Cho, J., Dura, J.M., Vijayraghavan, K., Perrimon, N., 2013. Ecdysone signaling at metamorphosis triggers apoptosis of Drosophila abdominal muscles. Dev. Biol. 383, 275e284.

Please cite this article in press as: Montali, A., et al., Timing of autophagy and apoptosis during posterior silk gland degeneration in Bombyx mori, Arthropod Structure & Development (2017), http://dx.doi.org/10.1016/j.asd.2017.05.003