- Email: [email protected]
Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms
Biochemical and Biophysical Research Communications xxx (2018) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms Yipeng Du a, Hao Hu a, b, Chaoju Hua a, b, Kang Du a, b, Taotao Wei a, * a b
National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, 100101, China University of Chinese Academy of Sciences, Beijing, 100049, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 June 2018 Accepted 14 June 2018 Available online xxx
SIRT5 is one of the seven mammalian sirtuins which are NADþ-dependent deacylases. In human beings, SIRT5 gene encodes for four SIRT5 protein isoforms, namely SIRT5iso1, SIRT5iso2, SIRT5iso3, and SIRT5iso4. Previous studies have focused mostly on SIRT5iso1. Characteristics regarding localization, activity and tissue distribution of the other three SIRT5 isoforms remain unclear. In the present study, we characterized these properties of these SIRT5 isoforms. We found that SIRT5iso13 were mitochondria-localized, while SIRT5iso4 localized mainly in cytoplasm. SIRT5iso24 had little deacylase activity comparing with SIRT5iso1. Although cDNAs of all SIRT5 isoforms were readily detected in multiply tissues according to EST database, proteins of SIRT5iso24 were seldom observed in human cell lines. Altogether, we dissected the four isoforms of human SIRT5 protein. © 2018 Elsevier Inc. All rights reserved.
Keywords: Sirtuins SIRT5 Protein isoform Acylase Malonylation Succinylation Acetylation
1. Introduction Sirtuins are a group of evolutionary-conserved, NADþ-dependent deacylases [1]. There are seven sirtuin proteins (SIRT1-SIRT7) in mammalian cells [2]. Although they share sequence and structure similarities, the seven mammalian sirtuins shown distinct subcellular localization [3]. SIRT1, SIRT6, and SIRT7 are mainly found in the nucleus [4], with SIRT7 exclusively in nucleolus [5]. SIRT2 resides predominantly in cytoplasm and can translocate into nucleus under certain conditions [6]. SIRT3, SIRT4, and SIRT5 are predominant mitochondrial proteins [7]. Previous investigation on activity of mammalian sirtuins have proved that the SIRT1-SIRT7 conduct overlapped but distinct deacylase activities [8]. SIRT1, SIRT2, and SIRT3 shown robust deacetylase activity; SIRT4, which was originally demonstrated to be an ADP-ribosyltransferase and lipoamidase [9], have recently been proved to be a demethylglutarylase, dehydroxymethylglutarylase, and demethylglutaconylase [10]; SIRT5 shown limited and selective deacetylase activity but strong and general demalonylase, desuccinylase, and deglutarylase activity [11e13]; SIRT6 has weak deacetylase activity, but more efficient deacylase activity towards long
* Corresponding author. E-mail address: [email protected] (T. Wei).
chain fatty acyl groups like myristoyl- and palmitoryl-group [8]; SIRT7 has been reported to deacetylase, long-chain deacylase and histone desuccinylase activity [14]. Among the 7 mammalian sirtuins, SIRT5 is unique by its mitochondrial localization and preference for negative-charged acyl groups [15]. SIRT5 was found localized to mitochondria by detecting exogenously expressed GFP-tagged or endogenous SIRT5 proteins [3,16]. It was then found to precisely localize to mitochondrial matrix and suspiciously to mitochondrial intermembrane space (IMS) [17]. Unlike SIRT1, SIRT2, and SIRT3, deacetylase activity of SIRT5 is weak and sequence-dependent. The reported proteins deacetylated by SIRT5 are cytochrome C [7], carbamoyl phosphate sythetase 1 [16], and urate oxidase [18]. For the 16 synthesized acetyl lysine peptides which are readily deacetylated by SIRT1, SIRT2, and SIRT3, only 8 can be deacetylated by SIRT5 [11]. However, SIRT5 is more efficient to demalonylate, desuccinylate, and deglutarylate a large number of proteins [11e13]. With the development of mass spectrometry techniques, an accelerating number of SIRT5 substrates have been identified [13,19e22]. Even though, the regulating role of SIRT5 has only been demonstrated on a few proteins including CPS1, SOD1, PDC1, HMGCS2, VLCAD, IDH2, GAPDH, ECHA, and PKM2 [19,20,22e27]. Both the malonylome and succinylome dataset indicate that SIRT5 plays an important role in cellular metabolism and participates in pathology of human diseases like cardiac dysfunction, type 2 diabetes, and neurodegenerative diseases [15].
https://doi.org/10.1016/j.bbrc.2018.06.073 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
2
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Most of the studies focused on full-length mouse or human SIRT5 (SIRT5iso1). There is only one protein-coded SIRT5 mRNA found in mouse, but four SIRT5 mRNAs in human, as has been reported in NCBI database. In one report, human SIRT5iso2 was partially characterized by its subcellular localization and shown to be a primate specific isoform [28]. Other biochemical characterizations of SIRT5 isoforms like enzymatic activity, tissue distribution remain to be investigated. In the present work, we compared the four SIRT5 isoforms in enzymatic activity, subcellular localization, and tissue expression, trying to gain further information about the human SIRT5 protein. 2. Materials and methods 2.1. Plasmid construction, cell culture and transfection The full-length cDNA of human SIRT5iso1 was obtained from cDNA library and subcloned into the pcDNA3.1/3flag vector using the primers: hSIRT5-iso1-F, 5-TCCGCTCGAGATGCGACCTCTCCAGA TT-3; hSIRT5-iso1-R, 5-ATGGGGTACCGAAGAAACAGTTTCATTTTC-3. The cDNA of SIRT5iso2 was made from that of SIRT5iso1 by cloning with a different reverse primer: hSIRT5-iso2-R, 5-ATGGGGTACCGA ATTCTTTATAATAATTAGAGATGAGATGGAGATCAAATGACTGAATCTGT TCGTAGC-3. The cDNA of SIRT5iso3 was subcloned from SIRT5iso1 by two steps PCR using the following primers: hSIRT5-iso3-F, 5GCTTTATCAGGAAAAGGGTGTGAAGAGGCAGGCTGC-3; hSIRT5-iso3R, 5- GCAGCCTGCCTCTTCACACCCTTTTCCTGATAAAGC-3. The cDNA of SIRT5iso4 was cloned from SIRT5iso1 by a different forward primer: 5-TCCGCTCGAGATGGGGAGCAAGGAGCCC-3. All the plasmids were sequenced before transfection. COS7, HeLa, HEK293T, HHL5, HepG2, A549, H1299, 16HBE, and K562 cells were cultured in DMEM supplemented with 10% fetal bovine serum in a humidified atmosphere of 5% CO2. Mammalian expression vectors of the four SIRT5 isoforms were transfected into COS7 or HEK293T cells using the lipofectamine 2000 reagent. 2.2. Immunoblotting and immunofluorescence microscopy SDS-PAGEs were performed following standard procedures. Anti-COX IV(60251-1-Ig, PTM-Biolabs), anti-succinyl lysine (PTM401, PTM-Biolabs), anti-Flag (F3165, Sigma-Aldrich), anti-SIRT5AB1 (15122-1-AP, PTM-Biolabs), and anti-SIRT5-AB2 antibodies (AV32391, Sigma-Aldrich) were used for the immunoblotting experiments. Transfected cells were fixed with 4% paraformaldehyde for 20 min at room temperature. Then washed twice with PBS and permeabilized with 0.2% Triton X-100 for 10 min, blocked with 5% bovine serum albumin after another two times washing. Cells were next incubated with primary antibody overnight at 4 C, and secondary antibody for 1 h at room temperature. DAPI was added for 10 min and wash away before observing with the confocal laser scanning microscopy. 2.3. Purification of SIRT5 isoforms from mammalian cells After 24 h of transfection, cells were collected and treated with lysis buffer (50 mM Tris/Cl, pH 7.5, 150 mM NaCl, 1 mM DTT, 1% Triton X-100, protease inhibitor cocktail) for 20 min on ice. Cell lysate was then centrifuge for 10 min at 12,000 g. The supernatant was transferred to a chilled test tube containing prepared anti-flag M2 affinity resin. After binding at room temperature for 2 h, the resin was washed three times with TBS, and eluted with 3flag peptide. Concentration of the eluted SIRT5 protein isoforms were measured and stored in storage buffer (50 mM Tris/Cl, pH 8.0, 265 mM NaCl, 0.2 mM DTT, 10% glycerol).
2.4. Activity assay of SIRT5 isoforms Two experiments were performed to measure the enzymatic activity of different SIRT5 isoforms. First experiment measures their activity at the peptide level. The procedure was similar to method of a previous literature [29]. Briefly, a succinyl peptide derivative was synthesized (2-Abz)-GVLK (succ)A [Y (3-NO2)]GV-NH2 and dissolved in buffer (50 mM Tris/Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl2). The reactions were performed in assay buffer (50 mM Tris/Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl2, 1 mg/mL BSA) and measured in 96-well microtiter plates. Equal amount of purified SIRT5 isoform proteins (0.01 mM) were incubated with this peptide derivative (2 mM) at the present of 500 mM NADþ for 2 h at 37 C. Then trypsin (0.01 mg/mL) was added for another 2 h. Fluorescence was detected at an excitation wavelength of 320 nm and emission wavelength of 420 nm. Second experiment measuring SIRT5 activity at the protein level. Briefly, succinylated BSA were incubated with equal amount of each types of SIRT5 isoforms, and desuccinylation of BSA was detected by pan antisuccinyl lysine antibody in the Western blot experiment. 3. Results 3.1. Analysis of sequence, structure and enzymatic activity of the four human SIRT5 isoforms The full-length SIRT5 protein (SIRT5iso1) contains the N-terminal 36 amino acid (AA) mitochondrial localization signal (MLS) peptide and the remaining NADþ-dependent deacylase domain (Fig. 1A). Crystal structure shown that its deacylase domain contains three functional subdomains including a zinc-finger binding domain, a NADþ binding domain, and a substrate binding domain [30]. The zinc-finger binding domain comprises four cysteines from AA 166 to 212. The NADþ binding domain is composed of several sequencediscontinuous, but spatial-closed AAs involving AA 58e77, AA 292e293 etc. The substrate binding domain is made up of lysine binding AA 221e254 and acyl-group binding AA 102e105 [11,30]. Based on the crystal structures of human SIRT5iso1, we analyzed the potential effect of sequence variance to its enzymatic activity of the other three isoforms. The SIRT5iso2 contains a different C-terminal sequence comparing with SIRT5iso1 (Fig. 1C). Cysteine 293 (C293) on C-terminal of SIRT5iso1 facilitates its binding of NADþ to SIRT5. Replacement of this residue might affect the binding capacity of NADþ. SIRT5iso3 differ from SIRT5iso1 by missing the AAs 189e206, which localized near by the zinc finger domain (Fig. 1D). Missing of this sequence in SIRT5iso3 probably destroy the formation of zincfinger, which is important for the deacylase activity. Deletion of N-terminal AAs in SIRT5iso4 has great impact on its activity because of the loss of two key residues Y102 and R105, which are critical for binding of acyl group from substrate peptides (Fig. 1E). The analysis suggest that SIRT5iso24 should be less active than that of SIRT5iso1. To validate our analysis based on the structure data, we measured the deacylase activity of these SIRT5 isoforms. The activity assay is based on a synthesized peptide derivative which comprises one succinyl lysine and a pair of fluorophore and quencher [29]. Desuccinylation of the peptide derivative enable cutting of the peptide by trypsin, thus separate the fluorophore from quencher. The activity of SIRT5 is reflected by the relative fluorescence unit (RFU). For SIRT5iso1, an increase of RFU was detected as the concentration of peptides derivative become higher. The Km value of SIRT5iso1 on the peptides derivative was 4.2 mM, which was similar to the previous data measured with histone H3K9 succinyl peptides [29]. However, little fluorescence signal was detected on SIRT5iso24, even at the higher concentration of substrate peptides (Fig. 2A). To further determine the desuccinylase activity of the four SIRT5
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
3
Fig. 1. Schematic diagram and structure of SIRT5 isoforms. A. Schematic diagram of human SIRT5 isoforms. SIRT5iso1 (iso 1) is the canonical sequence. SIRT5iso2 (iso2) differs from iso1 by the amino acids (AAs) at the C-terminal (iso 2, gray). SIRT5iso3 (iso3) and SIRT5iso4 (iso4) differ from iso1 by missing AAs 189e206 and 1e108. B. Structure of iso 1. The cartoon structure was generated based on the craystal structure of human SIRT5 (PDB: 3RIY) containing AAs 34e302. C. Missing AAs in iso 2 was marked in red. C-terminal replacement of AAs in iso 2 destroys the binding of C293 with NADþ molecule (blue). D. Missing AAs in iso 3 was marked in red. The missing sequence is close to C207 of the Zn finger binding domain (blue). E. Missing AAs in iso 4 was marked in red. Y102 and R105 in the missing sequence is key to the binding of acyl-group of substrate peptides (blue). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
isoforms, we took the in vitro succinylated BSA as substrate. Each of the four SIRT5 isoforms were incubated with the succinylated BSA with the presence of NADþ. We observed that SIRT5iso1, other than SIRT5iso24 efficiently removed the succinyl group on BSA (Fig. 2B). These results indicate that SIRT5iso1 was deacylase active, while SIRT5iso24 completely lost their deacylase activity, which was consistent with the above structural analysis. 3.2. Subcellular localization of the four human SIRT5 isoforms SIRT5 is one of the three mitochondrial sirtuins [3]. To
investigate the cellular localization of SIRT5 isoforms, we transiently expressed C-terminal Flag-tagged SIRT5 isoforms in COS7 cells. We observed a great overlap of anti-Flag signal with anti-COX IV signal (a mitochondrial marker) for SIRT5iso13, which suggests the exclusive mitochondrial localization of the three isoforms (Fig. 3). But there was little overlap for SIRT5iso4. Most of the antiFlag signal for SIRT5iso4 distributed equally in cytoplasm (Fig. 3). The results were consistent with prediction using the 36 length Nterminal MLS (Fig. 1A). All the isoforms (SIRT5iso13) containing MLS were localized in mitochondria, while the SIRT5iso4 missing MLS was cytoplasm localized.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
4
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 2. Deacylase activity of SIRT5 isoforms. A. Michaelis-Menten plot for each of the four SIRT5 isoforms mediated desuccinylation of synthesized peptides derivative. The synthesized peptide derivative ((2-Abz)-GVLK (succ)A [Y (3-NO2)]GV-NH2) contains a pair of fluorophore (2-Abz) and quencher (Y (3-NO2)). Each of the four overexpressed SIRT5 isoforms were purified from HEK293T cells, incubated with the peptide derivative at the presence of NADþ. Trypsin was used to cleave desuccinylated peptides, separating fluorophore from quencher. Relative fluorescence units (RFU) was measured in 96-well microtiter plates. Solid lines represent fit to Michaelis-Menten equation. All reactions were repeated for three times. B. Deacylase activity assay of SIRT5 isoforms using succinyl-BSA. Each of the purified SIRT5 isoforms were incubated with succinyl-BSA at the presence of NADþ. Western blot were determined using pan anti-succinyl lysine antibody (succinyl-K).
Fig. 3. Subcellular localization of SIRT5 isoforms. Each of the four Flag-tagged SIRT5 isoforms were transient expressed in COS7 cells. Overexpressed SIRT5 proteins, mitochondria, and nuclear were stained with anti-Flag, anti-COXⅣ antibodies, and DAPI. The merged pictures are in the right panel.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
5
Fig. 4. Tissue distribution of SIRT5 mRNA variants. A. A representative alignment of human SIRT5 EST sequences to SIRT5 transcript variants. Numbers above indicates the position of nucleotide in each mRNA sequence. Gray rectangle indicates distinct sequence. Red rectangle indicates well-matched parts of the EST sequence. Black rectangle indicates mismatched parts of the EST sequence. B. Tissue distribution analysis of SIRT5 mRNA variants based on expressed sequence tag (EST) of SIRT5. 191 ESTs of SIRT5 from various human tissues were obtained from GENBANK. They were matched to sequence of each of the four SIRT5 mRNA variants. The number of matched ESTs in each tissue were indicated. C and D. Measurement of purified SIRT5 isoforms by anti-SIRT5-AB1 (C) and anti-SIRT5-AB2 (D). E and F. Western blot detection of SIRT5 proteins in various human cell lines by anti-SIRT5AB1 (E) and anti-SIRT5-AB2 (F). Star: nonspecific bands. Arrow: position of endogenous SIRT5. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
6
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
3.3. Tissue distribution of the four human SIRT5 isoforms To characterize tissue distribution of human SIRT5 isoforms, a total of 191 expressed sequence tag (EST) of SIRT5 from various human tissues were obtained from GENBANK. Protein of SIRT5iso14 were translated by SIRT5 mRNA of variant 1e4 (Fig. 4A). Each of the 191 EST were matched to the four SIRT5 mRNA variants by the online BLASTn method. The BLAST results were manually refined to make sure that the full sequence of EST were matched to a continuous part of the sequence of the SIRT5 variants (Fig. 4A). For example, the EST AL557205 from blood was matched to all the four variants because of the tolerance of mismatch in the algorithm of BLASTn method. After manual refinement, the EST was matched only to variant 1, which indicated that AL557205 was a variant 1 special EST. Additionally, the EST BG328678 from intestine tissue matched perfectly to variant 1, 3, and 4, which suggested that this EST might be from variant 1, 3, or 4, and that the intestine tissue expresses at least one of the three SIRT5 variants. A total of 400 match between 191 ESTs from 29 human tissues and the four SIRT5 variants have been manually refined. Number of matches in each type of tissues have been summarized in Fig. 4B. It can be found that SIRT5iso1 expresses in almost all human tissues, except adipose, bladder and trachea, which is in consistence to previous reports [16,31]. ESTs for SIRT5iso2 were most frequently discovered in the brain, but less in all the other tissues (Fig. 4B). Interestingly, SIRT5iso2 was reported to be a primate specific isoform, which suggested the potential role of SIRT5iso2 in neuron system [28]. There are 13 tissues expressing all the four isoforms and only 3 tissues expressing one isoform. These results indicate SIRT5 gene is widely expressed, but expression pattern of different isoforms varies in tissues. To further explore the expression of SIRT5 isoforms, we measured the expression of SIRT5 isoforms in various human cell lines including uterus (HeLa), kidney (293T), liver (HHL5, L02, and HepG2), lung (A549, H1299, and 16HBE), and blood (K562). Two SIRT5 antibodies which recognize distinguished epitope of SIRT5 protein were used. The immunogen used to generate polyclonal anti-SIRT5-AB1 is the full-length human SIRT5 (SIRT5iso1) fusion protein, thus it detects all the four isoforms (Fig. 4C). However, the immunogen to generate anti-SIRT5-AB2 is synthetic peptides located within the middle of SIRT5 protein sequence which is missed on SIRT5iso3. Thus, anti-SIRT5-AB2 recognize three of the four isoforms except SIRT5iso3 (Fig. 4D). Whole cell lysis was first detected for expression of SIRT5 using anti-SIRT5-AB1 antibody. One band near the molecular weight of 34 KDa were detected. No bands were observed lower than 34 KDa. Molecular weight of SIRT5iso1 is 34 KDa. Although SIRT5iso3 is 11 AAs smaller than SIRT5iso1, their positions on gels are similar (Fig. 4C D). SIRT5iso2 and SIRT5iso4 are much smaller than that of SIRT5iso1 which can be distinguished by the position of bands. Thus, the 34 KDa band detected by anti-SIRT5-AB1 should be SIRT5iso1 or SIRT5iso3, and SIRT5iso2 and SIRT5iso4 were not expressed in the samples (Fig. 4E). There were also bands larger than 34 KDa which should be nonspecific bands for the antibody. To confirm the observation, we repeated the experiments and immunobloted the membrane with anti-SIRT5-AB2. Although nonspecific bands larger than 34 KDa were detected, there were still bands near 34 KDa which representing SIRT5iso1 or SIRT5iso3 (Fig. 4F). Interestingly, the band in HepG2 cells determined by anti-SIRT5-AB1 almost disappeared when detected by anti-SIRT5-AB2. As SIRT5iso3 can only be recognized by anti-SIRT5-AB1, we speculated that SIRT5iso3 should be the main SIRT5 isoform in HepG2 cells. Similarly, bands representing SIRT5iso2 and SIRT5iso4 were not detected. Although mRNAs of the four SIRT5 isoforms have been frequently detected in tissues like uterus, kidney, liver, lung and blood (Fig. 4B), proteins of SIRT5iso2
and SIRT5iso4 were not measured in cell lines originated from these tissues using two different antibodies (Fig. 4E F). 4. Discussion Here, we explored the tissue distribution, subcellular localization, and enzymatic activity of four human SIRT5 isoforms. We found that there was little deacylase activity of SIRT5iso24, comparing to SIRT5iso1. SIRT5iso13 containing the MLS localized predominantly in mitochondria, while SIRT5iso4 missing the MLS resided mainly in cytosol. Expression of different SIRT5 isoforms vary in different types of tissues. Sirtuins proteins were initially discovered as ADP-ribosyltransferase [32]. In the present work, we determined deacylase activity of SIRT5 isoforms using the substrates containing succinyl lysine. Although, little desuccinylase activity has been detected for SIRT5iso24, it is possible that they function as enzymes which catalyze ADP-ribosylation or remove other acyl groups like propionyl-, butyryl- or glutaryl-groups from substrate proteins. The other possibility is that SIRT5iso24 is enzymatic inactive, but regulatory active. They might regulate the activity of SIRT5iso1 through completing substrates binding. The SIRT5iso24 might also be the dominant-negative proteins of SIRT5iso1 and play roles in down-regulating activity of SIRT5iso1. Although mRNA of SIRT5 isoforms have been determined in various human tissues, there were little reports regarding existence of SIRT5iso24 proteins in human tissues. One possibility is that the mRNA of SIRT5iso24 are not translated or quickly degraded after translation. In this case, more work remains to be done to explore the function of these SIRT5 isoforms. It was reported that SIRT5iso2 was a primate-specific isoform [28]. Indeed, SIRT5 gene in mammalians other than primates encodes for only one SIRT5 protein. For example, there is one SIRT5 isoform in rodents, but five SIRT5 isoforms in chimpanzee and macaque monkey according to ENSEMBL database. Why primates develop various SIRT5 isoforms? The expression pattern in human tissues shown that SIRT5iso2 was widely and strongly expressed in brain tissue. The biological role of SIRT5iso2 in higher nervous activity remain to be explored. Further research on the function of SIRT5 isoforms should focus on particular tissues. Acknowledgements We thank Profs. Pingsheng Liu (IBP, CAS, China) and Zhonghong Gao (HUST, China) for valuable discussions, and Yan Teng (IBP, CAS, China) for technical assistance. Funding: This work was supported by the National Key R&D Program of China (2017YFA020550); the National Natural Science Foundation of China (31671175, 31771257); the Strategic Priority Research Programs (Category A) of the Chinese Academy of Sciences (XDA12030207); and the National Laboratory of Biomacromolecules (2017KF03). References [1] S. Greiss, A. Gartner, Sirtuin/Sir2 phylogeny, evolutionary considerations and structural conservation, Mol. Cell. 28 (2009) 407e415. [2] R.A. Frye, Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins, Biochem. Biophys. Res. Commun. 273 (2000) 793e798. [3] E. Michishita, J.Y. Park, J.M. Burneskis, J.C. Barrett, I. Horikawa, Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins, Mol. Biol. Cell 16 (2005) 4623e4635. [4] R. Mostoslavsky, K.F. Chua, D.B. Lombard, W.W. Pang, M.R. Fischer, L. Gellon, P. Liu, G. Mostoslavsky, S. Franco, M.M. Murphy, K.D. Mills, P. Patel, J.T. Hsu, A.L. Hong, E. Ford, H.L. Cheng, C. Kennedy, N. Nunez, R. Bronson, D. Frendewey, W. Auerbach, D. Valenzuela, M. Karow, M.O. Hottiger, S. Hursting, J.C. Barrett, L. Guarente, R. Mulligan, B. Demple, G.D. Yancopoulos, F.W. Alt, Genomic instability and aging-like phenotype in the absence of mammalian SIRT6, Cell 124 (2006) 315e329. [5] E. Ford, R. Voit, G. Liszt, C. Magin, I. Grummt, L. Guarente, Mammalian Sir2
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
homolog SIRT7 is an activator of RNA polymerase I transcription, Genes Dev. 20 (2006) 1075e1080. A. Vaquero, M.B. Scher, D.H. Lee, A. Sutton, H.L. Cheng, F.W. Alt, L. Serrano, R. Sternglanz, D. Reinberg, SirT2 is a histone deacetylase with preference for histone H4 Lys 16 during mitosis, Genes Dev. 20 (2006) 1256e1261. C. Schlicker, M. Gertz, P. Papatheodorou, B. Kachholz, C.F. Becker, C. Steegborn, Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and Sirt5, J. Mol. Biol. 382 (2008) 790e801. J.L. Feldman, J. Baeza, J.M. Denu, Activation of the protein deacetylase SIRT6 by long-chain fatty acids and widespread deacylation by mammalian sirtuins, J. Biol. Chem. 288 (2013) 31350e31356. N. Ahuja, B. Schwer, S. Carobbio, D. Waltregny, B.J. North, V. Castronovo, P. Maechler, E. Verdin, Regulation of insulin secretion by SIRT4, a mitochondrial ADP-ribosyltransferase, J. Biol. Chem. 282 (2007) 33583e33592. K.A. Anderson, F.K. Huynh, K. Fisher-Wellman, J.D. Stuart, B.S. Peterson, J.D. Douros, G.R. Wagner, J.W. Thompson, A.S. Madsen, M.F. Green, R.M. Sivley, O.R. Ilkayeva, R.D. Stevens, D.S. Backos, J.A. Capra, C.A. Olsen, J.E. Campbell, D.M. Muoio, P.A. Grimsrud, M.D. Hirschey, SIRT4 is a lysine deacylase that controls leucine metabolism and insulin secretion, Cell Metabol. 25 (2017) 838e855 e815. J. Du, Y. Zhou, X. Su, J.J. Yu, S. Khan, H. Jiang, J. Kim, J. Woo, J.H. Kim, B.H. Choi, B. He, W. Chen, S. Zhang, R.A. Cerione, J. Auwerx, Q. Hao, H. Lin, Sirt5 is a NADdependent protein lysine demalonylase and desuccinylase, Science 334 (2011) 806e809. C. Peng, Z. Lu, Z. Xie, Z. Cheng, Y. Chen, M. Tan, H. Luo, Y. Zhang, W. He, K. Yang, B.M. Zwaans, D. Tishkoff, L. Ho, D. Lombard, T.C. He, J. Dai, E. Verdin, Y. Ye, Y. Zhao, The first identification of lysine malonylation substrates and its regulatory enzyme, Mol. Cell. Proteomics 10 (2011). M111 012658. M. Tan, C. Peng, K.A. Anderson, P. Chhoy, Z. Xie, L. Dai, J. Park, Y. Chen, H. Huang, Y. Zhang, J. Ro, G.R. Wagner, M.F. Green, A.S. Madsen, J. Schmiesing, B.S. Peterson, G. Xu, O.R. Ilkayeva, M.J. Muehlbauer, T. Braulke, C. Muhlhausen, D.S. Backos, C.A. Olsen, P.J. McGuire, S.D. Pletcher, D.B. Lombard, M.D. Hirschey, Y. Zhao, Lysine glutarylation is a protein posttranslational modification regulated by SIRT5, Cell Metabol. 19 (2014) 605e617. Z. Tong, M. Wang, Y. Wang, D.D. Kim, J.K. Grenier, J. Cao, S. Sadhukhan, Q. Hao, H. Lin, SIRT7 is an RNA-activated protein lysine deacylase, ACS Chem. Biol. 12 (2017) 300e310. S. Kumar, D.B. Lombard, Functions of the sirtuin deacylase SIRT5 in normal physiology and pathobiology, Crit. Rev. Biochem. Mol. Biol. 53 (2018) 311e334. T. Nakagawa, D.J. Lomb, M.C. Haigis, L. Guarente, SIRT5 Deacetylates carbamoyl phosphate synthetase 1 and regulates the urea cycle, Cell 137 (2009) 560e570. Y. Nakamura, M. Ogura, D. Tanaka, N. Inagaki, Localization of mouse mitochondrial SIRT proteins: shift of SIRT3 to nucleus by co-expression with SIRT5, Biochem. Biophys. Res. Commun. 366 (2008) 174e179. Y. Nakamura, M. Ogura, K. Ogura, D. Tanaka, N. Inagaki, SIRT5 deacetylates and activates urate oxidase in liver mitochondria of mice, FEBS Lett. 586 (2012) 4076e4081. M.J. Rardin, W. He, Y. Nishida, J.C. Newman, C. Carrico, S.R. Danielson, A. Guo, P. Gut, A.K. Sahu, B. Li, R. Uppala, M. Fitch, T. Riiff, L. Zhu, J. Zhou, D. Mulhern,
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
7
R.D. Stevens, O.R. Ilkayeva, C.B. Newgard, M.P. Jacobson, M. Hellerstein, E.S. Goetzman, B.W. Gibson, E. Verdin, SIRT5 regulates the mitochondrial lysine succinylome and metabolic networks, Cell Metabol. 18 (2013) 920e933. G. Colak, O. Pougovkina, L. Dai, M. Tan, H. Te Brinke, H. Huang, Z. Cheng, J. Park, X. Wan, X. Liu, W.W. Yue, R.J. Wanders, J.W. Locasale, D.B. Lombard, V.C. de Boer, Y. Zhao, Proteomic and biochemical studies of lysine malonylation suggest its malonic aciduria-associated regulatory role in mitochondrial function and fatty acid oxidation, Mol. Cell. Proteomics 14 (2015) 3056e3071. Y. Du, T. Cai, T. Li, P. Xue, B. Zhou, X. He, P. Wei, P. Liu, F. Yang, T. Wei, Lysine malonylation is elevated in type 2 diabetic mouse models and enriched in metabolic associated proteins, Mol. Cell. Proteomics 14 (2015) 227e236. Y. Nishida, M.J. Rardin, C. Carrico, W. He, A.K. Sahu, P. Gut, R. Najjar, M. Fitch, M. Hellerstein, B.W. Gibson, E. Verdin, SIRT5 regulates both cytosolic and mitochondrial protein malonylation with glycolysis as a major target, Mol. Cell 59 (2015) 321e332. Z.F. Lin, H.B. Xu, J.Y. Wang, Q. Lin, Z. Ruan, F.B. Liu, W. Jin, H.H. Huang, X. Chen, SIRT5 desuccinylates and activates SOD1 to eliminate ROS, Biochem. Biophys. Res. Commun. 441 (2013) 191e195. J. Park, Y. Chen, D.X. Tishkoff, C. Peng, M. Tan, L. Dai, Z. Xie, Y. Zhang, B.M. Zwaans, M.E. Skinner, D.B. Lombard, Y. Zhao, SIRT5-mediated lysine desuccinylation impacts diverse metabolic pathways, Mol. Cell 50 (2013) 919e930. S. Sadhukhan, X. Liu, D. Ryu, O.D. Nelson, J.A. Stupinski, Z. Li, W. Chen, S. Zhang, R.S. Weiss, J.W. Locasale, J. Auwerx, H. Lin, Metabolomics-assisted proteomics identifies succinylation and SIRT5 as important regulators of cardiac function, Proc. Natl. Acad. Sci. U. S. A. 113 (2016) 4320e4325. L. Zhou, F. Wang, R. Sun, X. Chen, M. Zhang, Q. Xu, Y. Wang, S. Wang, Y. Xiong, K.L. Guan, P. Yang, H. Yu, D. Ye, SIRT5 promotes IDH2 desuccinylation and G6PD deglutarylation to enhance cellular antioxidant defense, EMBO Rep. 17 (2016) 811e822. Y. Xiangyun, N. Xiaomin, G. Linping, X. Yunhua, L. Ziming, Y. Yongfeng, C. Zhiwei, L. Shun, Desuccinylation of pyruvate kinase M2 by SIRT5 contributes to antioxidant response and tumor growth, Oncotarget 8 (2017) 6984e6993. N. Matsushita, R. Yonashiro, Y. Ogata, A. Sugiura, S. Nagashima, T. Fukuda, R. Inatome, S. Yanagi, Distinct regulation of mitochondrial localization and stability of two human Sirt5 isoforms, Gene Cell. 16 (2011) 190e202. C. Roessler, C. Tuting, M. Meleshin, C. Steegborn, M. Schutkowski, A novel continuous assay for the deacylase sirtuin 5 and other deacetylases, J. Med. Chem. 58 (2015) 7217e7223. Y. Zhou, H. Zhang, B. He, J. Du, H. Lin, R.A. Cerione, Q. Hao, The bicyclic intermediate structure provides insights into the desuccinylation mechanism of human sirtuin 5 (SIRT5), J. Biol. Chem. 287 (2012) 28307e28314. D.B. Lombard, F.W. Alt, H.L. Cheng, J. Bunkenborg, R.S. Streeper, R. Mostoslavsky, J. Kim, G. Yancopoulos, D. Valenzuela, A. Murphy, Y. Yang, Y. Chen, M.D. Hirschey, R.T. Bronson, M. Haigis, L.P. Guarente, R.V. Farese Jr., S. Weissman, E. Verdin, B. Schwer, Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation, Mol. Cell Biol. 27 (2007) 8807e8814. J.C. Tanny, G.J. Dowd, J. Huang, H. Hilz, D. Moazed, An enzymatic activity in the yeast Sir2 protein that is essential for gene silencing, Cell 99 (1999) 735e745.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms Yipeng Du a, Hao Hu a, b, Chaoju Hua a, b, Kang Du a, b, Taotao Wei a, * a b
National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, 100101, China University of Chinese Academy of Sciences, Beijing, 100049, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 June 2018 Accepted 14 June 2018 Available online xxx
SIRT5 is one of the seven mammalian sirtuins which are NADþ-dependent deacylases. In human beings, SIRT5 gene encodes for four SIRT5 protein isoforms, namely SIRT5iso1, SIRT5iso2, SIRT5iso3, and SIRT5iso4. Previous studies have focused mostly on SIRT5iso1. Characteristics regarding localization, activity and tissue distribution of the other three SIRT5 isoforms remain unclear. In the present study, we characterized these properties of these SIRT5 isoforms. We found that SIRT5iso13 were mitochondria-localized, while SIRT5iso4 localized mainly in cytoplasm. SIRT5iso24 had little deacylase activity comparing with SIRT5iso1. Although cDNAs of all SIRT5 isoforms were readily detected in multiply tissues according to EST database, proteins of SIRT5iso24 were seldom observed in human cell lines. Altogether, we dissected the four isoforms of human SIRT5 protein. © 2018 Elsevier Inc. All rights reserved.
Keywords: Sirtuins SIRT5 Protein isoform Acylase Malonylation Succinylation Acetylation
1. Introduction Sirtuins are a group of evolutionary-conserved, NADþ-dependent deacylases [1]. There are seven sirtuin proteins (SIRT1-SIRT7) in mammalian cells [2]. Although they share sequence and structure similarities, the seven mammalian sirtuins shown distinct subcellular localization [3]. SIRT1, SIRT6, and SIRT7 are mainly found in the nucleus [4], with SIRT7 exclusively in nucleolus [5]. SIRT2 resides predominantly in cytoplasm and can translocate into nucleus under certain conditions [6]. SIRT3, SIRT4, and SIRT5 are predominant mitochondrial proteins [7]. Previous investigation on activity of mammalian sirtuins have proved that the SIRT1-SIRT7 conduct overlapped but distinct deacylase activities [8]. SIRT1, SIRT2, and SIRT3 shown robust deacetylase activity; SIRT4, which was originally demonstrated to be an ADP-ribosyltransferase and lipoamidase [9], have recently been proved to be a demethylglutarylase, dehydroxymethylglutarylase, and demethylglutaconylase [10]; SIRT5 shown limited and selective deacetylase activity but strong and general demalonylase, desuccinylase, and deglutarylase activity [11e13]; SIRT6 has weak deacetylase activity, but more efficient deacylase activity towards long
* Corresponding author. E-mail address: [email protected] (T. Wei).
chain fatty acyl groups like myristoyl- and palmitoryl-group [8]; SIRT7 has been reported to deacetylase, long-chain deacylase and histone desuccinylase activity [14]. Among the 7 mammalian sirtuins, SIRT5 is unique by its mitochondrial localization and preference for negative-charged acyl groups [15]. SIRT5 was found localized to mitochondria by detecting exogenously expressed GFP-tagged or endogenous SIRT5 proteins [3,16]. It was then found to precisely localize to mitochondrial matrix and suspiciously to mitochondrial intermembrane space (IMS) [17]. Unlike SIRT1, SIRT2, and SIRT3, deacetylase activity of SIRT5 is weak and sequence-dependent. The reported proteins deacetylated by SIRT5 are cytochrome C [7], carbamoyl phosphate sythetase 1 [16], and urate oxidase [18]. For the 16 synthesized acetyl lysine peptides which are readily deacetylated by SIRT1, SIRT2, and SIRT3, only 8 can be deacetylated by SIRT5 [11]. However, SIRT5 is more efficient to demalonylate, desuccinylate, and deglutarylate a large number of proteins [11e13]. With the development of mass spectrometry techniques, an accelerating number of SIRT5 substrates have been identified [13,19e22]. Even though, the regulating role of SIRT5 has only been demonstrated on a few proteins including CPS1, SOD1, PDC1, HMGCS2, VLCAD, IDH2, GAPDH, ECHA, and PKM2 [19,20,22e27]. Both the malonylome and succinylome dataset indicate that SIRT5 plays an important role in cellular metabolism and participates in pathology of human diseases like cardiac dysfunction, type 2 diabetes, and neurodegenerative diseases [15].
https://doi.org/10.1016/j.bbrc.2018.06.073 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
2
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Most of the studies focused on full-length mouse or human SIRT5 (SIRT5iso1). There is only one protein-coded SIRT5 mRNA found in mouse, but four SIRT5 mRNAs in human, as has been reported in NCBI database. In one report, human SIRT5iso2 was partially characterized by its subcellular localization and shown to be a primate specific isoform [28]. Other biochemical characterizations of SIRT5 isoforms like enzymatic activity, tissue distribution remain to be investigated. In the present work, we compared the four SIRT5 isoforms in enzymatic activity, subcellular localization, and tissue expression, trying to gain further information about the human SIRT5 protein. 2. Materials and methods 2.1. Plasmid construction, cell culture and transfection The full-length cDNA of human SIRT5iso1 was obtained from cDNA library and subcloned into the pcDNA3.1/3flag vector using the primers: hSIRT5-iso1-F, 5-TCCGCTCGAGATGCGACCTCTCCAGA TT-3; hSIRT5-iso1-R, 5-ATGGGGTACCGAAGAAACAGTTTCATTTTC-3. The cDNA of SIRT5iso2 was made from that of SIRT5iso1 by cloning with a different reverse primer: hSIRT5-iso2-R, 5-ATGGGGTACCGA ATTCTTTATAATAATTAGAGATGAGATGGAGATCAAATGACTGAATCTGT TCGTAGC-3. The cDNA of SIRT5iso3 was subcloned from SIRT5iso1 by two steps PCR using the following primers: hSIRT5-iso3-F, 5GCTTTATCAGGAAAAGGGTGTGAAGAGGCAGGCTGC-3; hSIRT5-iso3R, 5- GCAGCCTGCCTCTTCACACCCTTTTCCTGATAAAGC-3. The cDNA of SIRT5iso4 was cloned from SIRT5iso1 by a different forward primer: 5-TCCGCTCGAGATGGGGAGCAAGGAGCCC-3. All the plasmids were sequenced before transfection. COS7, HeLa, HEK293T, HHL5, HepG2, A549, H1299, 16HBE, and K562 cells were cultured in DMEM supplemented with 10% fetal bovine serum in a humidified atmosphere of 5% CO2. Mammalian expression vectors of the four SIRT5 isoforms were transfected into COS7 or HEK293T cells using the lipofectamine 2000 reagent. 2.2. Immunoblotting and immunofluorescence microscopy SDS-PAGEs were performed following standard procedures. Anti-COX IV(60251-1-Ig, PTM-Biolabs), anti-succinyl lysine (PTM401, PTM-Biolabs), anti-Flag (F3165, Sigma-Aldrich), anti-SIRT5AB1 (15122-1-AP, PTM-Biolabs), and anti-SIRT5-AB2 antibodies (AV32391, Sigma-Aldrich) were used for the immunoblotting experiments. Transfected cells were fixed with 4% paraformaldehyde for 20 min at room temperature. Then washed twice with PBS and permeabilized with 0.2% Triton X-100 for 10 min, blocked with 5% bovine serum albumin after another two times washing. Cells were next incubated with primary antibody overnight at 4 C, and secondary antibody for 1 h at room temperature. DAPI was added for 10 min and wash away before observing with the confocal laser scanning microscopy. 2.3. Purification of SIRT5 isoforms from mammalian cells After 24 h of transfection, cells were collected and treated with lysis buffer (50 mM Tris/Cl, pH 7.5, 150 mM NaCl, 1 mM DTT, 1% Triton X-100, protease inhibitor cocktail) for 20 min on ice. Cell lysate was then centrifuge for 10 min at 12,000 g. The supernatant was transferred to a chilled test tube containing prepared anti-flag M2 affinity resin. After binding at room temperature for 2 h, the resin was washed three times with TBS, and eluted with 3flag peptide. Concentration of the eluted SIRT5 protein isoforms were measured and stored in storage buffer (50 mM Tris/Cl, pH 8.0, 265 mM NaCl, 0.2 mM DTT, 10% glycerol).
2.4. Activity assay of SIRT5 isoforms Two experiments were performed to measure the enzymatic activity of different SIRT5 isoforms. First experiment measures their activity at the peptide level. The procedure was similar to method of a previous literature [29]. Briefly, a succinyl peptide derivative was synthesized (2-Abz)-GVLK (succ)A [Y (3-NO2)]GV-NH2 and dissolved in buffer (50 mM Tris/Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl2). The reactions were performed in assay buffer (50 mM Tris/Cl, pH 8.0, 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl2, 1 mg/mL BSA) and measured in 96-well microtiter plates. Equal amount of purified SIRT5 isoform proteins (0.01 mM) were incubated with this peptide derivative (2 mM) at the present of 500 mM NADþ for 2 h at 37 C. Then trypsin (0.01 mg/mL) was added for another 2 h. Fluorescence was detected at an excitation wavelength of 320 nm and emission wavelength of 420 nm. Second experiment measuring SIRT5 activity at the protein level. Briefly, succinylated BSA were incubated with equal amount of each types of SIRT5 isoforms, and desuccinylation of BSA was detected by pan antisuccinyl lysine antibody in the Western blot experiment. 3. Results 3.1. Analysis of sequence, structure and enzymatic activity of the four human SIRT5 isoforms The full-length SIRT5 protein (SIRT5iso1) contains the N-terminal 36 amino acid (AA) mitochondrial localization signal (MLS) peptide and the remaining NADþ-dependent deacylase domain (Fig. 1A). Crystal structure shown that its deacylase domain contains three functional subdomains including a zinc-finger binding domain, a NADþ binding domain, and a substrate binding domain [30]. The zinc-finger binding domain comprises four cysteines from AA 166 to 212. The NADþ binding domain is composed of several sequencediscontinuous, but spatial-closed AAs involving AA 58e77, AA 292e293 etc. The substrate binding domain is made up of lysine binding AA 221e254 and acyl-group binding AA 102e105 [11,30]. Based on the crystal structures of human SIRT5iso1, we analyzed the potential effect of sequence variance to its enzymatic activity of the other three isoforms. The SIRT5iso2 contains a different C-terminal sequence comparing with SIRT5iso1 (Fig. 1C). Cysteine 293 (C293) on C-terminal of SIRT5iso1 facilitates its binding of NADþ to SIRT5. Replacement of this residue might affect the binding capacity of NADþ. SIRT5iso3 differ from SIRT5iso1 by missing the AAs 189e206, which localized near by the zinc finger domain (Fig. 1D). Missing of this sequence in SIRT5iso3 probably destroy the formation of zincfinger, which is important for the deacylase activity. Deletion of N-terminal AAs in SIRT5iso4 has great impact on its activity because of the loss of two key residues Y102 and R105, which are critical for binding of acyl group from substrate peptides (Fig. 1E). The analysis suggest that SIRT5iso24 should be less active than that of SIRT5iso1. To validate our analysis based on the structure data, we measured the deacylase activity of these SIRT5 isoforms. The activity assay is based on a synthesized peptide derivative which comprises one succinyl lysine and a pair of fluorophore and quencher [29]. Desuccinylation of the peptide derivative enable cutting of the peptide by trypsin, thus separate the fluorophore from quencher. The activity of SIRT5 is reflected by the relative fluorescence unit (RFU). For SIRT5iso1, an increase of RFU was detected as the concentration of peptides derivative become higher. The Km value of SIRT5iso1 on the peptides derivative was 4.2 mM, which was similar to the previous data measured with histone H3K9 succinyl peptides [29]. However, little fluorescence signal was detected on SIRT5iso24, even at the higher concentration of substrate peptides (Fig. 2A). To further determine the desuccinylase activity of the four SIRT5
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
3
Fig. 1. Schematic diagram and structure of SIRT5 isoforms. A. Schematic diagram of human SIRT5 isoforms. SIRT5iso1 (iso 1) is the canonical sequence. SIRT5iso2 (iso2) differs from iso1 by the amino acids (AAs) at the C-terminal (iso 2, gray). SIRT5iso3 (iso3) and SIRT5iso4 (iso4) differ from iso1 by missing AAs 189e206 and 1e108. B. Structure of iso 1. The cartoon structure was generated based on the craystal structure of human SIRT5 (PDB: 3RIY) containing AAs 34e302. C. Missing AAs in iso 2 was marked in red. C-terminal replacement of AAs in iso 2 destroys the binding of C293 with NADþ molecule (blue). D. Missing AAs in iso 3 was marked in red. The missing sequence is close to C207 of the Zn finger binding domain (blue). E. Missing AAs in iso 4 was marked in red. Y102 and R105 in the missing sequence is key to the binding of acyl-group of substrate peptides (blue). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
isoforms, we took the in vitro succinylated BSA as substrate. Each of the four SIRT5 isoforms were incubated with the succinylated BSA with the presence of NADþ. We observed that SIRT5iso1, other than SIRT5iso24 efficiently removed the succinyl group on BSA (Fig. 2B). These results indicate that SIRT5iso1 was deacylase active, while SIRT5iso24 completely lost their deacylase activity, which was consistent with the above structural analysis. 3.2. Subcellular localization of the four human SIRT5 isoforms SIRT5 is one of the three mitochondrial sirtuins [3]. To
investigate the cellular localization of SIRT5 isoforms, we transiently expressed C-terminal Flag-tagged SIRT5 isoforms in COS7 cells. We observed a great overlap of anti-Flag signal with anti-COX IV signal (a mitochondrial marker) for SIRT5iso13, which suggests the exclusive mitochondrial localization of the three isoforms (Fig. 3). But there was little overlap for SIRT5iso4. Most of the antiFlag signal for SIRT5iso4 distributed equally in cytoplasm (Fig. 3). The results were consistent with prediction using the 36 length Nterminal MLS (Fig. 1A). All the isoforms (SIRT5iso13) containing MLS were localized in mitochondria, while the SIRT5iso4 missing MLS was cytoplasm localized.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
4
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 2. Deacylase activity of SIRT5 isoforms. A. Michaelis-Menten plot for each of the four SIRT5 isoforms mediated desuccinylation of synthesized peptides derivative. The synthesized peptide derivative ((2-Abz)-GVLK (succ)A [Y (3-NO2)]GV-NH2) contains a pair of fluorophore (2-Abz) and quencher (Y (3-NO2)). Each of the four overexpressed SIRT5 isoforms were purified from HEK293T cells, incubated with the peptide derivative at the presence of NADþ. Trypsin was used to cleave desuccinylated peptides, separating fluorophore from quencher. Relative fluorescence units (RFU) was measured in 96-well microtiter plates. Solid lines represent fit to Michaelis-Menten equation. All reactions were repeated for three times. B. Deacylase activity assay of SIRT5 isoforms using succinyl-BSA. Each of the purified SIRT5 isoforms were incubated with succinyl-BSA at the presence of NADþ. Western blot were determined using pan anti-succinyl lysine antibody (succinyl-K).
Fig. 3. Subcellular localization of SIRT5 isoforms. Each of the four Flag-tagged SIRT5 isoforms were transient expressed in COS7 cells. Overexpressed SIRT5 proteins, mitochondria, and nuclear were stained with anti-Flag, anti-COXⅣ antibodies, and DAPI. The merged pictures are in the right panel.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
5
Fig. 4. Tissue distribution of SIRT5 mRNA variants. A. A representative alignment of human SIRT5 EST sequences to SIRT5 transcript variants. Numbers above indicates the position of nucleotide in each mRNA sequence. Gray rectangle indicates distinct sequence. Red rectangle indicates well-matched parts of the EST sequence. Black rectangle indicates mismatched parts of the EST sequence. B. Tissue distribution analysis of SIRT5 mRNA variants based on expressed sequence tag (EST) of SIRT5. 191 ESTs of SIRT5 from various human tissues were obtained from GENBANK. They were matched to sequence of each of the four SIRT5 mRNA variants. The number of matched ESTs in each tissue were indicated. C and D. Measurement of purified SIRT5 isoforms by anti-SIRT5-AB1 (C) and anti-SIRT5-AB2 (D). E and F. Western blot detection of SIRT5 proteins in various human cell lines by anti-SIRT5AB1 (E) and anti-SIRT5-AB2 (F). Star: nonspecific bands. Arrow: position of endogenous SIRT5. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
6
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
3.3. Tissue distribution of the four human SIRT5 isoforms To characterize tissue distribution of human SIRT5 isoforms, a total of 191 expressed sequence tag (EST) of SIRT5 from various human tissues were obtained from GENBANK. Protein of SIRT5iso14 were translated by SIRT5 mRNA of variant 1e4 (Fig. 4A). Each of the 191 EST were matched to the four SIRT5 mRNA variants by the online BLASTn method. The BLAST results were manually refined to make sure that the full sequence of EST were matched to a continuous part of the sequence of the SIRT5 variants (Fig. 4A). For example, the EST AL557205 from blood was matched to all the four variants because of the tolerance of mismatch in the algorithm of BLASTn method. After manual refinement, the EST was matched only to variant 1, which indicated that AL557205 was a variant 1 special EST. Additionally, the EST BG328678 from intestine tissue matched perfectly to variant 1, 3, and 4, which suggested that this EST might be from variant 1, 3, or 4, and that the intestine tissue expresses at least one of the three SIRT5 variants. A total of 400 match between 191 ESTs from 29 human tissues and the four SIRT5 variants have been manually refined. Number of matches in each type of tissues have been summarized in Fig. 4B. It can be found that SIRT5iso1 expresses in almost all human tissues, except adipose, bladder and trachea, which is in consistence to previous reports [16,31]. ESTs for SIRT5iso2 were most frequently discovered in the brain, but less in all the other tissues (Fig. 4B). Interestingly, SIRT5iso2 was reported to be a primate specific isoform, which suggested the potential role of SIRT5iso2 in neuron system [28]. There are 13 tissues expressing all the four isoforms and only 3 tissues expressing one isoform. These results indicate SIRT5 gene is widely expressed, but expression pattern of different isoforms varies in tissues. To further explore the expression of SIRT5 isoforms, we measured the expression of SIRT5 isoforms in various human cell lines including uterus (HeLa), kidney (293T), liver (HHL5, L02, and HepG2), lung (A549, H1299, and 16HBE), and blood (K562). Two SIRT5 antibodies which recognize distinguished epitope of SIRT5 protein were used. The immunogen used to generate polyclonal anti-SIRT5-AB1 is the full-length human SIRT5 (SIRT5iso1) fusion protein, thus it detects all the four isoforms (Fig. 4C). However, the immunogen to generate anti-SIRT5-AB2 is synthetic peptides located within the middle of SIRT5 protein sequence which is missed on SIRT5iso3. Thus, anti-SIRT5-AB2 recognize three of the four isoforms except SIRT5iso3 (Fig. 4D). Whole cell lysis was first detected for expression of SIRT5 using anti-SIRT5-AB1 antibody. One band near the molecular weight of 34 KDa were detected. No bands were observed lower than 34 KDa. Molecular weight of SIRT5iso1 is 34 KDa. Although SIRT5iso3 is 11 AAs smaller than SIRT5iso1, their positions on gels are similar (Fig. 4C D). SIRT5iso2 and SIRT5iso4 are much smaller than that of SIRT5iso1 which can be distinguished by the position of bands. Thus, the 34 KDa band detected by anti-SIRT5-AB1 should be SIRT5iso1 or SIRT5iso3, and SIRT5iso2 and SIRT5iso4 were not expressed in the samples (Fig. 4E). There were also bands larger than 34 KDa which should be nonspecific bands for the antibody. To confirm the observation, we repeated the experiments and immunobloted the membrane with anti-SIRT5-AB2. Although nonspecific bands larger than 34 KDa were detected, there were still bands near 34 KDa which representing SIRT5iso1 or SIRT5iso3 (Fig. 4F). Interestingly, the band in HepG2 cells determined by anti-SIRT5-AB1 almost disappeared when detected by anti-SIRT5-AB2. As SIRT5iso3 can only be recognized by anti-SIRT5-AB1, we speculated that SIRT5iso3 should be the main SIRT5 isoform in HepG2 cells. Similarly, bands representing SIRT5iso2 and SIRT5iso4 were not detected. Although mRNAs of the four SIRT5 isoforms have been frequently detected in tissues like uterus, kidney, liver, lung and blood (Fig. 4B), proteins of SIRT5iso2
and SIRT5iso4 were not measured in cell lines originated from these tissues using two different antibodies (Fig. 4E F). 4. Discussion Here, we explored the tissue distribution, subcellular localization, and enzymatic activity of four human SIRT5 isoforms. We found that there was little deacylase activity of SIRT5iso24, comparing to SIRT5iso1. SIRT5iso13 containing the MLS localized predominantly in mitochondria, while SIRT5iso4 missing the MLS resided mainly in cytosol. Expression of different SIRT5 isoforms vary in different types of tissues. Sirtuins proteins were initially discovered as ADP-ribosyltransferase [32]. In the present work, we determined deacylase activity of SIRT5 isoforms using the substrates containing succinyl lysine. Although, little desuccinylase activity has been detected for SIRT5iso24, it is possible that they function as enzymes which catalyze ADP-ribosylation or remove other acyl groups like propionyl-, butyryl- or glutaryl-groups from substrate proteins. The other possibility is that SIRT5iso24 is enzymatic inactive, but regulatory active. They might regulate the activity of SIRT5iso1 through completing substrates binding. The SIRT5iso24 might also be the dominant-negative proteins of SIRT5iso1 and play roles in down-regulating activity of SIRT5iso1. Although mRNA of SIRT5 isoforms have been determined in various human tissues, there were little reports regarding existence of SIRT5iso24 proteins in human tissues. One possibility is that the mRNA of SIRT5iso24 are not translated or quickly degraded after translation. In this case, more work remains to be done to explore the function of these SIRT5 isoforms. It was reported that SIRT5iso2 was a primate-specific isoform [28]. Indeed, SIRT5 gene in mammalians other than primates encodes for only one SIRT5 protein. For example, there is one SIRT5 isoform in rodents, but five SIRT5 isoforms in chimpanzee and macaque monkey according to ENSEMBL database. Why primates develop various SIRT5 isoforms? The expression pattern in human tissues shown that SIRT5iso2 was widely and strongly expressed in brain tissue. The biological role of SIRT5iso2 in higher nervous activity remain to be explored. Further research on the function of SIRT5 isoforms should focus on particular tissues. Acknowledgements We thank Profs. Pingsheng Liu (IBP, CAS, China) and Zhonghong Gao (HUST, China) for valuable discussions, and Yan Teng (IBP, CAS, China) for technical assistance. Funding: This work was supported by the National Key R&D Program of China (2017YFA020550); the National Natural Science Foundation of China (31671175, 31771257); the Strategic Priority Research Programs (Category A) of the Chinese Academy of Sciences (XDA12030207); and the National Laboratory of Biomacromolecules (2017KF03). References [1] S. Greiss, A. Gartner, Sirtuin/Sir2 phylogeny, evolutionary considerations and structural conservation, Mol. Cell. 28 (2009) 407e415. [2] R.A. Frye, Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins, Biochem. Biophys. Res. Commun. 273 (2000) 793e798. [3] E. Michishita, J.Y. Park, J.M. Burneskis, J.C. Barrett, I. Horikawa, Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins, Mol. Biol. Cell 16 (2005) 4623e4635. [4] R. Mostoslavsky, K.F. Chua, D.B. Lombard, W.W. Pang, M.R. Fischer, L. Gellon, P. Liu, G. Mostoslavsky, S. Franco, M.M. Murphy, K.D. Mills, P. Patel, J.T. Hsu, A.L. Hong, E. Ford, H.L. Cheng, C. Kennedy, N. Nunez, R. Bronson, D. Frendewey, W. Auerbach, D. Valenzuela, M. Karow, M.O. Hottiger, S. Hursting, J.C. Barrett, L. Guarente, R. Mulligan, B. Demple, G.D. Yancopoulos, F.W. Alt, Genomic instability and aging-like phenotype in the absence of mammalian SIRT6, Cell 124 (2006) 315e329. [5] E. Ford, R. Voit, G. Liszt, C. Magin, I. Grummt, L. Guarente, Mammalian Sir2
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073
Y. Du et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
homolog SIRT7 is an activator of RNA polymerase I transcription, Genes Dev. 20 (2006) 1075e1080. A. Vaquero, M.B. Scher, D.H. Lee, A. Sutton, H.L. Cheng, F.W. Alt, L. Serrano, R. Sternglanz, D. Reinberg, SirT2 is a histone deacetylase with preference for histone H4 Lys 16 during mitosis, Genes Dev. 20 (2006) 1256e1261. C. Schlicker, M. Gertz, P. Papatheodorou, B. Kachholz, C.F. Becker, C. Steegborn, Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and Sirt5, J. Mol. Biol. 382 (2008) 790e801. J.L. Feldman, J. Baeza, J.M. Denu, Activation of the protein deacetylase SIRT6 by long-chain fatty acids and widespread deacylation by mammalian sirtuins, J. Biol. Chem. 288 (2013) 31350e31356. N. Ahuja, B. Schwer, S. Carobbio, D. Waltregny, B.J. North, V. Castronovo, P. Maechler, E. Verdin, Regulation of insulin secretion by SIRT4, a mitochondrial ADP-ribosyltransferase, J. Biol. Chem. 282 (2007) 33583e33592. K.A. Anderson, F.K. Huynh, K. Fisher-Wellman, J.D. Stuart, B.S. Peterson, J.D. Douros, G.R. Wagner, J.W. Thompson, A.S. Madsen, M.F. Green, R.M. Sivley, O.R. Ilkayeva, R.D. Stevens, D.S. Backos, J.A. Capra, C.A. Olsen, J.E. Campbell, D.M. Muoio, P.A. Grimsrud, M.D. Hirschey, SIRT4 is a lysine deacylase that controls leucine metabolism and insulin secretion, Cell Metabol. 25 (2017) 838e855 e815. J. Du, Y. Zhou, X. Su, J.J. Yu, S. Khan, H. Jiang, J. Kim, J. Woo, J.H. Kim, B.H. Choi, B. He, W. Chen, S. Zhang, R.A. Cerione, J. Auwerx, Q. Hao, H. Lin, Sirt5 is a NADdependent protein lysine demalonylase and desuccinylase, Science 334 (2011) 806e809. C. Peng, Z. Lu, Z. Xie, Z. Cheng, Y. Chen, M. Tan, H. Luo, Y. Zhang, W. He, K. Yang, B.M. Zwaans, D. Tishkoff, L. Ho, D. Lombard, T.C. He, J. Dai, E. Verdin, Y. Ye, Y. Zhao, The first identification of lysine malonylation substrates and its regulatory enzyme, Mol. Cell. Proteomics 10 (2011). M111 012658. M. Tan, C. Peng, K.A. Anderson, P. Chhoy, Z. Xie, L. Dai, J. Park, Y. Chen, H. Huang, Y. Zhang, J. Ro, G.R. Wagner, M.F. Green, A.S. Madsen, J. Schmiesing, B.S. Peterson, G. Xu, O.R. Ilkayeva, M.J. Muehlbauer, T. Braulke, C. Muhlhausen, D.S. Backos, C.A. Olsen, P.J. McGuire, S.D. Pletcher, D.B. Lombard, M.D. Hirschey, Y. Zhao, Lysine glutarylation is a protein posttranslational modification regulated by SIRT5, Cell Metabol. 19 (2014) 605e617. Z. Tong, M. Wang, Y. Wang, D.D. Kim, J.K. Grenier, J. Cao, S. Sadhukhan, Q. Hao, H. Lin, SIRT7 is an RNA-activated protein lysine deacylase, ACS Chem. Biol. 12 (2017) 300e310. S. Kumar, D.B. Lombard, Functions of the sirtuin deacylase SIRT5 in normal physiology and pathobiology, Crit. Rev. Biochem. Mol. Biol. 53 (2018) 311e334. T. Nakagawa, D.J. Lomb, M.C. Haigis, L. Guarente, SIRT5 Deacetylates carbamoyl phosphate synthetase 1 and regulates the urea cycle, Cell 137 (2009) 560e570. Y. Nakamura, M. Ogura, D. Tanaka, N. Inagaki, Localization of mouse mitochondrial SIRT proteins: shift of SIRT3 to nucleus by co-expression with SIRT5, Biochem. Biophys. Res. Commun. 366 (2008) 174e179. Y. Nakamura, M. Ogura, K. Ogura, D. Tanaka, N. Inagaki, SIRT5 deacetylates and activates urate oxidase in liver mitochondria of mice, FEBS Lett. 586 (2012) 4076e4081. M.J. Rardin, W. He, Y. Nishida, J.C. Newman, C. Carrico, S.R. Danielson, A. Guo, P. Gut, A.K. Sahu, B. Li, R. Uppala, M. Fitch, T. Riiff, L. Zhu, J. Zhou, D. Mulhern,
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
7
R.D. Stevens, O.R. Ilkayeva, C.B. Newgard, M.P. Jacobson, M. Hellerstein, E.S. Goetzman, B.W. Gibson, E. Verdin, SIRT5 regulates the mitochondrial lysine succinylome and metabolic networks, Cell Metabol. 18 (2013) 920e933. G. Colak, O. Pougovkina, L. Dai, M. Tan, H. Te Brinke, H. Huang, Z. Cheng, J. Park, X. Wan, X. Liu, W.W. Yue, R.J. Wanders, J.W. Locasale, D.B. Lombard, V.C. de Boer, Y. Zhao, Proteomic and biochemical studies of lysine malonylation suggest its malonic aciduria-associated regulatory role in mitochondrial function and fatty acid oxidation, Mol. Cell. Proteomics 14 (2015) 3056e3071. Y. Du, T. Cai, T. Li, P. Xue, B. Zhou, X. He, P. Wei, P. Liu, F. Yang, T. Wei, Lysine malonylation is elevated in type 2 diabetic mouse models and enriched in metabolic associated proteins, Mol. Cell. Proteomics 14 (2015) 227e236. Y. Nishida, M.J. Rardin, C. Carrico, W. He, A.K. Sahu, P. Gut, R. Najjar, M. Fitch, M. Hellerstein, B.W. Gibson, E. Verdin, SIRT5 regulates both cytosolic and mitochondrial protein malonylation with glycolysis as a major target, Mol. Cell 59 (2015) 321e332. Z.F. Lin, H.B. Xu, J.Y. Wang, Q. Lin, Z. Ruan, F.B. Liu, W. Jin, H.H. Huang, X. Chen, SIRT5 desuccinylates and activates SOD1 to eliminate ROS, Biochem. Biophys. Res. Commun. 441 (2013) 191e195. J. Park, Y. Chen, D.X. Tishkoff, C. Peng, M. Tan, L. Dai, Z. Xie, Y. Zhang, B.M. Zwaans, M.E. Skinner, D.B. Lombard, Y. Zhao, SIRT5-mediated lysine desuccinylation impacts diverse metabolic pathways, Mol. Cell 50 (2013) 919e930. S. Sadhukhan, X. Liu, D. Ryu, O.D. Nelson, J.A. Stupinski, Z. Li, W. Chen, S. Zhang, R.S. Weiss, J.W. Locasale, J. Auwerx, H. Lin, Metabolomics-assisted proteomics identifies succinylation and SIRT5 as important regulators of cardiac function, Proc. Natl. Acad. Sci. U. S. A. 113 (2016) 4320e4325. L. Zhou, F. Wang, R. Sun, X. Chen, M. Zhang, Q. Xu, Y. Wang, S. Wang, Y. Xiong, K.L. Guan, P. Yang, H. Yu, D. Ye, SIRT5 promotes IDH2 desuccinylation and G6PD deglutarylation to enhance cellular antioxidant defense, EMBO Rep. 17 (2016) 811e822. Y. Xiangyun, N. Xiaomin, G. Linping, X. Yunhua, L. Ziming, Y. Yongfeng, C. Zhiwei, L. Shun, Desuccinylation of pyruvate kinase M2 by SIRT5 contributes to antioxidant response and tumor growth, Oncotarget 8 (2017) 6984e6993. N. Matsushita, R. Yonashiro, Y. Ogata, A. Sugiura, S. Nagashima, T. Fukuda, R. Inatome, S. Yanagi, Distinct regulation of mitochondrial localization and stability of two human Sirt5 isoforms, Gene Cell. 16 (2011) 190e202. C. Roessler, C. Tuting, M. Meleshin, C. Steegborn, M. Schutkowski, A novel continuous assay for the deacylase sirtuin 5 and other deacetylases, J. Med. Chem. 58 (2015) 7217e7223. Y. Zhou, H. Zhang, B. He, J. Du, H. Lin, R.A. Cerione, Q. Hao, The bicyclic intermediate structure provides insights into the desuccinylation mechanism of human sirtuin 5 (SIRT5), J. Biol. Chem. 287 (2012) 28307e28314. D.B. Lombard, F.W. Alt, H.L. Cheng, J. Bunkenborg, R.S. Streeper, R. Mostoslavsky, J. Kim, G. Yancopoulos, D. Valenzuela, A. Murphy, Y. Yang, Y. Chen, M.D. Hirschey, R.T. Bronson, M. Haigis, L.P. Guarente, R.V. Farese Jr., S. Weissman, E. Verdin, B. Schwer, Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation, Mol. Cell Biol. 27 (2007) 8807e8814. J.C. Tanny, G.J. Dowd, J. Huang, H. Hilz, D. Moazed, An enzymatic activity in the yeast Sir2 protein that is essential for gene silencing, Cell 99 (1999) 735e745.
Please cite this article in press as: Y. Du, et al., Tissue distribution, subcellular localization, and enzymatic activity analysis of human SIRT5 isoforms, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.06.073