Titin-cap (TCAP) polymorphisms associated with marbling score of beef

MEAT SCIENCE Meat Science 77 (2007) 257–263 www.elsevier.com/locate/meatsci

Titin-cap (TCAP) polymorphisms associated with marbling score of beef H.S. Cheong a, D. Yoon b, L.H. Kim a, B.L. Park a, H.W. Lee a, C.S. Han a, E.M. Kim a, H. Cho c, E.R. Chung d, I. Cheong b, H.D. Shin a,* a

Department of Genetic Epidemiology, SNP Genetics, Inc., Rm 1407, Complex B, WooLim Lion’s Valley, 371-28, Gasan-Dong, Geumcheon-Gu, Seoul, 153-803, Republic of Korea b National Livestock Research Institute, RDA, Suwon, 441-706, Republic of Korea c Department of Bio-Systems, KAIST, Daejeon, 305-701, Republic of Korea d Department of Biotechnology, Sangji University, Wonju, 220-702, Republic of Korea Received 29 August 2006; received in revised form 13 March 2007; accepted 14 March 2007

Abstract Marbling score (MS) is the major qualitative trait that affects carcass quality in beef cattle. In this study, we examined the association between genetic polymorphisms of the titin-cap gene (TCAP) and carcass traits in Korean native cattle (also known as Hanwoo). By direct DNA sequencing in 24 unrelated Korean cattle, we identified five sequence variants in 1.2 kb of TCAP. Among them, four common polymorphic sites were selected for genotyping in the beef cattle (n = 437). Pair-wise linkage analysis with four polymorphisms showed strong linkage disequilibrium (LD), and three major haplotypes (freq. > 0.1) were constructed. Statistical analysis revealed that polymorphisms in intron1 (g.346G > A) and exon2 (g.592-597CTGCAG[Leu-Gln]insdel) showed significant association with marbling score (Pcor. = 0.003 and 0.02, respectively). One haplotype, ht2[C-G-G-del], also showed significant association with MS (Pcor. = 0.0004). Our findings suggest that polymorphisms in TCAP might be among the important genetic factors involved in carcass quality in beef cattle. Ó 2007 Elsevier Ltd. All rights reserved. Keywords: TCAP; Marbling score; Cold carcass weight; Polymorphism

1. Introduction Genetic improvement has long been considered an important factor in the competitiveness of beef cattle production. Identification of genes and/or polymorphisms underlining quantitative traits, which are involved in different phenotypes of traits, and an understanding of how these genes/polymorphisms interact with the environment or with other genes affecting economic traits might be the keys to successful application of marker-assisted selection in the commercial animal population. As one of those economic traits, marbling is inter-muscular fat that gives meat *

Corresponding author. Tel.: +82 2 2026 4288; fax: +82 2 2026 4299. E-mail address: [email protected] (H.D. Shin).

0309-1740/$ - see front matter Ó 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.meatsci.2007.03.014

flavor and tenderness. Thus an increase in the degree of marbling raises the level of quality. Gene coding for sarcomeric proteins may play a key role in muscle mass accretion and meat production. Sarcomere assembly is regulated by the muscle protein titin. Titin is a giant elastic protein with kinase activity that extends half the length of a sarcomere. It serves as a scaffold to which myofibrils and other muscle-related proteins are attached (Granzier & Labeit, 2004). Because of its cytoskeletal role and large content in muscle, its potential role in meat texture has been postulated (Lametsch et al., 2003; Taylor, Geesink, Thompson, Koohmaraie, & Goll, 1995). The titin-cap gene (TCAP) encodes a protein found in striated and cardiac muscle that binds to the titin Z1–Z2 domains and is a substrate of titin kinase, interactions thought to be critical to

258

H.S. Cheong et al. / Meat Science 77 (2007) 257–263

sarcomere assembly (Mayans et al., 1998). In addition to its key role in myofibril assembly, a more dynamic role in myofibril turnover is also emerging (Mason, Bayol, & Loughna, 1999; Schroder et al., 2001). Thus TCAP seems to play a part in determination of meat quality. The full-length coding sequence of TCAP, comprising 166 amino acids, showed high sequence similarities with human (95.8%) and mouse (95.2%) TCAP genes. A radiation hybrid analysis has localized the gene on bovine chromosome 19, whereas the comparative human and porcine counterparts are on HSA17 and SSC12 (Yu et al., 2004). However, to date, no polymorphisms have ever been reported in TCAP in farm animals. In this study, we examined the TCAP gene as one of the most promising candidate genes related to meat production and quality in beef cattle. We performed extensive screening of TCAP by direct sequencing to detect polymorphisms and examined genetic association with the carcass traits. Here, we present five polymorphisms identified in TCAP and the results of an association study with meat quantity and quality in Korean cattle (also known as Hanwoo). 2. Materials and methods 2.1. Animals and phenotypic data The Korean native cattle genomic DNA samples were obtained from 437 steers produced from 76 sires used in the progeny testing program of the National Livestock Research Institute (NLRI) of Korea. All steers were fed for 731.39 ± 16.53 days under a tightly controlled feeding program in the Daekwanryeong and Namwon branches. They were weaned at a mean age of 3 months and fed until they were 6 months old with 30% concentrates and 70% roughage. After 6 months of age, they were fed with concentrates consisting of 15% crude protein (CP)/71% totally digestible nutrients (TDN) until they were 14 months old; 13% CP/72% TDN until 20 months; and 11% CP/73% TDN until 24 months of age, respectively. The roughage was offered ad libitum, and steers had free access to fresh water during the whole period. Live weights were determined before slaughter. The mean of live weights was 539.93 ± 51.96 kg. Yield grades for carcasses were determined by cold carcass weight (CW). After a 24-h chill, CW weights were measured, and then the left side of each carcass was cut between the last rib and the first lumbar vertebra to determine marbling score (MS). The mean of the CW was 311.47 ± 33.39 kg. MS was determined by assessing the degree of marbling in the cut surface of the ribeye. The degree of marbling was evaluated according to the Korean Beef Marbling Standard (1 = trace, 7 = very abundant) (APGS, 1995). The mean of the MS was 2.25 ± 1.36.

PRISM 3730 DNA analyzer (Applied Biosystems, Foster City, CA). Three primer sets for the amplification and sequencing analysis were designed based on GenBank sequences (Ref. Genome seq.: AY428575 released on 05 November 2003). Information regarding primers is available in Table 1, and sequence chromatograms of variants are shown in Fig. 3. 2.3. Genotyping by single-base extension (SBE) and electrophoresis For genotyping of polymorphic sites, amplifying and extension primers were designed for single-base extension (SBE) (Vreeland, Meagher, & Barron, 2002). Primer extension reactions were performed with the SNaPshot ddNTP Primer Extension Kit (Applied Biosystems). To clean up the primer extension reaction, one unit of SAP (shrimp alkaline phosphatase) was added to the reaction mixture, and the mixture was incubated at 37 °C for 1 h, followed by 15 min at 72 °C for enzyme inactivation. The DNA samples, containing extension products, and Genescan 120 Liz size standard solution were added to Hi-Di formamide (Applied Biosystems) according to the recommendation of the manufacturer. The mixture was incubated at 95 °C for 5 min, followed by 5 min on ice, and then electrophoresis was performed using the ABI Prism 3100 Genetic Analyzer. The results were analyzed using the programs ABI Prism GeneScan and Genotyper (Applied Biosystems). Information concerning the primers is shown in Table 2. 2.4. Statistics We examined a widely used measure of linkage disequilibrium between all pairs of biallelic loci, Lewontin’s D 0 (jD 0 j) (Hedrick, 1987) and r2. Haplotypes and their frequencies were inferred using the algorithm developed by Stephens, Smith, and Donnelly (2001). Phase probabilities of each site were calculated for each individual using this software. Association analyses with carcass traits (CW and MS) were performed using a mixed-effect model treating ‘‘sire’’ as a random effect. Age at slaughter was also included in the model. Other covariates were not available for this analysis. We used a full model that includes all four polymorphisms. We think the full model is more appropri-

Table 1 Primer sequences for TCAP sequence variants screening Primer

Locus

Sequence

TCAP-P1

Exon1

Forward Reverse

GGGAGTGAGCAGTCATCATGGC AGAGGCAGCACCCGCTGGT

2.2. Sequencing analysis of TCAP

TCAP-P2

Exon2

Forward Reverse

GGTTCAGCATCCCTTCGCTTCT AGCATCCGTGACCAGCAGCTC

We have sequenced a 1.2 kb full genome to discover variants in 24 unrelated Korean cattle using the ABI

TCAP-P3

Exon2

Forward Reverse

GCTGCTGGCACTGGAAACA CTCCACCCTGCCTCTGCCC

H.S. Cheong et al. / Meat Science 77 (2007) 257–263

259

Table 2 Sequences of amplifying and extension primers for genotyping of polymorphisms in TCAP by single-base extension method Locus

Sequence

g.227C > T

Forward Reverse Extension

GGGAGTGAGCAGTCATCATGGC AGAGGCAGCACCCGCTGGT AATCAATGATGATAGAGTGCCTGCTGGGGAAAGTGGAGTTGC

g.310G > T

Forward Reverse Extension

GGGAGTGAGCAGTCATCATGGC AGAGGCAGCACCCGCTGGT CCCCAGGGAGCTCTGCTGCCCC

g.346G > A

Forward Reverse Extension Forward Reverse Extension

GGGAGTGAGCAGTCATCATGGC AGAGGCAGCACCCGCTGGT GATCGGGCAGCAGCTCTCGGGTTCAGC GGTTCAGCATCCCTTCGCTTCT AGCATCCGTGACCAGCAGCTC ATGATGATGAGCGCGAGGAGACCCCCATCCAG

g.592-597CTGCAG[Leu-Gln]insdel

ate for controlling the closely linked polymorphisms effectively. The effective number of independent marker loci in TCAP was calculated to correct for multiple testing. The number was calculated using the software SNPSpD (http://genepi.qimr.edu.au/general/daleN/SNPSpD/), which is based on the spectral decomposition (SpD) of matrices of pair-wise LD between polymorphisms. The resulting number of independent marker loci was applied to correct for multiple testing (Nyholt, 2004). The mRNA folding structure was predicted using MFOLD (www.bioinfo.rpi.edu/ applications/mfold). The secondary protein structures of alternative alleles of g.592-597CTGCAG[Leu-Gln]insdel were also predicted using the software PSIPRED (http:// bioinf.cs.ucl.ac.uk/psipred/psiform.html) (McGuffin, Bryson, & Jones, 2000). 3. Results and discussion By direct DNA sequencing, five polymorphisms were identified in TCAP: three in introns (g.277C > T, g.310G > T, and g.346G > A) and two in coding exons (g.83G > A[Arg18Gln] and g.592-597CTGCAG[Leu-Gln]insdel). The locations and allele frequencies of the polymorphisms are

shown in Table 3 and Fig. 1a. Interestingly, a common (freq. = 0.342) 6-bp deletion in exon2, which corresponds to two amino acid deletions (Leu-Gln), was identified in this study. Among identified polymorphisms, four (g.277C > T, g.310G > T, g.346G > A, and g.592-597CTGCAG [LeuGln]insdel) were selected for larger-scale genotyping based on frequency (>0.1, Table 3). The minor allele frequencies of genotyped polymorphisms were 0.407 (g.277C > T), 0.096 (g.310G > T), 0.432 (g.346G > A), and 0.342 (g.592597CTGCAG[Leu-Gln]insdel), respectively, in Korean cattle (n = 437). Pair-wise linkage analysis with the four polymorphisms showed strong LDs, and three major haplotypes (freq. > 0.1) were constructed (Fig. 1b) using these four polymorphisms (Fig. 1c). Associations of TCAP polymorphisms with carcass traits were analyzed using the mixed-effect model with sire and age as covariates. Sire was treated as a random effect and age as a fixed effect. The obtained P-values were corrected for multiple testing by the effective number of independent marker loci (3.77), calculated using the software SNPSpD (Nyholt, 2004). Among the haplotypes, three of the major (freq. > 0.1) ones (ht1[T-G-G-ins], ht2[C-G-Gdel], and ht3[C-G-A-ins]) were analyzed (Fig. 1b).

Table 3 Genotype and allele frequencies of five polymorphisms in TCAP Locus

Region

A.A. change

Genotype/no. of subjects

g.83G > A

Exon1

Arg18Gln

G 22 C 158 G 368 G 151 ins 191

g.227C > T g.310G > T g.346G > A g.592-597CTGCAG[Leu-Gln]insdel

Intron1 Intron1 Intron1 Exon2

– – – 112Leu-Gln insdel

Rare allele frequencies and heterozygosity calculated in Korean cattle.

AG 1 CT 199 GT 54 AG 180 insdel 193

A 0 T 77 T 15 A 93 del 53

Total

Frequency

Heterozygosity

0.022

0.043

0.407

0.483

0.096

0.174

0.432

0.491

0.342

0.450

23 434 437 424 437

260

H.S. Cheong et al. / Meat Science 77 (2007) 257–263

g.592-597CTGCAG [Leu-Gln]insdel (0.342)*

g.346G>A (0.432)*

g.310G>T (0.096)*

g.277C>T (0.407)*

g.83G>A R18Q (0.022)

Map of Bos taurus TCAP (titin-cap) on chromosome 19p

+1

Exon2

Exon1

100 bp

LDs among TCAP polymorphisms

Haplotypes in TCAP

r2

59 25 [L 97C eu TG -G C ln AG ]in sd el g.

ins del ins ins ins del del -

g. 34 6G >A

G G A A A A G -

Polymorphisms

g. 31 0G >T

g. 34 6G >A g. 59 25 [L 97C eu TG -G C l n AG ]in sd el

31 0G >T

G G G T G G G -

Freq. 0.271 0.260 0.229 0.082 0.068 0.040 0.025 0.025

g. 22 7C >T

T C C C T T T -

g.

Hap. ht1 ht2 ht3 ht4 ht5 ht6 ht7 Others

g. 22 7C >T

|D '|

g.227 C>T

-

0.941

0.376

0.531

g.310 G>T

0.064

-

0.752

0.652

g.346 G>A

0.071

0.081

-

0.685

g.592-597CTGCAG [Leu-Gln]insdel

0.100

0.024

0.180

-

Fig. 1. Gene map, haplotypes, and LD coefficients in TCAP. (a) Gene map and polymorphisms inTCAP on chromosome 19p. The coding exon is marked by black blocks and 5 0 and 3 0 UTRs by white blocks. The first base of the transcriptional site is denoted as nucleotide +1. Asterisks (*) indicate polymorphisms genotyped in a larger Korean cattle cohort (n = 437). (b) Haplotypes of TCAP. Haplotypes with frequency >0.025 are presented. Others contain rare haplotypes: C-T-G-del, C-G-A-del, C-G-G-ins, T-T-G-ins, T-G-G-ins, C-G-G-del, C-G-A-ins, C-T-A-ins, T-G-A-ins, T-G-A-del, T-G-G-del, C-T-G-del, C-G-A-del, C-G-G-ins, and T-T-G-ins. (c) Linkage disequilibrium coefficient (jD 0 j and r2) among TCAP polymorphisms.

No positive associations were detected with CW. However, two polymorphisms in intron1 (g.346G > A) and exon2 (g.592-597CTGCAG[Leu-Gln]insdel) showed significant associations with MS (Table 4). The intronic polymorphism (g.346G > A) showed a very strong association with MS. The ‘‘A’’ allele of g.346G > A revealed a lowering effect on MS, e.g., the lowest MS was found in ‘‘AA’’ (MS = 1.85), intermediate in ‘‘A/G’’ (MS = 2.13), and the highest in ‘‘G/G’’ (MS = 2.46) (Pcor. = 0.003, Table 4). The two amino acid (Leu-Gln) deletion allele of g.592-597CTGCAG[Leu-Gln]insdel in exon2 also showed gene-dose dependent effects on MS, e.g., the highest was found in ‘‘deletion/deletion’’ (MS = 2.55), intermediate in ‘‘insertion/deletion’’ (MS = 2.26), and the lowest in ‘‘insertion/insertion’’ allele homozygotes (MS = 2.02) (Pcor. = 0.02). In further haplotype association analysis, the second most common (freq. = 0.260) haplotype in TCAP, ht2[CG-G-del], revealed the highest association with MS (Pcor. = 0.0004) among TCAP polymorphisms (Table 4). Titin constitutes about 10% of muscle mass, representing the third most abundant protein in the muscle following actin and myosin (Sela, 2002), and TCAP is linked to

the dynamic control of myofibrillogenesis and muscle turnover in skeletal muscle (Schroder et al., 2001). Based on these previous studies, we had hypothesized that TCAP polymorphisms are associated with quantitative and qualitative traits, CW and MS. The results of our study showed that, although no association with CW was detected (Table 4), three polymorphisms (one intronic, one exonic, and one haplotype polymorphism) in TCAP were associated with MS. Although the mechanisms involved in the association of alternative polymorphisms of TCAP with MS are not currently understood, our study clearly indicated that TCAP polymorphisms have an influence on MS in beef cattle. The crucial role of the amino acid change, including insertion/deletion, is well acknowledged. To examine possible differences mediated by alternative alleles of g.592597CTGCAG[Leu-Gln]insdel, mRNA stability/instability was predicted using the software MFOLD (Zuker, 2003). The secondary protein structures of alternative alleles were also predicted using the software PSIPRED (data not shown) (McGuffin et al., 2000). Although no additional changes in secondary protein structure of alternative alleles (other than Leu-Gln insertion/deletion) were predicted by

H.S. Cheong et al. / Meat Science 77 (2007) 257–263

261

Table 4 Association analyses of TCAP polymorphisms with carcass traits (CW and MS) among Korean native cattle Trait

CW

MS

Loci

g.227C > T g.310G > T g.346G > A g.592-597CTGCAG [Leu-Gln]insdel ht1 ht2 ht3 g.227C > T g.310G > T g.346G > A g.592-597CTGCAG [Leu-Gln]insdel ht1 ht2 ht3

Location

Amino acid change

Genotype C/Ca N(mean ± SD)b

C/Ra N(mean ± SD)b

R/Ra N(mean ± SD)b

P

Pcor.

Intron1 Intron1 Intron1 Exon2

– – – 112Leu-Gln insdel

158(310.07 ± 32.99) 368(311.68 ± 33.12) 151(313.05 ± 33.86) 191(311.41 ± 34.00)

199(311.90 ± 33.25) 54(312.46 ± 34.54) 180(311.11 ± 32.95) 193(312.67 ± 34.03)

77(313.08 ± 35.28) 15(302.60 ± 36.91) 93(310.25 ± 34.59) 53(307.32 ± 28.76)

0.44 0.30 0.64 0.77

NS NS NS NS

– – – Intron1 Intron1 Intron1 Exon2

– – – – – – 112Leu-Gln insdel

233(309.39 ± 32.86) 245(310.91 ± 33.46) 260(311.40 ± 33.30) 158(2.16 ± 1.36) 368(2.26 ± 1.33) 151(2.46 ± 1.36) 191(2.02 ± 1.23)

171(314.25 ± 33.25) 157(314.24 ± 34.35) 154(311.18 ± 34.50) 199(2.28 ± 1.38) 54(1.78 ± 1.14) 180(2.13 ± 1.32) 193(2.26 ± 1.37)

33(311.73 ± 37.71) 35(303.00 ± 27.19) 23(314.22 ± 27.53) 77(2.01 ± 1.06) 15(1.93 ± 1.39) 93(1.85 ± 1.19) 53(2.55 ± 1.35)

0.33 0.63 0.63 0.75 0.02 0.0008 0.005

NS NS NS NS NS 0.003 0.02

– – –

– – –

233(2.12 ± 1.30) 245(1.98 ± 1.21) 260(2.27 ± 1.32)

171(2.29 ± 1.41) 157(2.39 ± 1.38) 154(2.06 ± 1.31)

33(2.12 ± 0.86) 35(2.74 ± 1.50) 23(2.09 ± 1.41)

0.54 0.0001 0.14

NS 0.0004 NS

Genotype and haplotype distributions and P-values controlling for sire and age at slaughter as covariates are shown. NS: not significant a C/C, C/R, and R/R represent the common allele, and heterozygotes and homozygotes for the rare allele, respectively. b N(mean ± SD): Number of animals (mean of values ± standard deviations). To achieve a simple correction for multiple testing of single-nucleotide polymorphisms (SNPs) in linkage disequilibrium (LD) with each other, the effective number of independent marker loci (3.77) in TCAP was calculated using the software SNPSpD (http://genepi.qimr.edu.au/general/daleN/SNPSpD/), on the basis of the spectral decomposition (SpD) of matrices of pairwise LD between SNPs (Nyholt, 2004). Pcor. represents the simple corrected P-value. Significant associations are shown in boldface.

the software PSIPRED, obvious changes in folding patterns of mRNA were detected between alternative alleles of g.592-597CTGCAG[Leu-Gln]insdel of TCAP mRNAs by the software MFOLD (Fig. 2). If this difference mediated by g.592-597CTGCAG[Leu-Gln]insdel is real in vivo, the genetic effect of ht2 might be just tracking the effect of g.592-597CTGCAG[Leu-Gln]insdel because ht2[C-G-Gdel] was almost (>91%) tagged by g.592-597CTGCAG[Leu-Gln]insdel (Fig. 1b). In addition, although it is

hard to tell which is the causative site(s) among three associated polymorphisms, intron polymorphisms might also impact gene function by affecting the splice donor, acceptor site, or regions nearby as well as regulatory motifs within introns. In an association study, the interpretation of an association is dependent on whether the association is causal (i.e., there is a true relationship between the genetic factor and trait), due to chance (which is assessed by the P-value),

Fig. 2. TCAP mRNA folding structures predicted by MFOLD Each modeled structure for the TCAPmRNA–carrying polymorphisms g.592597CTGCAG[Leu-Gln]insertion and g.592-597CTGCAG[Leu-Gln]deletion is shown. The protein-coding region of NM_001014915 was used for predicting mRNA folding structure. DG: loop free energy. MFOLD: http://www.bioinfo.rpi.edu/applications/mfold (Zuker, 2003).

262

H.S. Cheong et al. / Meat Science 77 (2007) 257–263

Fig. 3. Chromatograms of discovered polymorphisms in TCAP Arrows indicate the polymorphic sites. At the g.592-597CTGCAG[Leu-Gln]insdel polymorphic site, the red box indicates 6bp insertion/deletion. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

or due to bias (usually confounding or a type of selection bias). In addition, other possibilities always emerge. Although it is true that the allele itself may be functional and directly affect the expression of the phenotype, a more likely event is that the allele is in linkage disequilibrium with another allele at a nearby locus that is the true causal allele. There is the possibility of the existence of nearby and/or linked genetic factor(s). However, when considering that (1) strong associations (P cor. = 0.02–0.0004), high enough to overcome the correction for multiple testing, were detected; (2) signals were revealed in multiple functional regions (intron, non-synonymous, and haplotype polymorphisms) of a functionally relevant and important candidate gene; and (3) different structures of mRNA are expected in alternative alleles of a non-synonymous polymorphism (6 bp insertion/deletion in exon2) in silico, results of this current study, as a typical candidate gene approach, may prove useful. In addition, similar to hundreds of other association studies using the candidate gene approach to human diseases, a report of our results, even if not complete, would facilitate further studies and contribute to understanding the genetic background of important traits. Further biological and/or functional evidence is needed to confirm the genetic effects of TCAP polymorphisms on MS.

In summary, we have identified five polymorphisms in TCAP in Korean cattle, and four common polymorphic sites were selected for genotyping. Statistical analysis revealed that, although there were no measurable effects on CW, genetic polymorphisms in TCAP (g.346G > A, g.592-597CTGCAG[Leu-Gln]insdel and ht2[C-G-G-del]) showed significant associations with the important carcass quality trait, marbling score, in beef cattle. Acknowledgement This work was supported by a Grant from the BioGreen 21 Program, Rural Development Administration, Republic of Korea. References APGS (1995). Report of business for animal products grading. Animal products grading system, National Livestock Co-operatives Federation, Korea. Granzier, H. L., & Labeit, S. (2004). The giant protein titin: A major player in myocardial mechanics, signaling, and disease. Circulation Research, 94(3), 284–295. Hedrick, P. W. (1987). Gametic disequilibrium measures: Proceed with caution. Genetics, 117(2), 331–341. Lametsch, R., Karlsson, A., Rosenvold, K., Andersen, H. J., Roepstorff, P., & Bendixen, E. (2003). Postmortem proteome changes of porcine

H.S. Cheong et al. / Meat Science 77 (2007) 257–263 muscle-related to tenderness. Journal of Agricultural and Food Chemistry, 51(24), 6992–6997. Mason, P., Bayol, S., & Loughna, P. T. (1999). The novel sarcomeric protein telethonin exhibits developmental and functional regulation. Biochemical and Biophysical Research Communications, 257(3), 699–703. Mayans, O., van der Ven, P. F., Wilm, M., Mues, A., Young, P., Furst, D. O., et al. (1998). Structural basis for activation of the titin kinase domain during myofibrillogenesis. Nature, 395(6705), 863–869. McGuffin, L. J., Bryson, K., & Jones, D. T. (2000). The PSIPRED protein structure prediction server. Bioinformatics, 16(4), 404–405. Nyholt, D. R. (2004). A simple correction for multiple testing for singlenucleotide polymorphisms in linkage disequilibrium with each other. American Journal of Human Genetics, 74(4), 765–769. Schroder, R., Reimann, J., Iakovenko, A., Mues, A., Bonnemann, C. G., Matten, J., et al. (2001). Early and selective disappearance of telethonin protein from the sarcomere in neurogenic atrophy. Journal of Muscle Research and Cell Motility, 22(3), 259–264.

263

Sela, B. A. (2002). Titin: Some aspects of the largest protein in the body. Harefuah, 141(7), 631–635, 665. Stephens, M., Smith, N. J., & Donnelly, P. (2001). A new statistical method for haplotype reconstruction from population data. American Journal of Human Genetics, 68(4), 978–989. Taylor, R. G., Geesink, G. H., Thompson, V. F., Koohmaraie, M., & Goll, D. E. (1995). Is Z-disk degradation responsible for postmortem tenderization? Journal of Animal Science, 73(5), 1351–1367. Vreeland, W. N., Meagher, R. J., & Barron, A. E. (2002). Multiplexed, high-throughput genotyping by single-base extension and end-labeled free-solution electrophoresis. Analytical Chemistry, 74(17), 4328–4333. Yu, S. L., Chung, H. J., Jung, K. C., Sang, B. C., Yoon, D. H., Lee, S. H., et al. (2004). Cloning and Characterization of Bovine Titin-cap (TCAP) Gene. Asian-Austrian Journal of Animal Science, 17(10), 1344–1349. Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research, 31(13), 3406–3415.