Tissue-specific alternative splicing of neurofibromatosis 1 (NF1) mRNA

365

Tissue-specific alternative splicing of neurofibromatosis 1 (NFl) mRNA G Danglot, C Teinturier, A Duverger, A Bernheim Cy/o,qewriyrw

et Grnrrique

Oncologiyues.

CNRS

I/A

I /SE.

Imrirrrr

Gusta~v

Roussy.

94805

Villejui’

Cedes.

Frmre

Summary - The neurofibromatosis 1 gene NFI appears to play a crucial role in regulating the proliferation of cells of neural crest origin. The NFI gene is a 300 kbp gene, encoding a complex pattern of mRNA related to the presence or absence of two alternative splices. The first splice. in the centre of the coding region of the gene. results in the addition of 63 bp in the GAP-related domain. The second splice located 4203 bp downstream, near the 3’ terminus of the coding region of the gene, consists of a 54 bp insert. RT-PCR analysis demonstrates that the most prevalent splice variant in human tissues is the one which contains the GAP-related splice and omits the 3’ terminal splice. It is also the form expressed in the peripheral nerve, adrenal medulla, benign NFI neurofibromas and NFI neurosarcomas. Conversely, a few organs (brain, muscle) exhibit extensive alternative splicing leading to the co-expression of four distinct transcripts. The reproducibility of the relative levels of each of the splice types in the different organs indicates a tissue-specific splicing pattern of the NFI gene. neurofibromatosis

(type

I) I splicing

/ tissue-specific

I expression

Introduction Neurofibromatosis type 1 (NFI), also known as Von Recklinghausen disease, is one of the most frequent autosomal dominant genetic disorders, affecting one in 3000 individuals [l]. The pathology exhibits extensive variation in phenotypic expression between families and even more within each family, and is characterized by peripheral neurofibromas and cafe-au-lait spots. Learning disorders, renal hypertension and optic gliomas may also be associated. In addition, neurofibromatosis increases the risk of malignancy in these patients whose cancers (essentially neurofibrosarcomas, meningiomas, astrocytomas, glioblastomas) develop in cells of neural crest origin. The mutation rate is estimated to be approximately 1 in 10,000 gametes per generation, family studies indicating that 50% of cases are caused by a new mutation occurring preferentially on the paternal chromosome [2-41. The NFl gene was localized to chromosome 17qll-2 by genetic linkage analysis [5, 61. The discovery and subsequent physical mapping of two NFl translocations occurring in this region led to the identification and cloning of the NFl

gene [7-131. The gene extends for approximately 300 kb and encodes a ubiquitously expressed transcript of about 13 kb [ 121. Sequence information is now available for the entire coding region of the transcript which comprises 50 or more exons, and contains an open reading frame of at least 2818 amino acids [14]. Antibodies raised against recombinant parts of the NFl protein have identified a 250 kd protein expressed in viva [15, 161. Three small genes: OMPG, RCl and EV12 are embedded in an intron of the NFl gene and transcribed from the complementary strand [13, 17-201; an AK3 pseudogene [21] lies in another intron. Four NFl pseudogenes representing small portions of the unprocessed NFl gene were recently mapped to chromosomes 14 (two bands), 15 and 22 [22, 231. Sequencing data indicated that the predicted amino acid sequence of the NFl gene product showed significant homology with the catalytic domain of GAP and IRA proteins [24-261, both of which are involved in controlling the activity of RAS proteins in mammals and yeast respectively. The RAS proteins are GTP binding proteins acting as transducers of mitogenic signals, the RAS-GTP form being mitogenic while RAS-

366 GDP is the inactive form. Expression studies have revealed that the GAP-related domain of the NFl protein synthesized in the baculovirus, yeast or E coli could indeed regulate GTPase activity of the RAS and IRA proteins [26-281. Finally, extracts from tumors and tumor cell lines derived from neurofibrosarcomas from NFl patients were shown to contain constitutively activated RAS proteins and not any functional NFl proteins [29311. These results strongly suggest that the NFl gene acts as a tumor suppressor-gene, the NFl protein being involved in the negative regulation of RAS proteins and hence in the inhibition of cell proliferation. However, there are still many features that require explanation. One of the most striking is the variation in the phenotypic expression of the mutant gene, both between different families and between affected individuals in the same family. Another enigma is that although the NFI gene is widely expressed in many different cell types, the clinical features can be ascribed to cells of neuroectodermal origin. In order to address this last issue, we decided to conduct a fine analysis of the structure of NFl messengers expressed in adult tissues, and to compare the messengers observed in tissues derived from the neural crest with NFl messengers present i) in other normal adult tissues, ii) in benign, and iii) malignant tumors. Two alternative splices have previously been described in NFl transcripts, one in the central part, ie the region coding for the GAP-related domain, and the other near the 3’ end of the coding portion of the messenger [14]. We describe tissue-specific expression of these two alternative splices and demonstrate that the type of NFl transcript expressed in the peripheral nerve and in the medullary adrenal gland is identical to the major form of the NFl messenger present in other normal tissues.

Materials and methods Patient tissues NFl patients participating in this study met criteria agreed upon in a consensus conference at the National Institute of Health [32]. Human tissue samples used for research were obtained with informed consent of the patients. RNA purification Total RNA was isolated from cells and liquid nitrogen frozen solid tissues by using the guanidium isothiocyanate acid-phenol procedure [33].

cDNA synthesis and amplification chain reaction (PCR)

by polymerase

Total RNA was denatured at 65°C for 2 min and reverse transcribed into cDNA using specific primers. Reverse transcription was carried out in a total volume of 20 1.11 by mixing 0.5 to 2 ug of total RNA with 50 pmol of

primer, 40 units RNAsin (Promega), 200 units Moloney murine leukemia virus reverse transcriptase (BRL) and 50 nmol of each deoxyribonucleotide triphosphate in a buffer containing 50 mM Tris pH 8.3, 75 mM KCI, 3 mM MgClz and 5 mM DTT. Reactions were incubated at 42°C for 60 min. Forty cycles of amplification (denaturation at 95°C for 1 min, annealing at 69°C for 3 min I5 s and primer extension at 72°C for 3 min)

were performed in a mixture containing IO mM TrisHCI pH 8.3, 50 mM KCI, 5 mM MgClI, 0.001% gelatin, 1 mM each dNTP, 50 pmol of both primers and 1.25 units Ampli Taq DNA Polymerase (Cetus) in a final vol of 50 ul. Synthetic oligonucleotides for RT-PCR were designed to amplify eight fragments of 1000 to 1200 bp which allowed the major part of the 9 kb coding region

of NFI transcript to be analysed. Their sequences are as follows: (i) sense primers: NFI-I 109: TGGACAGTCTACGAAAAGCTCTTGCTGG; NFI -2135: GGAAGGGAAAAGGGAACTCCTCTATGGA; NFI -3089: AAGGCAGCTCTGAACATCTAGGGCAAGCTA; NFI -4073: TACGAATTGTGATCACATCCTCTGATTGGC; NFI -4980: TTATGTTGCACGGAGGTTCAAAACTGGT; NFI -59 15: AGCCACACCTCACGTTAGAATTTTTGGA; NFI -6803: CATGCATGAGAGATA’MCCAACGTGCA; NFl-7754: CCAACACTAAGAAGTTGCTGGAACAAGGA; (ii) antisense primers: NFI-2300: CAGAGGTGGCGGAAACAGGACATG; NFl-3349: GACATTTTACATCATCATCTGCTGCTTGGT; NF l-4 102: GCCAATCAGAGGATGTGATCACAATTCGTA; NFI -5 196: GATATAGACTGCGGAGACGTTGTCGTAAGC; NFl-6069: TCTTTGTCGTTTGGCATCATCATTATGTC; NFI -6957: CTGCTTTATCTGCCCATGAGACACTCGT; NFI -785 1: TGTGATCCCTGATTCCATTTCTTGCCT; NFI -8855: TAAAACAGGAAGTGCAGCATTACAACATGG; Detection

and characterization

of PCR products

Five pl aliquots of the reaction product were directly analysed by electrophoresis on a 2% agarose gel con-

367

mining ethidium bromide. in TrislBoratelEDTA, Other aliquots were digested with the appropriate restriction enzymes and analysed on 7% agarose pel 35 previously described.

Gels stained with ethidium bromide were photographed. Photographs were dipitalized with a scanner (Omnimedia XRS) driven with Photoshop I .07 software (Adobe) and densitometry performed with Image I.-U freeware (NIH).

Results Different NFl some tissue

trmscripts

cm be expressed

in the

NFl RNAs from normal tissues were reversetranscribed and the resulting cDNA amplified by PCR. As the coding region of the transcript was too large (9 kb) to be PCR amplified once, the oligonucleotides used as primers had to be scattered all over the gene in order to achieve the amplification of overlapping cDNA fragments of

1000 to 1200 bp. This technique was chosen because Northern blot analysis would not have given such fine structural details on this 13 kb messenger. and in several cases, large quantities of starting material were not available. The RPPCR method offers two main advantages. It permits the characterization of a rare messenger from small quantities of starting material and, when used with a mixture of related molecules, can give quantitative results. provided that these related molecules are tested in the same reaction tube, with the same primers. and that the differences between them are minor [34, 351. An example of the results obtained with two of the tested tissues is shown in figure 1. Panel A represents the amplification of NFI RNA expressed in hematopoietic cells and panel B. NFI RNA expressed in adult brain. All the cDNA fragments obtained were of the expected size. Their authenticity was further confirmed by digestions with different restriction enzymes (Pstl, EcoRl and Taql) and all digestion products showed the expected pattern. These results are in agreement with the published sequences. They further show that the alternative splicing occurring in two regions, the central GAP-related domain and the 3’

Fig I. Characteriation of NFI cDNA amplified from normal hemutopoielic cells (panel A) and brain tkue (panel B). Total RNA was extracted in the presence of guanidinium isithiocyanate. Eight aliquots of each RNA were reverse transcribed in the presence of one of the reverse NFI-specific oligonucleotides and the NFI cDNA amplified by polymerase chain reaction afler addition of the corresponding sens NFI oligonucleotide. Five pl aliquots of the reaction products were analysed by electrophoresis on 2% agarose gel containing ethidium bromide. Region of thr NFI gene amplified between: lane I: oligonucleotide NFI-II09 and oligonucleotide NFI -7300: lane 2: oligonuclcotidc NFI-2135 and oligonucleotide NFI-3349; lane 3: oligonucleotide NFI-3089 and oligonucleotide NFI-4102; lane 4: oligonucleotide NFI-4073 and oligonucleotide NFI-5196; lane 5: oligonucleotide NFI-4980 and oligonucleotide NFI-6069; lane 6: oligonucleotide NFI-S91S and oligonucleotide NFI-6967: lane 7: oligonucleotide NFL6803 and oligonucleotide NFl-78.51; lane 8: oligonucleotidc NFI-7754 and oligonucleotide NFI-8844: lane 9: 0X 174/Haelll molecular weight fragments.

368 terminal end of the gene, generates different NFl transcripts which can co-exist in the same tissue. NFl mRNA alternative

splicing is tissue specific

To determine whether these alternative splices were common or exclusive to particular cell types, we studied the existence and relative abundance of these various forms of NFl transcripts in eight different normal tissues. One thousand bp NFl cDNA fragments spanning the two alternative splice sites were generated by RT-PCR and analysed by 2% agarose gel electrophoresis as previously described. The results concerning the central region of the gene (fig 2 panel B) show that the larger NFl amplified cDNA containing the 63 bp additional exon located in the GAP-related domain, is present in all the tested tissues, while the smaller cDNA is only abundant in a few cell types (central nervous system, hematopoietic cells and muscle). In order to verify the specificity and the reproducibility of these results, RT-PCR reactions were repeated, starting either with the same RNA preparation, or with new RNA preparations of the same tissues. Each tissue was tested at least twice and in some cases up to seven times, in the same week or spaced out over several months and in each case, an identical result was obtained for a given tissue. The reproducibility of the different splice patterns observed according to tissues is in agreement with the quantitative nature of such PCR and is indicative of tissue-specific NFl expression. It is noteworthy that the 63 bp larger form is widely expressed in the peripheral nerve and the medullary adrenal gland, while only traces of the shorter form are observed in these tissues. The expression levels of both forms visualized on the photograph were further quantitated by densitometry (table I) and confirm that nine out of ten NFl transcripts present in the peripheral nerve and nine out of ten present in the adrenal medulla bear the additional exon located in the GAP-related domain. Conversely, seven out of ten NFl transcripts present in the adult brain are devoid of this 63 bp additional exon. The results concerning the alternate splicing located in the 3’ region of the gene (fig 2 panel C) show that the smaller NFl amplified cDNA, devoid of the 54 bp additional exon is the rule in all the tested tissues, while only two tissues, squeletal muscle and brain, show significant amounts of cDNA containing the 54 bp additional exon. Quantitative data confirm these observa-

tions since the 3’ end larger cDNA represents 10% or less of NFl transcripts in six out of eight tissues, including the peripheral nerve and the adrenal medulla. These different findings, summarized in figure 3, indicate that the major form of NFl transcripts expressed in the peripheral nerve and in the adrenal medulla (both of which originate from

Fig 2. Expression

of NFI variant transcripts in different tissues and cell types. Three regions of NFl messenger are studied: Panel A: region located between oligonucleotides NFI-3089 and NFI-4102. Panel B: GAP-related domain between oligonucleotides NFI-4073 and NFI-5106. Panel C: 3’ terminal region of the coding part located between oligonucleotides NFl-7754 and NFI-8844. RNAs from different tissues were extracted, reverse transcribed and NFl cDNAs amplified by PCR and analysed on 2% agarose gel electrophoresis as previously described. RNA extracted from: lane I. brain; lane 2, peripheral nerve; lane 3, medullary adrenal gland; lane 4. liver; lane 5, placenta; lane 6, muscle; lane 7, lung; lane 8, bone marrow cells. Lane 9, (PX 174Haelll molecular weight marker.

369 Table I. Relative proportion of NFl pressed in normal adult tissues. Gap-related domain

splice

types ex-

3’ end

region

Tissue

-63 bp

+63 bp exon

exon

Brain Peripheral nerve Adrenal medulla Liver Placenta Muscle Lung Hematopoietic cells

-54 bp exon

+54 bp exon

8 9 IO IO IO 3 IO 5

5

IO

0

Quantitative analysis was performed by scanning photographs of long migrating gels stained with ethidium bromide and then integrating the surfaces of the peaks. The total amount of amplified DNA present in each lane of the gels was arbitrarily normalized to IO.

I Peripheral nerve

Adrenal medulla Liver PlW&?llta

Lung

Hematopoieoc cells

----------------------------------------. . . . . . . . . . . . . . . . .v. . . . . _ . _ __ . . . . _ _sz . _ . . . . . ..__................_.......__.. XT...

I

(81%) (9%) (9%) (1%)

(90%) (10%)

77

(80%) (20%)

w

(50%) (50%)

I:::; “(z,’

Muscle

WV

(35%) (35%) (15%) (15%)

Fig 3. Schematic representation of the NFI splice variants expected in the different tissues according to the frequency measured in table I. This theoretical pattern could not be verified experimentally due to the large size of the transcripts (13 kb) and to the large distance between the two splices (4.2 kb). The numbers in brackets represent an estimation of the relative abundance of each variant messenger in each tissue.

neural crest cells), contains the 63 bp additional exon located in the GAP-related domain, but is

devoid of the 54 bp additional exon located near the 3’ end of the coding region of the NFl messenger. Our results also show that this type of NFl transcript is also present in all the six other tissues tested, even if it co-exists with other types of NFl transcript. Two tissues, the liver and placenta, show exactly the same splicing profile as the peripheral nerve and adrenal medulla, and exhibit the very predominant form of the NFl transcript. Lung and hematopoietic cells contain two kinds of NFl transcripts, some contain the exon located in the GAP-related domain and others lack it, while all of them are devoid of the 3’ terminal exon. Two tissues, however, the brain and muscle, probably contain the four combinations but with different relative proportions. NFI transcripts patients

expressed

in tumors

from

NFI

We were interested to establish whether the splicing profile observed in the normal periphcral nerve and adrenal medulla was maintained sifter tumorigenesis. For this purpose, RNA extracted from 20 subcutaneous neurofibromas, one pheochromocytoma, three neurofibrosarcomas and one neuroepithelioma, all from patients affected by neurofibromatosis, were reverse transcribed, amplified across the two splicing sites and the cDNA analysed on agarose gel as previously described. With respect to the central GAP-related domain, all neurofibromas showed major amplification of the larger cDNA with the presence of trace amounts of the smaller cDNA in a few samples (two examples of them are shown in fig 4). This expression profile is analogous to that observed in the peripheral nerve, indicating that these benign tumors are able to splice NFl pre-messengers in an identical manner to that of normal cells. In contrast, the pheochromocytoma expressed both forms of NFl, with a slight excess of the short form (fig 4 and table II), unlike the medullary adrenal gland. In the case of malignant tumors, the three neurofibrosarcomas and the neuroepitheloma, such as benign neurofibromas, predominantly exhibited the large cDNA. Interestingly, all tumors (20 benign and four malignant) derived from the peripheral nerve retained the typical expression pattern observed in normal tissue while pheochromocytoma expression differed from its normal counterpart. Additional data are necessary to determine whether the appearance of the smaller form of NFl in pheochromocytomas is a general

Fig 4. Expression of the NFI gene in tumor tissues from NFI patients: behaviour of the alternative cxon located in the GAPrelated domain. RNA extracted from different tumors from NFI patients were reverse transcribed: NFI cDNA were amplified between oligonucleotidcs NFI -4073 and NFI-5 196. and analysed by 7% agarose gel electrophoresis as previously described. RNA extracted from: lane I, normal peripheral nerve (used as a marker): lane 2: normal brain (used as a marker); lanes 3 and 4: benign neurofibromas from two of the 20 patients tested; all the others had identical profiles: lane 5: pheochromocytoma from the same patient as neurofibroma in lane 4; lanes 6 and 7: nemosarcomas from two different patients; the third showed an identical profile: lane 8: neuroepithelioma. Lane 9: @X 174/Haelll molecular weight marker.

Table II. Relative proportion transcripts expressed in tumors

bp exorl

-63

nerve

Neurofibroma

Neurofibroma Pheochromocytoma Neurosarcoma

Neurosarcoma Neuroepithelioma For footnote,

from

Cup-related domnirl

Tissue

Peripheral Brain

of splice types of NFI NFI

3’

patients.

end regim

+63 bp -54 bp +S4 bp exon exert exon 9

9

1

7

8

8 8 4 9

9 9 9 9

2 I

8

IO IO

9

I I I 0 0

see legend to table I.

correlated with tumorigenesis. The same tumors were analyzed for the structure of NFl transcripts at the splice site located near the 3’ end of the coding region of the messenger. Our

phenomenon

Fig 5. Expression of the NFI gene in tumor tissues from NFI patients: behaviour of the alternative exon located in the 3’ terminal region. RNA extracted from different tumors from NFI patients were reverse transcribed; NFI cDNA were amplified between oligonucleotides NFI-7754 and NFI-8844. and analysed by 2% agarose gel electrophoresis as previously described. RNA extracted from: lane I, normal peripheral nerve (used as a marker); lane 2: normal brain (used as a marker); lanes 3 and 4: benign neurofibromas from two of the 20 patients tested; all the others had identical profiles; lane 5: phcochromocytoma from the same patient as neurofibroma of lane 4; lanes 6 and 7: nettrosarcomas from two different patients; the third showed an identical profile; lane 8: neuroepithelioma. Lane 9: 0X 174/Haelll molecular weight marker.

results indicate that all the benign and malignant tumors widely amplified short cDNA (fig 5 and table II). This result is also true for the pheochromocytoma, indicating that the splicing process always remained unchanged after tumorigenesis in this part of the gene. In summary, we analysed 25 NFl peripheral tumors. Twenty-four of them widely expressed the same NF1 transcript as the normal peripheral nerve. They bore the 63 pb additional exon located in the GAP-related domain and were devoid of the 54 bp additional exon located in the 3’ part of the gene. The unique pheochromocytoma we tested had a different pattern of expression: a mixture of transcripts either bore the 63 bp exon or were devoid of it, but all of them lacked the 3’ terminal exon.

Discussion The presence of mutations of the NFl gene in a number of patients affected by neurofibromatosis [ 11, 131, the potency of the GAP-related domain of the NFl protein to regulate GTPase activity

371 of the RAS and IRA proteins in vitro and in vivo [26-281, the presence of constitutively activated RAS proteins with very little, if any, functional NFl proteins in neurofibrosarcomas [29-311, all strongly suggest that this gene functions as a tumor suppressor gene. We were interested by the fact that clinical features of neurofibromatosis 1 mainly develop in cells derived from the neural crest whereas the NFl gene is very widely expressed in embryonic and adult tissues [ 121. Since two alternative splices had already been described in the NFl gene, we wanted to determine which type of NFl messengers were expressed in both normal tissues and tumor cells. Our results show that NFl gene splicing occurs in a tissue-specific manner. Some tissues possess one main form while others contain both alternative sequences at one or both splice sites. However, the major form, which was ubiquitously expressed in all the tissues tested, bears the 63 bp additional exon located in the GAP-related domain, and is devoid of the 54 bp additional exon located near the 3’ end of the gene. This is the form which is preferentially expressed in the peripheral nerve, adrenal medulla, benign neurofibromas and neurosarcomas. These results demonstrate that the development of the pathology observed in tissues derived from neural crest cells is not related to a particular type of splicing leading to the expression of a specific NFl messenger in these cells. However, our observations indicate that, according to tissues, the four types of NFl transcripts are synthesized. One may speculate on potentially distinct targets and functions for each encoded NFl protein. Until now, the recombinant GAP-related domains which were constructed and tested for their activity toward RAS were all devoid of the 63 bp additional exon. Our previous studies have indicated that this exon bore homology with a nucleoside triphosphatase [36]. This observation associated with the central location of this exon in the domain of interaction with RAS gave some insight into its importance in the catalytic process. Very recent data indicate that a recombinant GAP-related domain containing the additional exon-encoded peptide, stimulates RAS-GTPase activity in a similar manner but that its inhibition by arachidonic acid is different [37]. Whether the entire NFl protein will behave like the two GAP-related domains previously tested remains to be elucidated, especially since NFl protein has been shown to be membrane-associated [16]. The synthesis of recombinant NFl protein(s) according to the major

type of messenger which we characterized in i) peripheral nerve and adrenal medulla, ii) lung, and iii) muscle, could lead to the identification of several factors which may interact with the NFl protein. The discovery of naturally occurring mutations, particularly in both alternative exons, should complement functional studies of NFl proteins and provide an understanding of the normal role(s) of this gene.

Acknowledgments We are grateful to Dr Zeller at the Henri Mondor Hospital, Drs Terrier, Contesso, Caillou and Prades at the Anatomie Pathologique Department of Gustave Roussy Institut and Drs Launay and Blanchet-Bardon at the Saint Louis Hospital who provided the NFI samples used in this study. We likewise thank Dr A Lamouroux

at the Neurobiology laboratory of Gif, Dr MP Leibovitch

and Dr L Tran at the Gustave Roussy Institut

for providing normal RNA or tissues. We also acknowledge our colleagues D Fauvet for excellent technical assistance, and G Merault for photographs. Special thanks are addressed to Mrs L Saint Ange for revising the manuscript. This research was supported by grants from CNRS, Institut Gustave Roussy, Association pour la Recherche sur le Cancer and Ligue Nationale Frangaise contre le Cancer.

References Riccardi VM. Von Recklinghausen neurofibromatosis. N Engl J Med 1981;305:1617-27 Huson SM, Compston DAS, Clark P. Harper PS. A genetic study of von Recklinghausen neurofibromatosis in southeast Wales. I. Prevalence, fitness, mutation rate, and effect of parental transmission on severity. J Med Genef 1989; 26:704-l I Takano T, Kawashima T, Yamanouchi Y, Kitayama K. Baba T, Ueno K, Hamaguchi H. Genetics of neurofibromatosis I in Japan: mutation rate and paternal age effect. Hum Genet 1992;89:281-6 Stephens K. Kayes L, Riccardi VM. Rising M, Sybert VP, Pagon RA. Preferential mutation of the neurofibromatosis type I gene in paternally derived chromosomes. Hum Genet 1992;88:279-82 Barker D. Wright E. N¥ K et al. Gene for von Recklinghausen neurofibromatosis is in the pericentromeric region of chromosome 17. Science 1987;236: 1100-02 Seizinger BR. Rouleau GA. Ozelius LJ et al. Genetic linkage of von Recklinghausen neurofibromatosis to the nerve growth factor receptor gene. Cell 1987;49:589-94 Ledbetter DM, Rich DC, O’Connell P, Leppert M. Carey JC. Precise localization of NFI to 17qll.2 by balanced translocation. Am J Hum Genet 1989;44:20-4

372 8 O’Connell locations Science

P, Leach R, Cawthon RM map within a 600 kilobase 1989;244:

1087-a

9 Fountain JW. Wallace ping of a translocation Science

1989;244:

IO Wallace MR. mosome jump Recklinghausen Can

ef al. Two NFI transsegment of 17q11.2.

MR.

Bruce MA et al. Physical mapbreakpoint in neurofibromatosis.

1085-6

Andersen LB, Fountain JW et al. A chrocrosses a translocation breakpoint in the von neurofibromatosis region. Genes Chrom

1990;22:271-7

11 Viskochil D, Bucherg AM, Xu Cl er al. Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus. Cell 1990;62:187-92 12 Wallace MR. Marchuck DA, Andersen LB er a/. Type I neurofibromatosis gene: identification of a large transcript disrupted in three NFI patients. Science 1990;249: 181-6 13 Cawthon RM, Weiss R. Xu Cl er a/. A major segment of the neurofibromatosis type I gene: cDNA sequence, genomic structure, and point mutations. Cell 1990;62:193201 14 Marchuk DA, Saulino AM, Tavakkol R. et al. cDNA cloning of the type 1 neurofibromatosis gene: complete sequence of the NFl gene product. Genomics 199 I ; 11:93 I 40 15 Gutmann DH, Wood DL. Collins FS. Identification of the neurofibromatosis type 1 gene product. Proc Narl Acad Sci USA 1991;88:9658-62 16 DeClue JE, Cohen BD, Lowy DR. Identification and characterization of the neurofibromatosis type I protein product. Proc Nat/ Acad Sci USA 1991;88:9914-18 17 Xu Cl, O’Connell P, Viskochil et al. The neurofibromatosis type I gene encodes a protein related to GAP. Cell 1990; 62599-608 18 O’Connell P, Viskochil D. Buchberg AM er a/. The human homolog of murine Evi-2 lies between two von Recklinghausen neurofibiomatosis translocations. Genomics 1990; 71547-54 19 Viskochil D, Cawthon R, O’Connell et al. The gene encoding the oligodendrocyte-myeline glycoprotein is embedded within the neurofibromatosis type I gene. Mel Cell Eiol 1991;11:906-12 20 Cawthon RM, O’Connell P, Buchberg AM et al. Identification and characterization of transcripts from the neurofibromatosis 1 region: the sequence and genomic structure of EV12 and mapping of other transcripts. Genomics 1990; 7:555-65 21 Xu G, O’Connel P. Stevens J, White R. Characterization of Human adenylate Kinase (AK3) cDNA and mapping of the AK3 pseudogene to an intron of the NFI gen. Genomits

1992:13:537-42

22 Marchuk DA, Tavakkol R, Wallace MR er al. A yeast artificial chromosome contig encompassing the type 1 neurofibromatosis gene. Genomics 1992;13:672-80

DA, Hall BK, Andersen LB, Wallace 23 Legius E, Marchuk MR. Collins F, Glover TW. NFl-related locus on chromosome 15. Genomics 1992;13:1316-18 24 Xu G, O’Connell P, Viskochil D CI al. The neurofibromatosis type I gene encodes a protein related to GAP. Cell 1990;62:599-08 25 Buchberg AM, Cleveland LS. Jenkins NA, Copeland NG. Sequence homology shared by neurofibromatosis type I gene and IRA-I and IRA-2 negative regulators of the RAS cyclic AMP pathway. Narure 1990;347:29 l-4 26 Ballester R, Marchuk D, Boguski M, Saulino A, Letcher R, Wigler M, Collins F. The NFI locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell 1990;63:85 l-9 27 Xu G, Lin B, Tanaka et a/. The catalytic domain of the neurofibromatosis type I gene product stimulates rasGTPase and complements ira mutants of S. cerevisiae. Ce// 1990;63:835-41 28 Martin GA, Viskochil D, Bollag G er a/. The GAP-related domain of the neurofibromatosis type 1 gene product interacts with ras ~21. Cell 1990;63:843-9 29 DeClue JE, Papageorge AG. Fletcher JA, Diehl SR. Ratner N. Vass WC, Lowy DR. Abnormal regulation of mammalian p2 I’“‘ contributes to malignant tumor growth in van Recklinghausen (type I) neurofibromatosis. Cell 1992;69:265-73 30 Basu TN, Gutmann DH, Fletcher JA, Glover TW. Collins FS, Downward J. Aberrant regulation of ras protein in malignant tumour cells from type 1 neurofibromatosis patients. Narure 1992; 356:713-15 mutations in the 31 Li Y, Bollag G, Clark R ef a/. Somatic neurofibromatosis I gene in human tumors. Cell 1992; 69:275-a I 32 Stumpf DA, Alksne JF, Brown SS er a/. Neurofibromatosis. Arch Neural 1987;45:575-8 33 Chomczinskin P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Ann Biochem 1987;62: 156-9 of mRNA 34 Wang AW, Doyle MV, Mark DF. Quantitation by the polymerase chain reaction. Proc Narl Acad Sci USA 1989;86:9717-21 35 Gilliland G, Perrin S, Blanchard K, Bunn HF. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proc Nat/ Acad Sci USA 1990;87:2725-9 C, Danglot G, Slim R, Pruliere D, Launay JM, 36 Teinturier Bernheim A. The neurofibroamtosis I (NFI) gene transcripts expressed in peripheral nerve and neurofibromas bear the additional exon located in the GAP domain. Biochem

Biophys

Res Commun

1992;188:851-7

37 Uchida T. Matozaki T, Suzuki ef al. Expression of two types of neurofibromatosis type I gene transcripts in gastric cancers and comparison of GAP activities. Biochem Biophys Res Commun 1992;187:332-9