Tissue plasminogen activator mutants lacking the growth factor domain and the first kringle domain: I

Fibrindy~is (1991) 5, 17-29 01991 Longman Group UK Ltd

Tissue Plasminogen Activator Mutants Lacking the Growth Factor Domain and the First Kringle Domain: I DNA Constructions, Expression in Mammalian Cells, Protein Structure, Fibrin Affinity and Enzymatic Properties

G. Pohl, C. Sterky, A. Attersand,

E. Nyberg, B. Lowenadler,

L. Hansson

SUMMARY. Six variants of tissue-type plasminogen activator (t-PA) were produced in mouse Cl27 cells using a bovine papilloma virus expression vector. All variants lacked the growth factor (G) domain and the first kringle domain (Kl) and three of the variants also lacked the finger domain (F). Furthermore, the specific changes, LysZ,,-+Val and Asn44s-+Gln were introduced into some of the molecules. The variants were denoted K2P, K2P(Va1277), K2P(Gln448), FK2P, FK2P(Va1277), and FK2P(Gln448). Amino acid sequence analyses revealed that the variants were proteolytically processed in the amino terminus and at Arg275-Ile276 in the same way as the full sized molecule. A proteolytically sensitive site was identified in the F domain at Arg2,-Ser2s. The two variants that lacked glycosylation at AsnMs, K2P(Gln448) and FK2P(Gln448), were cleaved at Arg449-Thr450, indicating that the oligosaccharide normally present at Asna protects this site against proteolysis. The fibrin affinity for all variants was markedly reduced compared with normal t-PA. The plasminogen activator activity of all variants was stimulated by cyanogen bromide fragments of fibrinogen. In an indirect chromogenic assay K2P and K2P(Va1277) showed specific activities that were 23% and 36%, respectively, of that of wild type t-PA, while the corresponding non-glycosylated variant K2P(Gln448) was as active as t-PA. The activity of the three F domain-containing variants were between 88 and 98% of the value determined for t-PA. When the specific activity was determined with the fibrin plate assay all variants were found to have higher specific activities than t-PA (1.8-4.7 fold). The lack of correlation between the activity of t-PA and the variants in these two assays indicate that the reaction mechanism may differ between the variants and wild type t-PA. The kinetic constants K, and kcat were determined for two-chain forms of t-PA and the variants with the chromogenic peptide substrate D-Ile-Pro-Arg-pNA. The results show that the t-PA heavy chain is not affecting the reaction with small peptide substrates as the K, and kcat values were essentially identical for t-PA, K2P, and FK2P (K,, 0.18-0.21 mM and k cat, 8.8-11.1~s’). The values for the two non-glycosylated variants K2P(Gln448) and FK2P(Gln448) were 0.28mM, 9.4~~~ and 0.24mM, 5.3~~‘, respectively. Interestingly, the Va1277 variants showed significantly reduced K, values, suggesting that LysZT7 is important for the substrate interaction. For the variant K2P(Va1277) K, and kcat were 0.06mM and 6.5~~I, respectively, and for FK2P(Va1277) the corresponding values were 0.06mM and 6.0~~~. KEYWORDS. t-PA variants. Domain deletions. Proteolytic Kinetic properties. Peptide substrate.

Tissue plasminogen activator (t-PA) is an essential component of the fibrinolytic system in the blood.’ It is a serine protease that activates plasminogen to plasmin by a specific cleavage of the Arg560-Va1561 peptide bond in the plasminogen molecule.’ Plasmin, in turn, is responsible for the degradation of fibrin, the main protein constituent of thrombi. G. Pohl, Hansson,

C. Sterky,

A. Attersand,

E. Nyberg,

B. Liiwenadler,

cleavage. Fibrin binding.

Enzymatic

activity.

The successful use of plasminogen activators such as streptokinase and t-PA for the treatment of cardiovascular disorders has been described in several recent clinical trials.3,4 t-PA is synthesised by the vascular endothelium. It is secreted as a single-chain polypeptide, but is readily converted by plasmin into a two-chain disulfidelinked form.5 Both forms are enzymatically active.6,7 t-PA binds to fibrin’ and fibrin is required for efficient plasminogen activation by t-PA.9

L.

KabiGen AB, S-112 87 Stockholm, Sweden. 17

18 t-PA Mutants

The amino acid sequence of human t-PA has been determined from cDNA nucleotide sequencestoT” and by direct protein sequencing.i2,13 The secreted single-chain form of t-PA has been isolated as a 530 amino acid protein12 as well as a shorter 527 residue polypeptide. l4 Although the amino acid numbering of proteins usually is based on the longest form secreted, t-PA is most commonly numbered according to the shorter 527 residue form. The two-chain form of t-PA is generated by proteolytic cleavage between Arg275 and Ile276. The N-terminal half of the molecule consists of 275 residues (heavy chain) and the C-terminal half, containing the active site, consists of 252 residues (light chain). The heavy chain of t-PA contains several domains that are homologous to structures found in other plasma proteins. Starting from the amino terminus, the first 49 residues of the heavy chain show sequence homology with the fibrin binding ‘finger’ domains (F domain) in fibronectin. Next is a sequence of 37 amino acid residues that is homologous with human and murine epidermal growth factor (G domain). Such G domains have been identified also in protein C, protein S, factor IX, factor X, factor XII and urokinase. The heavy chain also contains two ‘kringle’ structures of about 80 residues each (Kl and K2), similar to those found in plasminogen, prothrombin, factor XII and apolipoprotein(a). Finally, the light chain is homologous to serine proteases such as chymotrypsin, trypsin and plasmin and is often referred to as the P domain. For review of structural domains in different plasma proteins seei5,16 The structure and function properties of t-PA mutants have recently been reviewed by Pannekoek et a1.17 Various functions of t-PA have been attributed to specific domains of the molecule. By use of classical biochemical methods the P domain has been shown to be responsible for the enzymatic activity” whereas the fibrin affinity of t-PA is provided for by domains in the heavy chain. More recently, recombinat DNA techniques have been employed in order to construct and produce various deletion mutants of t-PA for the elucidation of the specific functions of the various domains. The K2 domain and the F domain have been shown to be involved in the fibrin directed properties of t-PA. l9 The function of Kl has been disputed. One research group could not demonstrate interaction with fibrin for Kl,*’ whereas another group found Kl and K2 to be equal in their interaction with fibrin. *’ The G domain in t-PA has not as yet been attributed to any specific function, but deletion mutants lacking the F and the G domains have been shown to have a longer in vivo half-life in rats and rabbits than normal t-PA.22,23 The oligosaccharides of t-PA have also been shown to be involved in the clearance of this protein by the liver.24,25 Site specific mutagenesis has been used to change the glycosylation sites Asnl17 and Asn448, respectively. 26,27In both cases the mutant activators,

lacking glycosylation at these sites, displayed an increased in vivo half-life compared with the normal t-PA. In order to investigate the functions of the different domains of t-PA, aiming for a new thrombolytic agent with improved clinical properties, we have constructed and produced a series of different deletion mutants of t-PA. In this article we describe the construction of six t-PA molecules lacking the G and Kl domains, their expression in mammalian cells, molecular characterisation, fibrin interactions and enzymatic properties. The in vitro enzymatic properties in plasma and the in vivo fibrinolytic activity and pharmacokinetic properties of the variants are described in an accompanying paper.*’ MATERIALS

The cDNA coding for t-PA was derived from a human melanoma cell line (Bowes). A 2378 bp DNA fragment containing the coding sequence of t-PA was cloned as a HindIII/BamHI fragment in the plasmid pKGE22 (Fig. 1). Enzymes and reagents used for DNA constructions were obtained from Boehringer Mannheim GmbH and New England Biolabs. Synthetic oligonucleotides were synthesised by KabiGen AB.29 Tissue culture media and plastics were from Flow laboratories and Costar, USA. Bovine fibrinogen, Triton X-100, 3,3’,5,5’-tetramethylbenzidine (TMB), and G418 was obtained from Sigma Chemicals, USA. Sepharose@ and Sephadex@ chromatography media were from Pharmacia, Sweden. Human fibrinogen, human serum albumin, and the chromogenic peptide substrates H-D-Val-Leu-Lys-pNA (S-2251) and H-D-Ile-Pro-Arg-pNA (S-2288) were from Kabi Diagnostica, Sweden. Human Glur-plasminogen was obtained from Dr Per Wall& Umeb University, Umeb, Sweden. Human thrombin (Topostasin@) was from Hoffman-La Roche, Basle, Switzerland. Tween 80 and Tween 20 were purchased from KEBO, Sweden. The wild-type human t-PA that was used as reference substance in all experiments in this work was single-chain and two-chain forms of melanoma t-PA. The melanoma t-PA as well as polyclonal antibodies and conjugates used in the enzyme-linked immunosorbent assay (ELISA) were obtained from Biopool, Umea, Sweden. Aprotinin (Trasylol’@) was purchased from Bayer, AG, West Germany. METHODS Mutagenesis

The plasmid pKGE22 containing the cDNA coding for the full sized human t-PA was used to construct the six variants. Nucleotide number 1 was assigned to the A in the initiation codon ATG, and amino acid

Fibrinolysis HindIII

(-130) ,sg111

(103)

pKGE22

IBSIM

(2.248)

BamHI

BglII 1

5

174

171

184

SerTyrGlnValIleSerGluGlySerSerAspCysTyrPheGlyGln Oligonucleotide

Ia Ib

S'-GATCTTACCAAGTGATCTCTGAGGI;ATCCAGTGACTGCTACTTTGGGCAG AATGGTTCACTAGAGACTCCCTAGGTCACTGACGATGAAACCCGTC EcoRI 7.05

GlySerAlaTyrArgGlyThrHisSerLeuThrGluSerGlyAlaSeKCysLeuProTrpAsn GGGTCAGCCTACCGTGGCACGCACAGCCTCACCGAGTCGGGTGCCTCCTGCCTCCCGTG~ CCCAGTCGGATGGCACCGTGCGTGTCGGAGTGGCTCAGCCCACGGAGGACGGAGGGCACCTT~

-5'

277 . . . Gin tPA

sequence

Oligonucleotide

Phe

. . . CAG TTT

Arg

Ile

CGC ATC

Lys

Leu

.. .

AAA GGA GGG CTC

Gly

Gly

.. .

III III Ill *** III AAA GCG TAG CAC CCT

II

III I CCC G -5'

& va1 448 tPA

Sequence

. . . Ser

Gin

. . . TCA

CAA CAT TTA III

Oligonucleotide

III

GTT

His

Leu

Leu

Asn

Arg

Thr

Val

Thr

Asp

CTT AAC AGA ACA GTC ACC GAC

Ill III II* *I* III III GTA AAT GAC GTC TCT TGT

.. . _..

III III CAG TGG -5'

.b Gh

. . . Cys tPA

sequence

Oligonucleotide

His

Ser

Val

47

40

Pro

Val

Lys

Ser

. . . TGC CAC TCA GTG CCT GTC AAA AGT IV

III Ill GTG AGT

III *** **I III CAC CCT AGG TTT -c

z

Gly

Ser

Cys

Ser

.. .

TGC AGC

.. .

III III TCA AGC -5'

I LlHI

1 Map of the plasmid pKGE22 showing the t-PA cDNA with the restriction enzyme cleavage sites used for the construction of the six t-PA variants (see Methods). Shown below are the synthetic oligonucleotides used as linkers and for site directed mutagenesis.

Fig.

19

20 t-PA Mutants Table 1 The amino acid sequence of the t-PA variants in relation to the normal t-PA molecule Compound

Residues deleted

Residues changed

KZP K2P(Va1277) K2P(Gln448) FK2P FK2P(Va1277) FK2P(Gln448)

6-173 6-173 6-173 47-175 47-175 47-175

Asnl77+Ser, Asnl77-+Ser, Asnl77-+Ser, Asnl77-+Ser, Asnl77+Ser, Asnl77+Ser,

numbering is according to Pennica et a1.l’ A simplified restriction map is shown in Figure 1, indicating the relevant restriction sites, and below are the sequences of the synthetic oligonucleotides that were used for the constructions. For the construction of the deletion variant K2P, a restriction fragment encoding the complete F, G and Kl domains as well as part of the K2 domain was removed. The lost portion of the K2 region was restored and fused to the gene segment encoding the t-PA signal peptide sequence using two synthetic oligonucleotides (Ia and Ib in Fig. 1). These oligonucleotides were designed to (1) introduce a BamHl site immediately prior to the K2 region, thereby changing amino acid 177 from Asn to Ser and (2) to remove the putative glycosylation site in K2 by substituting Asnlsd for Gln. The variants K2P(Va1277) and K2P(Gln448) were both made from K2P, using site directed mutagenesis with mismatch primers on single stranded K2P DNA subcloned into Ml3 mp18. In K2P(Va1277) the LysZT7 residue was changed to Val with the synthetic mismatch oligonucleotide II. The K2P(Gln448) variant was obtained by exchanging Asn at position 448 for Gln using oligonucleotide III. In order to construct the genes encoding the t-PA variants FK2P, FK2P(Va1277), and FK2P(Gln448) a BamHZ site was first introduced at the junction between the finger and the growth factor domain in the t-PA cDNA by site directed mutagenesis using oligonucleotide IV. This changes amino acids 46 and 47 from Pro-Val to Gly-Ser. The newly introduced site was cleaved with BamHZ and the DNA fragment encoding the signal peptide and the finger domain was isolated and ligated to the BamHZ site preceeding the K2 region of K2P, K2P(Va1277) and K2P(Gln448), respectively. The modifications of all six variants in relation to the amino acid sequence of full-sized human t-PA are summarised in Table 1. Expression Vector The DNA constructs coding for the modified t-PA variants were cloned into a bovine papilloma virusbased expression vector. This vector contains the entire mouse metallothionein gene1 (mMT-1) upstream regulatory element,30 in front of the fragment

Asn184+Gln Asn184-+Gln, Asnl&l+Gln, AsnlW+Gln AsnlN-+Gln, Asn184-+Gln,

Lys277-+Val Asn448+Gln Lys277+Val Asn44&Gln

encoding the t-PA variants. Downstream is a SV40derived sequence containing the small t intron and polyadenylation signals. 31 The heterologous transcriptional unit was combined with the entire bovine papilloma virus type-l genome (BPV-1) and pML2d .32 Transfection Mouse Cl27 cells (ATCC CRL 1616), cultured in DMEM supplemented with 10% fetal calf serum (FCS), were transfected with the expression vector together with a vector that harbours the neomycin resistance gene according to the calcium phosphate method essentially as described.33 Transfectants were selected in medium containing 1.5mg/ml of G418. Typically about 50 clones were isolated for each of the variants. When the cells had reached confluency they were tested for expresson of t-PA using fibrin plates. Samples that showed fibrinolytic activity on fibrin plates were further analysed for production by ELISA. Cell Culture The best producing clones were cultured in roller bottles (surface area 900cm*) in DMEM 10% FCS. When the cells had reached confluency the medium was replaced by 200 ml DMEM 1% FCS. The medium was harvested every 3-4 days. The harvested medium was centrifuged to remove cells and debris and stored frozen at -20°C until purification. Purification The collected harvest medium (lO-30L) was thawed, pooled and supplemented with 0.01% Tween 80 and the t-PA variants were adsorbed overnight at 4°C using a Sepharose-coupled monoclonal anti t-PA antibody. 34The immunosorbent gel (lOOm1, containing 2.5 mg antibody/ml gel) was collected and washed in a glass funnel with 0.1 M sodium phosphate pH7.3, containing 0.05M KSCN and 0.01% Tween 80. The gel was packed in a column and the bound material was eluted with 3M KSCN in the washing buffer. Fibrinolytically active fractions were pooled, concentrated in an ultrafiltration cell (Amicon, YMlO) and

Fibrinolysis

21

chromatographed on a 5 x 90cm Sephadex GlOO column equilibrated with 1M ammonium bicarbonate. Again the fibrinolytically active fractions were pooled, then concentrated by ultrafiltration to OS1.5mg/ml and stored at -70°C.

(Gln448), and 45000 for FK2P, FK2P(Va1277), FK2P( Gln448). Concentrations of fibrinogen and CNBr digested fibrinogen fragments were determined by measurement of absorbance at 280nm using A$,2 = 15,1.36

Structural

Fibrin Binding

Characterization

The purity of the preparations was analysed by SDS polyacrylamide gel electrophoresis, using gradient gels (420% acrylamide) for gels stained with Coomassie Brilliant Blue. For enzyme autography on fibrin plates the slab gels (isocratic, 10% acrylamide) were incubated for 2 h at room temperature in two changes of lOOmlO. M sodium phosphate, 0.15M sodium chloride pH 7.4 (PBS) with 2.5% Triton X-100 in order to remove the SDS and to renature the activators before a plasminogen-containing fibrin agarose plate was placed on the gel. After incubation at 37°C for 4 to 6h, fibrinolysis was observed. N-terminal sequence determinations of the preparations were performed using a gas-liquid protein sequencer, Applied Biosystems 470A. Protein Quantitation ELISA was used for quantitation of t-PA and t-PA variants in the culture medium. Microtiter wells (Immunoplade I, Nunc, Denmark) were coated with 200~1 of goat anti melanoma t-PA IgG, 2.5 Fg/ml in 50mM NaHCOs, pH 9.6 overnight at 4°C. Residual protein binding sites were blocked with 200 ~JLI0.5% bovine serum albumin (BSA, RIA grade, Sigma) in PBS for 1 h at room temperature. The wells were washed three times with PBS containing 0.05% Tween 20 (PBS/Tween). Samples and standards were diluted in PBSiTween containing 0.1% BSA and incubated at 37°C for 2h in a shaker incubator. After washing three times with PBS/Tween, a conjugate consisting of anti t-PA IgG and horse radish peroxidase diluted 1000 fold in PBS/Tween with 0.25% BSA was added (200~1) and was incubated at 4°C overnight. Substrate, O.lmg/ml of 3,3’,5,5’,-tetramethylbenzidine35 freshly prepared in 0.1 M Na acetate pH 6.0, was mixed with 30% Hz02 (2 ~1 for 15 ml substrate), and 200 p,l was added to each well. The plates were developed at room temperature in the dark for about 30 min. The reaction was stopped by the addition of 5Ol~l2.25M HzS04 and absorbance was read at 450nm with a Dynatech MR700 photometer. Normally the sample was added as 20 ~1 to the wells prefilled with 180~1 PBS/Tween with 0.05% BSA. By this procedure the linear assay range is 5-30ng/ml of t-PA in the sample. The concentrations of plasminogen, t-PA, and t-PA variants were determined with a Beckman 6300 amino acid analyzer after acid hydrolysis. The following M, were used for calculation of molar concentrations: 92000 for Glui-plasminogen, 60000 for normal t-PA, 40000 for K2P, K2P(Va1277), K2P-

Human fibrinogen (grade L, 98% clottable, Kabi) was treated with lysine-Sepharose to remove plasminogen . Fibrinogen at final concentrations of 0-3.2mg/ml was mixed with trasylol (50KIE/ml), human serum albumin (1 mg/ml) and plasminogen activators (1 nM) in Tris/HCl 0.05M pH 7.4, NaCl 0.12M, Tween 80 0.01%. Clots were formed by the addition of 1 NIH unit of human thrombin. After incubation at 37°C for lh, the clots were compacted by centrifugation at 20000g for 10 min. Supernatants were analysed for t-PA antigen with ELISA as described. Enzymatic Activity Fibrin plates were prepared by adding human thrombin (final concentration 0.1 NIH units/ml) to a warm (60°C) solution of 1% agarose in PBS with 1.5 mg/ml bovine fibrinogen, and carefully pouring the fibrin-agarose solution on a plastic film (GelBond, Pharmacia). After a few minutes a l-2mm gel layer is formed. Wells were punched in the gel and the sample or serial dilutions of t-PA reference, 10~11, were placed in the holes. The plates were then incubated in a humidity chamber at 37°C for 12-15 h. Zones of fibrinolysis were measured and the area of the lysis zones were plotted against the logarithm of the activator concentration. Indirect chromogenic assay was performed in 50mM Tris/HCl, 1OOmM NaCI, 0.01% Tween 80 pH 7.4 (TBYTween80) using human Glu-plasminogen (1 PM), CNBr digested human fibrinogen (0.3mg/ml) and the chromogenic substrate S-2251 (0.5mM). Dilutions of plasminogen activator were mixed with the reagents in microtiter wells, with or without CNBr digested fibrinogen, and the absorbance at 410nm (corrected for turbidity at 490nm) was measured after 2h incubation at room temperature. The activity was compared with a standard preparation of single-chain melanoma t-PA that had been calibrated against the international t-PA reference preparation 83/517 (National Institute for Biological Standards and Control, London). Kinetic Constants with Chromogenic Substrate

Peptide

The t-PA variants were completely converted to two-chain molecules by treatment with Sepharoseplasmin. The conversion was checked by SDS/ PAGE under reducing conditions (not shown). The activator molecules (final concentration 200ng/ml)

22 t-PA Mutants

to the antibiotic G418, a large number of t-PA producing clones could conveniently be isolated. Typically more than 50% of the clones that survived in G418 were found to produce active t-PA (or t-PA variants). The best producing clones were propagated further and stable producers were cultured in roller bottles. After the cells had reached confluency the concentration of fetal calf serum was reduced to 1% (harvest medium) and 200ml medium was changed every 3 or 4 days. The conditioned medium contained 2-5 mg/L of recombinant protein as determined by ELISA and the harvest procedure was repeated twice every week for up to 3 months. The variants were purified using immunoaffinity chromatography and size exclusion chromatography. The monoclonal antibody AFlO has previously been shown to be useful for the purification of melanoma t-PA.34 This antibody was here found to bind all of the six t-PA variants, which were purified with a total yield of 30-50%.

were mixed with different concentrations (0.1-4mM) of the chromogenic peptide substrate D-Ile-Pro-ArgpNA (Kabi S-2288) in 50mM Tris/HCl 0.01% Tween 80, pH 8.3, and the absorbance increase at 410nm was measured at ambient temperature (about 22°C) during 30 min. The initial reaction rate was determined, and the kinetic constants K, and k,,, were calculated from Lineweaver-Burk plots. RESULTS Construction

of the t-PA Variants

The modifications of the t-PA variants in relation to the full sized t-PA are summarised in Table 1. The strategy to construct the molecules is described in the Methods section. In order to ensure proper signal/pro peptide processing and secretion of the variants we included the first five amino acid residues of the mature t-PA protein. For the deletion of the G and the Kl domain we wished to follow the intromexon boundaries of the gene. 37 Thus, in the K2P group of the variants IleS was joined to Ser174. The corresponding intromexon junctions map at Va14 and Glyi76, respectively, For the FK2P group a BarnHI site was introduced between the F and the G domain (oligonucleotide IV) which allowed fusion of the F domain at Va146 to Glyr76. Here the intronlexon junctions map at Serfi and Glares. All sites that were changed in the construction of the six variants were checked by restriction enzyme cleavages and nucleotide sequencing.

Structural

The purity and the chain structure of the isolated t-PA variants were studied by SDS/PAGE performed under non reducing or reducing conditions (Figs 2A and 2B). The non reduced samples showed one main protein band at the expected size for each of the variants. The faster migration of K2P(Gln448) and FK2P(Gln448) is consistent with the lack of oligosaccharide chains at Asn44s in these variants. The reduced samples (Fig. 2B) show a more complex pattern. All samples, including the melanoma t-PA reference, were mixtures of single-chain and twochain forms. K2P was prepared with aprotinin (50KIE/ml) in the harvest medium whereas the other

Expression and Purification

With the protocol described in the Methods section, utilizing cotransfection of the BPV vector containing the t-PA variant with a vector that confers resistance

12

3

4

Characterisation

5

6

7

Mr x 10

77 66 45

30

A

17 12

-3

Fibrinolysis 23

1234567

Mr x 10

-3

77 66 45 30 17 12

12

3

4

5

6

7

C

Fig. 2 SDS-PAGEof the purified variantsfollowed by CoomassieBrilliant Blue staining (A and B) and fibrin zymography (C). The sampleswere separatedunder non-reducingconditions (A and C) or reducingconditions(B). The samplesin the lanesare, 1. single-chainmelanoma t-PA, 2. K2P, 3. K2P(Va1277),4. K2P(Gln448),5. FK2P, 6. FK2P(Va1277),7. FK2P(Gln448). variants were produced in the absence of protease inhibitors. As expected, the addition of aprotinin resulted in a preparation of K2P that was mainly single chain. This is in contrast to K2P(Va1277) and K2P(Gln448) which were mainly in the two-chain form. In the latter variant the absence of glycosylation in the P domain is indicated by a faster migration in the gel. The N-terminal part, K2, migrates as a single band at the bottom of the gel (Fig. 2B lanes 2-4). The F domain-containing variants

(Fig. 2B lanes 5-7) were also mixtures of single chain and two chain molecules. However, the band pattern for these molecules indicate at least one additional proteolytic cleavage. This cleavage appears to have occurred in the FK2 part since the P domains migrate identically with the P domains of the K2P variants. The preparations were further analysed by SDS/ PAGE fibrin autography (Fig. 2C). A single zone of fibrinolysis at the expected size was obtained for each preparation.

+l

2

3

t 100%

Gly-Ala-Arg-Ser-Tyr-Gln-Val-lle-Cys-

t 10 0 %

Gly-Ala-Arg-Ser-Tyr-Gln-Val-lle-Cys-

t 100%

Gly-Ala-Arg-Ser-Tyr-Gin-Val-lie-Cys-.....

-3

4

t 60 %

5

26

F

t 40 %

. . . . . -Arg-Ser-Asn-...-Val-Gly-

t 30%

. . . . .-Arg-Ser-Asn-...-Val-Gly-

t 3 0%

K2

t 90 %

-Arg-Ile-Lys-

t 70 %

. . . . . . . . . -Arg-lie-Val-

t 10%

. . . . . . . . . -Arg-Ile-Lys-

P

t 20%

. . . . . . . . -Gin-Arg-Thr-Val-

. . . . . . . . -Asn-Arg-Thr-Val-

. . . . . . . . -Am-Arg-Thr-Val-

_.............._

. . . . ..__........

-Pro

-Pro

. . . . . . . . . . . . . . . . -Pro

t 100%

. . . . . . . . . -Arg-Ile-Lys-

t 6 0%

. . . . . . . . . -Arg-Ile-Val-

t a 0%

. . . . . . . . . -Arg-Ile-Lys-

-Asn-Arg-Thr-Val-

t 40 %

. . . . . . . . . -Gin-Arg-Thr-Val-

,........

. . . . . . . . . -Asn-Arg-Thr-Val-

-Pro

. . . . . . . . . . . . . . . -Pro

. . . . . . . . . . . . . . . -Pro

..,._......_...

29 . . . . . . . .46 17 6 . . . . . . . . . . . . 275 276 277 . . . . . . . . . . . . 448 449 450 . . .. . .. .. . .. . . . . . . . . . . . . . .527

-Arg-Ser-Asn-...-Val-Gly-

6 . .. . . . . .. .27

t 100%

Gly-Ala-Arg-Ser.Tyr-Gln-Val-lie-Ser-.........

t 100%

Gly-Ala-Arg-Ser-Tyr-Gln-Val-lle-Ser-

t 40%

Gly-Ala-Arg-Ser-Tyr-Gln-Val-lle-Ser-

P

Fig. 3 Structure of the six t-PA variants. Arrows indicate the cleavage sites identified by N-terminal sequence analysis of the purified preparations and the relative occurrence of each cleavage is shown in %.

FKZP(o

m.

KZPIW

w

K2

Fibrinolysis

The N-terminal amino acid sequence analysis of the preparations further clarified the chain structure and the proteolytic cleavages that were indicated by the electrophoretic analysis. Between two and four sequences were obtained, all which were easily identified, and the sites of proteolytic cleavage could be deduced and quantitated. The results are summarised in Figure 3. As expected all variants except K2P, which was prepared in the presence of protease inhibitor, were to a large extent cleaved after ArgZT5 into a two-chain form. K2P which was mainly in the single-chain form (10% cleaved) displays two N-terminal sequences, one starting at G~Y-~ and one starting at Ser+r. This three residue extension was not observed in any of the other preparations, indicating that the tripeptide is readily removed by proteases in the culture medium in conjunction with the two-chain cleavage. The proteolytic cleavage in the amino terminal part of the F domain-containing variants that was indicated by the electrophoretic analysis was identified as a cleavage at the Arg27-Ser28 peptide bond. Furthermore, the two non-glycosylated variants displayed an additional proteolytic cleavage at Arg449-Thr450. This indicates that the oligosaccharide at Asn@ protects an exposed and proteolytically sensitive site in the P domain. Fibrin Binding The relative affinity of the variants to forming fibrin clots was studied by mixing 1 nM of the activators with fibrinogen (0-3.2mg/ml), clotting the mixture by addition of thrombin and calculating the fraction bound by assaying the amount of antigen present in the supernatant. The result is illustrated in Figure 4. All variants showed a reduced fibrin affinity compared with single-chain as well as two-chain forms of the full sized t-PA. In control experiments no binding of rz51-BSA could be seen at any of the fibrinogen concentrations used. At 1.6mg/ml of fibrinogen, 73-t-5% of set-PA was bound and 68+2% of the tct-PA. Under the same conditions 35_+6% of the variant FK2P(Gln448) was bound and 1742% of K2P. The values represent mean values k standard deviations from a total of nine analyses. The other four variants range between 21 and 29% bound at this

25

fibrinogen concentration. A comparison of the relative fibrin binding between the different variants showed that the F domain-containing variants bound slightly better than the corresponding variants without the finger domain. We also found that the non-glycosylated forms, FK2P(Gln448) and K2P(Gln448), consistently bound better to fibrin than the corresponding glycosylated forms. Enzymatic Activity of the Variants in Two in vitro Assays The specific enzymatic activity of the variant preparations was determined with an indirect chromogenic assay in the presence or absence of CNBr digested fibrinogen as stimulator. The results are summarised in Table 2. in the presence of fibrinogen fragments, four of the six variants showed specific activities (500-6OOU/Fg) that are very similar to the melanoma t-PA (58OU/kg). However, the variants K2P and K2P(Va1277) yielded significantly lower values, 132 and 206U/kg respectively. In order to investigate if the relatively low activity of these two variants was simply resulting from differences in the amount of single-chain vs two-chain molecules in the preparations, equimolar concentrations of the six activators completely converted into the two-chain form by plasmin Sepharose were compared in the indirect chromogenic assay. The progressive increase of absorbance at 410nm was followed in samples containing 0.3nM plasminogen activator under the conditions given for the indirect chromogenic assay in the Methods section. Figure 5A clearly shows that, in the presence of stimulator, K2P and K2P(Va1277) is less active compared with K2P(Gln448) and wildtype t-PA. The absorbance curves of the F domaincontaining variants almost overlapped with the curve for t-PA (Fig. 5B), indicating that they are approximately as active as t-PA in this assay. In the absence of stimulator the activity was low for all variants and very similar to that of the melanoma t-PA (Table 2). The stimulation factor calculated as the specific activity in the presence of stimulator divided by the corresponding value for the activity in the absence of stimulator was lower for the group of

Table 2 The specific activity of the t-PA variants determined by indirect chromogenic assay with or without fibrinogen fragments (mean values _t standard deviation, n=3), and by fibrin plate assay

Compound set-PA K2P K2P(Va1277) K2P(Gln448) FK2P FK2P(Va1277) FK2P(Gln448)

Specific activity +CNBr fbg -CNBr wh%) FJh.4 580 4+1 132k 9 2+1 206+23 6+2 602+45 12+3 568+17 4+1 531k18 6+1 512+25 6kl

fbg

Stimulation factor

Relative specific activity (%) Indirect chromoFibrin plate genie assay assay

145 66 34 50 142 89 85

100 23 36 104 98 92 88

100 340 420 470 200 180 188

26 t-PA Mutants

80

P z

60

3

1 2 FIBRINOGEN (mglml)

-

s&PA

-

tct-PA

_fl_

K2P

U

K2P-V277

+

K2P-Q448

_f_

FK2P

_t_

FK2P-V277

_t_

FK2P-Q448

3

Fig. 4 Binding of single-chain t-PA, two-chain t-PA and the six t-PA variants to forming fibrin clots. Samples of 1 nM (final concentration) of each activator were mixed with the indicated concentrations of fibrinogen. After clotting with thrombin the activator concentration in the supernatant was determined as described in the Methods section. Each data point represent the mean value of nine determinations.

variants lacking the F domain (34-66-fold stimulation) than for the corresponding variants with the F domain (85-142-fold). This indicates that the fibrin selectivity, especially in the case of the F domain-containing variants, is maintained to a large extent although the fibrin binding ability is significantly reduced. The specific activity determined on fibrin plates differs significantly from the results obtained by the indirect chromogenic assay as shown in Table 2 where the relative specific activity is compared with melanoma t-PA for the two assays. The specific activity on fibrin plates is 3.4 to 4.7-fold higher for the K2P type of variants and 1.8 to 2-fold higher for the FK2P group when compared with melanoma set-PA. In contrast, in the indirect chromogenic assay none of the variants showed a higher specific activity than t-PA.

Kinetic Constants Determined Peptide Substrate

with Chromogenic

In order to further study the enzymatic properties of the variants we determined the Michaelis constants K, and k,,, using the amidolytic peptide substrate D-Ile-Pro-Arg-pNA. As it has been shown that single-chain and two-chain forms of t-PA differ in their kinetic properties with this type of substrate we first converted all variants completely to the twochain form by treatment with plasmin-Sepharose. The conversion was verified by SDS/PAGE (not shown). The values for K,, k,,* and the catalytic efficiency (K&K,) for tct-PA and for two-chain forms of the variants are shown in Table 3. The K, value for tct-PA, 0.18mM was very similar to the values for K2P and FK2P, 0.20 and 0.21mM, respectively. Slightly higher values were obtained for

Table 3 Kinetic constants for hydrolysis of the chromogenic peptide substrate S-2288. Values represent the mean value + standard deviation from 3 experiments Compound (two-chain form) t-PA K2P K2P(Va1277) K2P(Gln448) FK2P FK2P(Va1277) FK2P(Gln448)

KIII @Ml 0.18+0.02 0.20t0.03 0.06f0.01 0.28+0.03 0.21t0.03 0.06f0.01 0.24+0.01

k cat K1) f3.s+1.1 10.7+1.6 6.5f0.3 9.4kO.3 11.1+1.8 6.OkO.5 5.3kO.2

kaJKm (s-l mM-r) 49.5t- 4.8 52.8+ 3.6 119.7f13.5 33.4+ 2.9 52.1+ 2.5 105.7rt 4.3 22.0f 1.5

Fibrinolysis

+ stimulator

P s a (35 0 ii! a

- stimulator

090 100

0

200 TIME (MIN)

1,5 + stimulator

% 0" St

l,o

% 3

iii 0,5

- stimulator

ii a 090 0

100

200 TIME (MIN)

Fig. 5 The stimulation of plasminogen activation by fibrinogen fragments. The activation was measured indirectly by the progressive increase in absorbance over time when 0.3nM of two chain forms of the different activators were mixed with plasminogen and the plasmin chromogenic substrate S-2251, with or without CNBr digested fibrinogen as stimulator. In panel A the symbols indicate, tct-PA (X), K2P (U), K2P(Va1277) (0), IQP(Gln448) (A) and in panel B, tct-PAS (X), FK2P (H), FK2P(Va1277) (O), FK2P(Gln448) (A).

the two non-glycosylated variants, 0.28mM for K2P(Gln448) and 0.24mM for FK2P(Gln448). Most interestingly, the two Va1277 variants showed three to four times lower K, values (0.06mM). The kcat values for the two Va1277 variants were about 6s-l, which was lower than the kcat values of about lOs-1 observed for tct-PA, K2P and FK2P. The resulting catalytic efficiency is about two times higher for K2P(Va1277) and FK2P(Va1277) than for t-PA, K2P and FK2P and three to four times higher than for K2P(Gln448) and FK2P(Gln448). DISCUSSION This paper describes the construction, expression and structural and enzymatic characterisation of six variants of t-PA that are lacking the growth factor domain and the first kringle domain.

B

27

The two basic criteria in the design of the variants were that they should be fibrinolytically active and display a longer in vivo half-life than t-PA. Our initial experiments with the K2P variant expressed transiently in COS-7 cells indicated that deletion of the FGKl segment of t-PA resulted in a molecule that was fibrinolytically active and had a prolonged in vivo half-life in rabbits (G Pohl, unpublished). The present set of variants were constructed in order to address questions about the function and the functional independence of the finger domain, the importance of a positively charged residue at position 277 and the function of the oligosaccharide in the P domain. In all variants the glycosylation site Asn1s4, which is variably glycosylated in t-PA,38 was changed to Gln in order to obtain more homogeneous preparations. The C127/BPV host/vector system was found very suitable for the simultaneous production of several variants in quantities that would allow also for animal studies. The total time required from transfection to production in roller bottles was about two months and production was stably maintained for several months. All variants were secreted into the medium and could be immunoaffinity purified using the same monoclonal antibody. Analysis of the polypeptide chain structure showed that the variants were processed in the same way as the full-sized molecule. Thus, when protease inhibitors were omitted from the culture medium, the molecules were to a large extent cleaved after ArgZ7s and displayed Seri as the amino terminus. However, in the preparation that had been produced with aprotinin in the culture medium (K2P) a significant percentage of the amino acid sequence started at Gly-3, indicating that the variants are secreted in an extended form as have also been shown for melanoma t-PA.5 In the absence of protease inhibitors, formed plasmin can remove the amino terminal tripeptide in addition to the generation of a two-chain molecule by the cleavage after Arg275. For the F domain-containing variants a specific cleavage was observed at the ArgZ7-Ser2s peptide bond. This is apparently a sensitive site also in the full-sized molecule as it is readily cleaved by traces of trypsin.3g Interestingly, the two variants that had been modified in order to remove the glycosylation site in the P domain was found to be specifically cleaved after ArghJg. The oligosaccharide chain normally present at Asnd4s appears to protect the Arg449-Thr450 bond. In summary, the structural analyses,showed that the variants were proteolytically processed in the same way as the normal molecule and revealed similar sites of protease sensitivity. This indicates that the domains in the variants are correctly folded. The fibrin binding properties of the variants were compared in forming fibrin clots. All variants showed a reduced fibrin binding compared to single-chain and two-chain forms of melanoma t-PA. The difference was most pronounced for clots made at low concen-

28 t-PA Mutants

trations of fibrinogen. Since each F domain-containing variant binds somewhat better than the corresponding fingerless variant, it appears that the F domain when joined directly to K2, adds slightly to the fibrin affinity but does not confer the strong fibrin affinity of normal t-PA to the variants. Larsen et a14’ obtained similar results with variants lacking the F domain, the FG domains or the G domain, respectively. Although we found that the binding was reduced for all variants, it was still significantly over the background as determined with radiolabeled BSA. Within each group (with or without F domain) we observed that the non-glycosylated variants, K2P(Gln448) and FK2P(Gln448), showed the highest fibrin binding, indicating that the carbohydrates in the P domain affects the interaction with fibrin. An increased fibrin affinity has also been observed for non-glycosylated forms of full-sized t-PA41 and for non-glycosylated t-PA variants lacking the FG domains.23 The specific enzymatic activity, determined in the indirect chromogenic substrate assay was 20-40% of that of t-PA for K2P and K2P(Va1277), whereas the other variants were about as active as t-PA in this assay. This reduced activity appears to be caused by a time lag phase in the onset of the reaction for K2P and K2P(Va1277). The lag phase is much less apparent for K2P(Gln448) and for the F-containing variants. A similar lag phase-behaviour has been reported for t-PA variants lacking the F and the G domains, resulting in specific activities in the indirect chromogenic assay that were 35-70% of that of wild type t-PA.41 The decreased fibrin affinity and the lag phase and low specific activity in the chromogenic assay are properties shared between K2P and K2P(Va1277) in this work and other variants that are lacking the F and the G domains.40,41 However, the activity that we have determined on fibrin plates differ considerably from other studies in that we consistently find specific activities to be higher for the variants than for t-PA in this type of assay. Hansen et a141reported values that correlated well with the results from the chromogenic assay, being 25-70% of that of t-PA. Our surprisingly high specific activity values for the variants in the fibrin plate assay may be explained by different assay procedures or may be related to the smaller size of the K2P and FK2P type of variants in this work. The small size result in favourable molar concentration and the low fibrin affinity allows a faster diffusion in the fibrin-agarose gel. The kinetic parameters determined for t-PA and the two-chain forms of the variants for the substrate Ile-Pro-Arg-pNA are in good agreement with the values determined for t-PA by Tate et a1.7 The significant decrease in K, for K2P(Va1277) and FK2P(Va1277) clearly indicate that the Lys277 residue is important for the substrate interaction of t-PA. For the two-chain forms of the molecules studied in this

work the activity with small peptide substrates appears to be relatively independent of the heavy chain. The kinetic parameters are essentially the same for t-PA, K2P and FK2P. Similar observations have been made with several heavy chain-mutated variants using a different peptide substrate.42 In summary, we have constructed and expressed in mammalian cells six variants of t-PA. The secreted proteins were proteolytically processed as the normal t-PA but the variants lacking glycosylation in the protease domain displayed specific proteolytic cleavage after Arg449. The fibrin binding properties of all variants were low compared to t-PA. Thus, adding the F domain directly to the K2 domain is not sufficient to ensure high fibrin binding. However, all variants were stimulated by fibrin, and the F domaincontaining variants showed stimulation factors in the same range as t-PA. In the fibrin plate assay the variants had specific activities that were 2-5-fold higher than for t-PA. In contrast, the indirect chromogenic assay showed all variants to be less active than t-PA. This inconsistency between the results from the two assays indicate differences in the mechanisms of reaction between the variants and t-PA which probably is related to the low fibrin affinity and the smaller size of the variants. Finally, the Lys277 residue was found to be affecting the kinetic parameters as determined with a small peptide substrate, indicating that this residue is important for the substrate interaction of t-PA. ACKNOWLEDGEMENTS We wish to thank Annika Stenbeck for tissue culture work, Eva Lagerholm for purifying the protein and Gunilla Lundqvist for N-terminal sequence analyses.

REFERENCES 1. Wun T-C, Capuano A 1985 Spontaneous fibrinolvsis in whole human-plasma. J Biol Chem 260: 5061-5066 2. Robbins K C. Summaria L. Hsieh B. Shah R J 1967 The peptide chains of human plasmin. Mechanism of activation of human plasminogen to plasmin. J Biol Chem 242: 23332342 3. Gruppo Italian0 per lo studio dells streptoichinasi nell’infart miocardio (GISSI) 1986 Effectiveness of intravenous thrombolytic treatment in acute myocardial infarction. The Lancet 1: 397401 4. Wilcox R G, von der Lippe G, Olsson C G, Jensen G, Skene A M, Hampton J R For the Asset Study Group 1988 Trial of tissue plasminogen activator for mortality reduction in acute myocardial infarction. Anglo-Scandinavian Study of Early Thrdmbolysis (ASSET). TheLancet 2: 525-530 _ 5. Wall&r P. Pohl G., Beresdorf N et al 1983 Purification and characterization of a melanoma cell plasminogen activator. Eur J Biochem 132: 681-686 6. Ranby M, Bergsdorf N, Nilsson T 1982 Enzymatic properties of the one- and two-chain form of tissue plasminogen activator. Thromb Res 27: 175-183 7. Tate K M, Higgins D L, Holmes W E et al 1987 Functional role of proteolytic cleavage at Arginine-275 of human tissue plasminogen activator as assessed by site-directed mutagenesis. Biochemistry 26: 338-343

Fibrinolysis 8. Thorsen S, Glas-Greenwalt P, Astrup T 1972 Differences in binding to fibrin of urokinase and tissue plasminogen activator. Thromb Diath Haemorrh 28: 65-74 9. Wall& P 1977 Activation of pIasminogen with urokinase and tissue activator. In: Proceedings of the Serono symposia on thrombosis and urokinase 91-102 (Paoletti R and Sherry S eds) Academic Press London 10. Pennica D, Holmes W E, Kohr W J et al 1983 Cloning and expression of human tissue-type plasminogen activator cDNA in E. coli. Nature 301: 214-221 11 Edlund T, Ny T, Ranby M et al 1983 Isolation of cDNA sequences coding for apart of human tissue plasminogen activator. Proc Nat1 Acad Sci USA 80: 349-352 12. Pohl G, Kallstrom M, Bergsdorf N, Wall&i P, Jornvall H 1984 Tissue-type plasminogen activator: peptide analysis confirm an indirectly derived amino acid sequence, identify the active site serine residue, establish glycosylation sites, and localize variant differences. Biochemistry 23: 3701-3707 13. Vehar G A, Kohr W J, Bennett P D et al 1984 Characterization studies on human melanoma cell tissue plasminogen activator. Biotechnology 2: 1051-1057 14. Jornvall H, Pohl G, Bergsdorf N, Wall& P 1983 Differential proteolysis and evidence for a residue exchange in tissue plasminogen activator suggest possible association between two types of protein microheterogeneity. FEBS Lett 156: 47-50 15. Patthy L 1985 Evolution of the proteases of blood coagulation and fibrinolysis by assembly from modules. Cell 41: 6.57-663 16. Furie B and Furie B C 1988 The molecular basis of blood coagulation. Cell 53: 505-518 17. Pannekoek H, de Vries C, van Zonneveld A-J 1988 Mutants of human tissue-type plasminogen activator (t-PA): Structural aspects and functional properties. Fibrinolysis 2: 123-132 18. Rijken D C, Groeneveld E 1986 Isolation and functional characterization of the heavy and light chain of human tissue-type plasminogen activator. J Biol Chem 261: 3098 3102 19. van Zonneveld A-J, Veerman H, Pannekoek H 1986 Autonomous functions of structural domains on human tissue-type plasminogen activator. Proc Nat1 Acad Sci USA 83: 467&4674 20. van Zonneveld A J, Veerman H, Pannekoek H 1986 On the interaction of the finger and the kringle-2 domain of tissuetype plasminogen activator with fibrin. J Biol Chem 261: 14214-14218 21. Gething M J, Adler B, Boose J A et al 1988 Variants of human tissue-type plasminogen activator that lack specific structural domains of the heavy chain. EMBO J 7: 27312740 22. Larsen G R, Metzger M, Henson K, Blue Y, Horgan P 1989 Pharmacokinetic and distribution analysis of variant forms of tissue-type plasminogen activator with prolonged clearance in rat. Blood 73: 1842-1850 23. Cohen D, Stassen J-M, Larsen G 1988 Pharmacokinetics and thrombolytic properties of deletion mutants of human tissue-type plasminogen activator in rabbits. Blood 71: 216 219 24. Einarsson M, Haggroth L, Mattsson C 1989 Elimination of native and carbohydrate-modified tissue plasminogen activator in rabbits. Thromb Haemost 62: 1088-1093 25. Smedsrod B, Einarsson M, Pertoft H 1988 Tissue plasminogen activator is endocytosed by mannose and galactose receptors of rat liver cells. Thromb Haemost 59: 480-484

Received: 24 May 1990 Accepted after revision: 5 September 1990 Offprint orders to: Dr Gunnar Pohl, KabiGen AB (P5), S-112 87 Stockholm, Sweden. Tel: + 46 8 13 80 00; Fax: + 46 8 618 82 62.

29

26. Hotchkiss A, Refino C J, Leonard C K et al 1988 The influence of carbohydrate structure on the clearance of recombinant tissue-type plasminogen activator. Thromb Haem 60: 255-261 27. Lau D, Kuzuma G, Wei C-M, Livingston D J, Hsiung N 1987 A modified human tissue plasminogen activator with extended half-life in vivo. Biotechnology 5: 953-958 28. Wikstriim K, Mattsson C, Sterky P, Pohl G 1991 Tissue plasminogen activator mutants lacking the growth factor domain and the first kringle domain: II Enzvmatic properties in plasma and% vivo thromboly& activity and clearance rates in rabbits. Fibrinolvsis 5: 31-42 29. Elmblad A, Josephson S, Palm G 1982 Synthesis of mixed oligodeoxyribonucleotides following the solid phase method. Nucleic Acids Res 10: 3291-3301 30. Pavlakis G N, Hamer D H 1983 Regulation of a metallothionein-growth hormone hybrid gene in bovine uapilloma virus. Proc Nat1 Acad Sci USA 50: 397-401 31. Mulligan R C, Berg P 1980 Expression of a bacterial gene in mammalian cells. Science 209: 1422-1427 32. Sarver N, Byrne J C, Howley P M 1983 Transformation and replication in mouse cells of a bovine papillomavirus-pML2 plasmid vector that can be rescued in bacteria. Proc Nat1 Acad Sci USA 79: 7147-7151 33. Graham F L, Van der Eb A J 1973 A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52: 456-467 34. Einarsson M, Brandt J, Kaplan L 1985 Large-scale purification of human tissue-type plasminogen activator using monoclonal antibodies. Biochem Biophys Acta 830: l-10 35. Goka J A K and Farthing M J G 1987 The use of 3, 3’,5,5’-tetramethyl benzidine as a peroxidase substrate in microplate enzyme-linked immunosorbent assay. J Immunoassay 8: 29-41 36. Blomblck B and Blomback M 1956 Purification of human and bovine fibrinogen. Ark Kemi 10: 415-443 37. Ny T, Elgh F, Lund B 1984 The structure of the human tissue-type plasminogen activator gene: Correlation of intron and exon structures to functional and structural domains. Proc Nat1 Acad Sci USA 81: 5355-5359 38. Pohl G, Kenne L, Nilsson B, Einarsson M 1987 Isolation and characterization of three different carbohydrate chains from melanoma tissue plasminogen activator. Eur J Biochem 170: 69-75 39. Teshima G, Harris R, Keck R, Meunier A, Burnier J, Keyt B 1987 Characterization of limited proteolytic digests of tissue plasminogen activator. Thromb Haemostas 58: 429 (Abstract no 1576) 40. Larsen G, Henson K, Blue Y 1988 Variants of human tissue-type plasminogen activator: fibrin binding, fibrinolytic and fibrinogenolytic characterization of genetic variants lacking the fibronectin finger-like and/or the epidermal growth factor domains. J Biol Chem 263: 1023-1029 41. Hansen L, Blue Y, Barone K, Cohen D, Larsen G R 1988 Functional effects of asparagine-linked oligosaccharide on natural and variant human tissue-type plasminogen activator. J Biol Chem 263: 15713-15719 42. Rehberg E F, Theriault N Y, Carter J B et al 1989 Construction of a tissue plasminogen activator gene having unique restriction sites to facilitate domain manipulation: a model for the analysis of multi-domain proteins. Protein Eng 5: 371-377