- Email: [email protected]
TLR9 activation induces aberrant IgA glycosylation via APRIL- and IL-6–mediated pathways in IgA nephropathy
basic research
www.kidney-international.org
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
Q2Q1
Q12
Q3
TLR9 activation induces aberrant IgA glycosylation via APRIL- and IL-6–mediated pathways in IgA nephropathy
OPEN
Yuko Makita1, Hitoshi Suzuki1, Toshiki Kano1, Akiko Takahata1, Bruce A. Julian2,3, Jan Novak3 and Yusuke Suzuki1 1
Department of Nephrology, Juntendo University Faculty of Medicine, Tokyo, Japan; 2Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, USA; and 3Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama, USA
Galactose-deficient IgA1 (Gd-IgA1) plays a crucial role in the development of IgA nephropathy (IgAN). However, the pathogenic mechanisms driving Gd-IgA1 production have not been fully elucidated. Innate-immune activation via Toll-like receptor 9 (TLR9) is known to be involved in GdIgA1 production. A proliferation inducing ligand (APRIL) and IL-6 are also known to enhance Gd-IgA1 synthesis in IgAN. With this as background, we investigated how TLR9 activation in IgA secreting cells results in overproduction of nephritogenic IgA in the IgAN-prone ddY mouse and in human IgA1-secreting cells. Injection of the TLR9 ligand CpG-oligonucleotides increased production of aberrantly glycosylated IgA and IgG-IgA immune complexes in ddY mice that, in turn, exacerbated kidney injury. CpGoligonucleotide-stimulated mice had elevated serum levels of APRIL that correlated with those of aberrantly glycosylated IgA and IgG-IgA immune complexes. In vitro, TLR9 activation enhanced production of the nephritogenic IgA as well as APRIL and IL-6 in splenocytes of ddY mice and in human IgA1-secreting cells. However, siRNA knockdown of APRIL completely suppressed overproduction of Gd-IgA1 induced by IL-6. Neutralization of IL-6 decreased CpG-oligonucleotide-induced overproduction of Gd-IgA1. Furthermore, APRIL and IL-6 pathways each independently mediated TLR9-induced overproduction of Gd-IgA1. Thus, TLR9 activation enhanced synthesis of aberrantly glycosylated IgA that, in a mouse model of IgAN, further enhanced kidney injury. Hence, APRIL and IL-6 synergistically, as well as independently, enhance synthesis of Gd-IgA1. Kidney International (2019) j.kint.2019.08.022
-, -–-;
https://doi.org/10.1016/
KEYWORDS: APRIL; galactose-deficient IgA1; IgA nephropathy; IL-6; immune complex Copyright ª 2019, International Society of Nephrology. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Correspondence: Yusuke Suzuki, Department of Nephrology, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan. E-mail: [email protected] Received 11 January 2019; revised 30 July 2019; accepted 16 August 2019; published online 5 September 2019
Translational Statement Disease-specific therapy targeting galactose-deficient IgA1 can constitute a future treatment of IgA nephropathy. Results from this study, which demonstrated the involvement of a proliferation inducing ligand (APRIL) and interleukin-6 (IL-6) in overproduction of aberrantly glycosylated IgA, support the rationale for targeting APRIL and IL-6 in IgA nephropathy (IgAN). In fact, a recent study demonstrated positive effects of anti-APRIL monoclonal antibody in murine IgAN,1 and a clinical study with neutralizing APRIL antibody is currently ongoing in patients with IgAN.
gA nephropathy (IgAN), the most common primary glomerulonephritis,2 causes end-stage renal disease in 20% to 40% of patients within 20 years after onset of this disease.3 Although the pathogenesis of IgAN remains to be fully elucidated, episodic macroscopic hematuria concurrent with an infection of the upper respiratory tract suggests that the mucosal immune system plays an important role in the clinical manifestations of IgAN.4 Aberrant glycosylation of IgA is central in the pathogenesis of IgAN. Glomerular IgA in patients with IgAN is restricted to the IgA1 subclass and is enriched for molecules that have some hinge-region O-glycans deficient in galactose (galactose-deficient IgA1 [Gd-IgA1]).5,6 Furthermore, serum levels of Gd-IgA1 and IgA1-containing immune complexes (ICs) with Gd-IgA1–specific autoantibodies are elevated in patients with IgAN.7–9 However, the mechanisms for production of Gd-IgA1 are still not fully understood. We used the IgAN-prone ddY mouse model in this study. ddY mice develop glomerular injuries mimicking those of humans with IgAN.10 Although mice do not have IgA molecules with O-glycans typical for human IgA1, human IgAN and this IgAN-prone ddY mouse model share some diseasespecific features, such as serum elevation of aberrantly glycosylated IgA and IgG-IgA IC.6,11 In fact, aberrant IgA glycosylation due to deficiency of b1,4-galactosylation of Nglycans induces murine IgAN because of elevation of serum levels of high-molecular-weight IgA and IgA-containing IC
I
Kidney International (2019) -, -–-
1 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106
basic research
107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
with their subsequent renal deposition and glomerular injury.12 ddY mice show proteinuria and a mesangial proliferative glomerulonephritis with co-deposition of IgA and C3 in the glomeruli. A genome-wide association study identified candidate loci linked with progression of IgAN in ddY mouse.13 The loci include genes functionally similar to those associated with human IgAN.14,15 These findings suggest that IgAN in ddY mice and in humans may be affected at least in part by the same susceptibility genes. Although the molecular features of murine IgA and human IgA1 differ, aberrantly glycosylated IgA tends to form polymeric IgA and IgG-IgA ICs that subsequently drive progression of renal injury in the ddY murine model of IgAN, as well as in human IgAN. Thus the ddY mice model has some common features with human IgAN and can be a useful tool for analysis of various pathogenetic features of IgAN. Toll-like receptors (TLRs) are key molecules in the innate immune system and have been implicated in the pathogenesis of IgAN.16–20 Exogenous antigens derived from pathogens activate the TLR9-MyD88 signaling pathway.21 This process leads to significantly increased synthesis of inflammatory cytokines, such as type 1 interferon and interleukin-6 (IL-6).22 Recently we demonstrated that TLR9 activation aggravated kidney injury in IgAN-prone ddY mice, with elevation of serum levels of IgA and IgG-IgA ICs.16 Moreover, specific TLR9 polymorphisms associate with disease progression in patients with IgAN.16 Serum levels of tumor necrosis factor–a and IL-6 are elevated in patients with IgAN.23 Moreover, IL-6 and IL-4 increase production of IgA1 and accentuate the degree of galactose deficiency, increasing Gd-IgA1 synthesis by IgA1-secreting cell lines from patients with IgAN.24 These findings suggest that IL-6 may be a key mediator of this process.24,25 The gene of tumor necrosis factor ligand superfamily member 13 (TNFSF13) encodes a proliferation inducing ligand (APRIL) that is a central cytokine for the maturation and survival of B cells.26 APRIL shares some signaling receptors important for B-cell development with another TNF super family ligand, B-cell activating factor (BAFF). BAFF is also involved in affinity maturation of B cells. A genomewide association study identified TNFSF13 as one of the candidate genes associated with IgAN.27 Indeed, in patients with IgAN, serum levels of APRIL are elevated28 and the levels are associated with renal prognosis.28 To gain a better understanding of the underlying mechanisms involved in the overproduction of aberrantly glycosylated IgA via TLR9 activation by the ligand CpG oligodeoxynucleotides (ODNs), we used IgAN-prone ddY mice and human IgA1-secreting cells. RESULTS Activation of TLR9 aggravated renal injury in ddY mice via increased production of nephritogenic IgA
TLR9 can be activated by the corresponding ligands, such as CpG-ODN. To test the effect of TLR9 activation in a murine model of IgAN, we used injection of the ligand in IgAN-prone
ddY mice. Mice injected with CpG-ODN developed mesangial proliferation and extracellular matrix expansion (Figure 1a). Renal histologic scores based on mesangial proliferation and mesangial matrix expansion in mice injected with CpG-ODN were significantly higher than those in control mice (P < 0.01; Figure 1a). Urinary albumin levels in the mice injected with CpG-ODN were significantly elevated compared with those of the control mice (P < 0.01; Figure 1a). Only the mice injected with CpG-ODN developed mesangial deposits of IgA, IgG, and complement C3 (Figure 1b). Mice injected with CpG-ODN showed significantly higher serum levels of IgA (P < 0.01) and IgG (P < 0.01) than did control mice (Figure 1c). Serum IgA from mice injected with CpGODN mice had lower reactivity with Ricinus communis agglutinin-I (RCA-I) and Sambucus nigra agglutinin lectins than Q4 that from control mice (Figure 1c), indicating a lower content of galactose and sialic acid on N-glycans of murine IgA. Furthermore, the serum level of IgG-IgA IC in mice injected with CpGODN was significantly higher than that in control mice (P < 0.05; Figure 1c). These findings indicated that TLR9 activation by CpG-ODN resulted in the overproduction of aberrantly glycosylated IgA and IgG-IgA IC, leading to immune-complex deposition and renal injury. B cells and dendritic cells were involved in the CpG-ODN responses
We investigated which cell types are involved in the induction of overproduction of aberrantly glycosylated IgA in response to CpG-ODN. B cells and dendritic cells (DCs) were isolated from the spleens of ddY mice using anti-mouse CD19 and CD11c antibodies by fluorescence activated cell sorting, Q5 respectively. CpG-ODN stimulation of isolated B cells induced overproduction of IgA. In addition, CpG-ODN significantly increased IgA production when B cells were cocultured with DCs (Supplementary Figure S1). These results suggested that CpG-ODN directly activated B cells and that DCs further enhanced IgA production upon TLR9 activation. Overproduction of APRIL enhanced synthesis of aberrantly glycosylated IgA and IgG-IgA ICs
We assessed whether APRIL and/or BAFF was involved in the synthesis of nephritogenic IgA induced by TLR9 activation. Injection of CpG-ODN in ddY mice significantly elevated serum levels of APRIL and BAFF (Figure 2a). Expression levels of APRIL in splenocytes correlated with production of aberrantly glycosylated IgA and formation of IgG-IgA IC (Figure 2b). Expression levels of BAFF in splenocytes correlated with production of aberrantly glycosylated IgA but not with formation of IgG-IgA IC (Figure 2b). Furthermore, serum levels of APRIL but not BAFF significantly correlated with elevated serum levels of aberrantly glycosylated IgA and IgG-IgA IC in the CpG-ODN–injected mice (Figure 2c). These findings suggest that both APRIL and BAFF may be involved in production of aberrantly glycosylated IgA, although APRIL may be more involved in the production of IgG-IgA IC. Kidney International (2019) -, -–-
2 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218
basic research
b
non–CpG-ODN
non–CpG-ODN
CpG-ODN
a
6 4 2
800
500
IgG (mg/dl)
IgA (mg/dl)
600 400 200
non–CpG-ODN CpG-ODN
400 300 200 100
0
0
2.0
2.0
non–CpG-ODN CpG-ODN
SNA
1.5 1.0 0.5 0.0
non–CpG-ODN CpG-ODN
(OD at 490nm)
RCA-I
20 0
non–CpG-ODN CpG-ODN
(OD at 490nm)
40
0
non–CpG-ODN CpG-ODN
c
50 μm
60 (mg/dl)
8
Urinary albumin
Renal injury score
50 μm
1.5 1.0 0.5 0.0
non–CpG-ODN CpG-ODN
IgG-IgA IC
(OD at 490nm)
2.5
print & web 4C=FPO
219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274
CpG-ODN
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
2.0 1.5 1.0 0.5 0.0
non–CpG-ODN CpG-ODN
Figure 1 | CpG-oligodeoxynucleotide (ODN) stimulation induced production of nephritogenic IgA. Injection with CpG-ODN increased blood levels of aberrantly glycosylated IgA and IgG-IgA immune complex (IC) and exacerbated kidney injury in ddY mice. (a) ddY mice before development of IgA nephropathy (IgAN) were intraperitoneally injected with CpG-ODN thrice weekly for 12 weeks. In histologic analysis of glomerular lesions, mice injected with CpG-ODN showed mesangial cellular proliferation and extracellular matrix expansion. The right panel shows evaluation of renal injuries by semiquantitative scoring. Renal histologic scores, evaluated by percentages of glomeruli with aforementioned lesions, showed that renal injury in the mice injected with CpG-ODN were exacerbated. Urinary albumin levels in the mice injected with CpG-ODN were significantly elevated compared with those of control mice. Bars in the bottom panels ¼ mean SEM. (b) Immunohistochemical analysis of glomerular IgA, IgG, and C3 deposits. Only mice injected with CpG-ODN developed mesangial deposits of IgA, IgG, and C3. (c) Serum levels of IgA, IgG, and IgG-IgA ICs were significantly increased after CpG-ODN treatment for 12 weeks. Serum IgA in mice injected with CpG-ODN showed significantly lower reactivity with Ricinus communis agglutinin-I (RCA-I) and Sambucus nigra agglutinin (SNA) lectins than did the IgA in control mice. These results indicate that injection of CpG-ODN increased serum levels of aberrantly glycosylated IgA. Individual points are shown. *P < 0.05, **P < 0.01. OD, optical density. To optimize viewing of this image, please see the online version of this article at www.kidney-international.org.
Kidney International (2019) -, -–-
3 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
Q10Q13
275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330
basic research
25
15
BAFF (ng/ml)
20 15 10 5 0
10 5 0
non–CpG-ODN CpG-ODN
0.0 0.0 0.5 1.0 1.5 2.0 2.5
0.0 0.0 0.5 1.0 1.5 2.0 2.5
10
15
20
RCA-I
1.0 r = 0.344 P = 0.06
0.0 0.0 0.5 1.0 1.5 2.0 2.5
1.5 1.0 r = 0.646 P < 0.05
0.5 0.0 0
25
10
15
20
25
2.5
1.0 0.5 0.0
5
APRIL (ng/ml)
1.5
1.5
2.0
APRIL (ng/ml)
2.0
0.5
5
0
(OD at 490nm)
r = -0.388 P < 0.05
IgG-IgA IC
1.0
(OD at 490nm)
1.5
r = -0.644 P < 0.05
0.0
2.5
BAFF expression
0.5
APRIL expression
2.0
RCA-I
r = 0.388 P < 0.05
1.0
IgG-IgA IC
0.5
2.5 (OD at 490nm)
1.0
APRIL expression
0.5
RCA-I
1.5
1.5
r = -0.051 P = 0.84 8
BAFF expression
10
12
14
16
BAFF (pg/ml)
IgG-IgA IC
0.0 0.0 0.5 1.0 1.5 2.0 2.5
2.0
(OD at 490nm)
r = -0.388 P < 0.05
IgG-IgA IC
1.0
(OD at 490nm)
1.5
0.5
c
2.5
2.0 (OD at 490nm)
RCA-I
b
non–CpG-ODN CpG-ODN
(OD at 490nm)
APRIL (ng/ml)
a
(OD at 490nm)
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
2.0 1.5 1.0 r = 0.325 P = 0.23
0.5 0.0
0
10
12
14
16
BAFF (pg/ml)
Figure 2 | Correlation between overproduction of a proliferation inducing ligand (APRIL) and aberrantly glycosylated IgA in mice injected with CpG- oligodeoxynucleotide (ODN). (a) Injection of ddY mice with CpG-ODN increased serum levels of B-cell activating factor (BAFF) and APRIL. (b) Expression levels of BAFF in whole splenocytes correlated with reduced reactivity with Ricinus communis agglutinin-I (RCA-I) lectin but did not correlate with formation of IgG-IgA immune complex (IC). Meanwhile, expression levels of APRIL were associated with production of aberrantly glycosylated IgA and formation of IgG-IgA IC. (c) In mice injected with CpG-ODN, serum levels of APRIL were associated with reduced reactivity of IgA with RCA-I lectin and elevated levels of IgG-IgA IC. Serum levels of BAFF did not correlate with production of glycosylated IgA and formation of IgG-IgA IC. Bars ¼ mean SEM. *P < 0.05. OD, optical density.
IL-6 induced production of aberrantly glycosylated IgA
Serum levels of IL-6 in mice injected with CpG-ODN were significantly higher compared with control mice (P < 0.05; Figure 3a). Using splenocytes of IgAN-prone ddY mice, we examined whether TLR9-induced cellular activation and overproduction of aberrantly glycosylated IgA was mediated by IL-6. CpG-ODN stimulation enhanced production of IL-6 by splenocytes in vitro. The addition of IL-6 to the culture medium of splenocytes increased IgA production. Moreover, IL-6 enhanced synthesis of aberrantly glycosylated IgA and formation of IgG-IgA IC and increased APRIL production (Figure 3a). IL-6–neutralizing antibody reduced CpG-ODN– induced total IgA, aberrantly glycosylated IgA production, and IgG-IgA IC formation (Figure 3b). These findings indicate that TLR9 activation was mediated, at least in part, by IL6. Furthermore, another TLR9-mediated pathway(s) may be involved in the production of aberrantly glycosylated IgA. APRIL and IL-6 enhanced synthesis of Gd-IgA1 in human IgA1secreting cells
We further tested whether APRIL and IL-6 are common major mediators that enhance production of nephritogenic IgA in human IgA1-secreting cells. CpG-ODN supplementation enhanced increase of IL-6, expression of APRIL,
production of APRIL protein, and production of IgA and GdIgA1 (Figure 4a). Stimulation with IL-6 and with APRIL enhanced production of IgA and Gd-IgA1 (Figure 4b, c). The effects of CpG-ODN stimulation on production of IgA and Gd-IgA1 were partly reduced by IL-6-neutralizing antibody (Figure 4d). Moreover, APRIL small, interfering (si)RNA knockdown also reduced production of IgA and Gd-IgA1 induced by IL-6 stimulation (Figure 4b), indicating that APRIL and IL-6 synergistically promote the generation of GdIgA1. DISCUSSION
Mesangial IgA in human IgAN is exclusively of the IgA1 subclass that displays abnormal O-glycosylation.29,30 Human IgA1 has a hinge region with O-glycans that is absent from murine IgA.6,31,32 However, aberrant glycosylation of N-glycans is involved in the pathogenesis of a murine model of IgAN in ddY mice, with elevation of aberrantly glycosylated IgA and IgA-containing IC.11,12 Aberrant modifications of IgA carbohydrates in either O- or N-glycans are characteristic properties of nephritogenic IgA-containing IC. Several studies have shown TLR9 activation in progression of IgAN.17–19 In the present study, we have shown that activation of TLR9 by intraperitoneal injection of Kidney International (2019) -, -–-
4 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442
basic research
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
50 0 non CpG-ODN
500 0
0.4 0.3
0
**
400
0.8
**
30 25 20 15
0
10
**
** { PBS z CpG-ODN CpG-ODN + anti–IL-6 CpG-ODN + control IgG
0.40 0.35
2.2
** (OD at 490nm)
**
SNA
RCA-I
1.0
10
0.30
1.4 1.2
10
35
0.45
200 1.6
0
(OD at 490nm)
600
0
rIL-6 (ng/ml)
rIL-6 (ng/ml)
IgG-IgA IC
**
0
(OD at 490nm)
10
IgA (unit)
800
100
**
40
rIL-6 (ng/ml)
b
200
rIL-6 (ng/ml) APRIL (ng/ml)
IgG-IgA IC
(OD at 490nm)
0.5
300
0.8 0.6
10
**
400
1.0
rIL-6 (ng/ml) 0.6
10
CpG-ODN (μg/ml)
SNA
RCA-
(OD at 490nm)
0.8
0
1000
1.2
1.0
0.6
1500
CpG-ODN
**
1.2
2000
0
**
500
**
IgA (unit)
100
2500 (pg/ml)
IL-6 produced by splenocytes
*
150 (pg/ml)
Serum IL-6
a
(OD at 490nm)
443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498
**
**
2.0 1.8 1.6 1.4
Figure 3 | Effect of CpG-oligodeoxynucleotide (ODN) and interleukin (IL)-6 on cultured splenocytes of ddY mice. (a) Serum levels of IL6 in mice injected with CpG-ODN were significantly higher compared with control mice. CpG-ODN stimulation increased production of IL-6 of splenocytes of ddY mice in culture. Incubation of splenocytes of ddY mice with recombinant IL-6 increased production of total IgA and aberrantly glycosylated IgA, resulting in the formation of IgG-IgA immune complex (IC). Recombinant IL-6 increased overproduction of a proliferation inducing ligand (APRIL). (b) Splenocytes in culture were stimulated with CpG-ODN in the presence or absence of IL-6-neutralizing antibody. Anti–IL-6 antibody reduced production of total IgA and aberrantly glycosylated IgA and, consequently, reduced formation of IgG-IgA IC induced by CpG-ODN. Bars ¼ mean SEM. *P < 0.05, **P < 0.01. OD, optical density; PBS, phosphate-buffered saline solution; RCA-I, Ricinus communis agglutinin-I; SNA, Sambucus nigra agglutinin.
CpG-ODN in ddY mice aggravated renal injuries accompanied by glomerular IgA and IgG deposits, likely because of increased serum levels of aberrantly glycosylated IgA and
IgG-IgA IC. Moreover, we showed that TLR9 activation was involved in synthesis of Gd-IgA1 in human IgA1-secreting cell lines.
Kidney International (2019) -, -–-
5 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554
basic research
1.0
5 10
0.0
GAPDH
Gd-IgA1 (unit)
**
300 250 200
0
10
CpG-ODN (μg/ml)
5000 0
10
**
4 2 0
9000 8000 7000 6000
non CpG-ODN
d 15000
45
**
**
**
10000
40 35 30 0
10
CpG-ODN (μg/ml)
**
10 5
IL-6 + siRNA APRIL IL-6 + siRNA control
0 100 rAPRIL (ng/ml)
CpG-ODN
**
50
25
*
10000
6
**
15
**
0 { PBS z IL-6
c
8
CpG non-CpG
350
10000
CpG-ODN (μg/ml)
Relative intensity of APRIL
APRIL
0
**
15000
IgA (unit)
0
CpG-ODN (μg/ml)
IgA (unit)
0
0.5
**
Gd-IgA1 (unit)
10
20000
20
**
Gd-IgA1 (unit)
1.5
IgA (unit)
15
b
**
5000 0
Gd-IgA1 (unit)
**
APRIL expression
IL-6 (pg/ml)
a
IgA (unit)
555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
18 17 16 15 14 13 12
40
**
0 100 rAPRIL (ng/ml)
**
**
**
30 20 10 0
{ PBS z CpG-ODN CpG-ODN + control IgG CpG-ODN + control IgG + siRNA control CpG-ODN + anti IL-6 CpG-ODN + anti IL-6 + siRNA APRIL
Figure 4 | Effect of CpG- oligodeoxynucleotide (ODN) or a proliferation inducing ligand (APRIL) supplementation on human IgA1secreting cell lines on IgA1, galactose-deficient IgA1 (Gd-IgA1), and interleukin (IL)-6 production. (a) CpG-ODN supplementation enhanced production of IL-6. CpG-ODN enhanced gene expression of APRIL. Western blot analysis demonstrated that CpG-ODN increased protein levels of APRIL. Results were evaluated densitometrically. Stimulation with CpG-ODN induced production of IgA and Gd-IgA1. (b) APRIL small, interfering RNA (siRNA) knockdown reduced IL-6–induced overproduction of IgA and Gd-IgA1. (c) IgA1-producing cells stimulated with recombinant APRIL produced more IgA and Gd-IgA1. (d) IgA1-secreting cells were incubated with anti–IL-6 antibody after CpG-ODN stimulation. The enhanced production of IgA and Gd-IgA1 induced by CpG-ODN was reduced by anti–IL-6 antibody and by siRNA knockdown of APRIL. Bars ¼ mean SEM. *P < 0.05, **P < 0.01. GADPH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline solution.
We assessed the mechanism by which TLR9 activation mediated enhanced production of aberrantly glycosylated IgA. BAFF and APRIL are known for their roles in B-cell survival and differentiation. McCarthy et al.33 demonstrated that BAFF-overexpressing transgenic mice develop mesangial IgA deposits with renal injury and urinary abnormalities.33 Recently we demonstrated that gene expression of APRIL is elevated in tonsillar germinal centers of patients with IgAN. Furthermore, overexpression of APRIL in tonsillar germinal centers correlated with serum levels of Gd-IgA1 and disease severity in patients with IgAN.34 These findings suggest that both BAFF and APRIL may be involved in the pathogenesis of IgAN. However, the association between BAFF/APRIL and TLR9 activation is unclear. In the present study, TLR9 activation increased gene expression and serum levels of APRIL. Serum levels of aberrantly glycosylated IgA correlated with expression levels of BAFF and APRIL in splenocytes. However, serum levels of IgG-IgA IC correlated with expression levels of
APRIL but not BAFF. Furthermore, serum levels of APRIL were associated with overproduction of aberrantly glycosylated IgA and IgG-IgA IC in the TLR9-activated mice. In IgA1-secreting cells, TLR9 activation also induced overproduction of Gd-IgA1 via APRIL. These results suggested that APRIL plays an important role in TLR9-induced overproduction of nephritogenic IgA and formation of IgG-IgA IC. The response by cell type to determine the role of the B and T cells and DCs should be clarified. In the present study, we assessed the role of B cells and plasmacytoid DCs. TLR9 is expressed by DCs, B cells, and macrophages but not by T cells.35–37 The contribution of BAFF/APRIL to T cell– independent antibody response is known.38,39 Here we tested whether TLR9 activation can enhance synthesis of aberrantly glycosylated IgA and formation of IgG-IgA IC via APRIL in a T cell–independent manner. We also used cloned human IgA1secreting cell lines and showed that TLR9 activation augmented production of Gd-IgA1 via APRIL and IL-6, Kidney International (2019) -, -–-
6 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666
667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722
Q6
suggesting that the process is T cell–independent. Furthermore, we evaluated the roles of B cells and DCs. We showed that CpGODN specific for B cells and DCs increased production of aberrantly glycosylated IgA in whole splenocytes. Furthermore, we investigated whether CpG-ODN stimulation in vitro can enhance IgA production. CpG-ODN stimulation of isolated B cells induced overproduction of IgA. In addition, CpG-ODN significantly increased IgA production when B cells were cocultured with DCs (Supplementary Figure S1). These results suggest that CpG-ODN activation resulting in greater IgA production and aberrant glycosylation is mediated by TLR9 in a T cell–independent manner. IL-6 is known to accentuate proliferation of immunoglobulin-producing cells and the terminal differentiation of plasma cells.40–42 Furthermore, IL-6 also may be a primary-candidate cytokine for T follicular helper cell differentiation.43,44 T follicular helper cells are essential for B-cell affinity maturation, class switch recombination, and memory B-cell and plasma cell generation within the germinal center.43,44 In a lupus mouse model, IL-6 deficiency prevented T follicular helper cell differentiation and germinal-center B-cell expansion, resulting in reduced autoantibody production.45 The present study clarified that TLR9 activation by CpGODN enhanced IL-6 production in splenocytes of murine IgAN. IL-6 induced overproduction of aberrantly glycosylated IgA and IgG-IgA IC in a murine model of IgAN. In human IgA1-secreting cells, we confirmed that IL-6 enhanced production of Gd-IgA1.24 Our findings suggest that IL-6 may be one of the major molecules inducing overproduction of nephritogenic IgA mediated by TLR9 activation. APRIL plays an important role in IgA-class switching and plasmacytoid differentiation.46,47 IL-6 promotes the terminal differentiation of B cells to IgA-secreting plasma cells.41,42 The present study demonstrated that IL-6 stimulation induced production of APRIL. Then we hypothesized that there was an association between APRIL and IL-6 mediated by TLR9 activation that induced production of aberrantly glycosylated IgA. We found that IL-6–neutralizing antibody did not completely block CpG-ODN–induced overproduction of Gd-IgA1 and that siRNA knockdown of APRIL reduced overproduction of GdIgA1 induced by IL-6. These data suggested that APRIL and IL-6 synergistically promoted the production of Gd-IgA1 mediated by TLR9 activation. Furthermore, both IL-6–neutralizing antibody and siRNA knockdown of APRIL reduced production of IgA and Gd-IgA1 more than did IL-6–neutralizing antibody alone. Thus the TLR9 activation pathway involves IL-6 and APRIL synergistic effect on antibody production and glycosylation (Figure 5). Recent studies also have indicated that IL-6, in combination with APRIL, induced generation and survival of PCs.48,49 However, future studies are required to clarify intercellular signaling pathways between APRIL and IL-6 in the production of nephritogenic IgA. In conclusion, TLR9 activation exacerbated renal injury in a murine model of IgAN by enhancing production of aberrantly glycosylated IgA and formation of IgG-IgA IC. In this process, the overproduction of APRIL and IL-6 induced by
print & web 4C=FPO
basic research
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
Figure 5 | Synergistic role between Toll-like receptor 9 (TLR9), a proliferation inducing ligand (APRIL), and interleukin (IL)-6 in IgA-producing cells in IgA nephropathy (IgAN). TLR9 activation induced production of APRIL and IL-6, resulting in overproduction of aberrantly glycosylated IgA. APRIL and IL-6 function synergistically to promote the generation of aberrantly glycosylated IgA. In addition to APRIL inducing production of IL-6, as previously reported, IL-6 can also enhance synthesis of APRIL. Furthermore, APRIL and IL-6 independently promote production of aberrantly glycosylated IgA. NF-kB, nuclear factor kB.
TLR9 activation enhanced production nephritogenic IgA. In addition, the present study clarified that APRIL and IL-6 function synergistically, as well as independently, to produce aberrantly glycosylated IgA. These findings may inform future development of new therapeutic approaches for IgAN. Q7 METHODS Animals and experimental protocols The IgAN-prone ddY mouse is a known model of spontaneous IgAN with variable incidence and extent of glomerular injury mimicking human IgAN.10 ddY mice are divided into 3 groups based on manifestation of kidney damage: mice with early or late onset and quiescent mice. Early-onset disease in ddY mice presents with proteinuria and IgA deposits in glomerular after 20 weeks of age.13 Q8 Therefore, we used ddY mice within 18 weeks of age to evaluate whether TLR9 activation aggravated IgAN in this model. A total of 30 female ddY mice (SLC Japan, Shizuoka, Japan) were maintained at the animal facility of Juntendo University, Tokyo, Japan. Mice were fed regular chow (Oriental Yeast Co., Tokyo, Japan) and water ad libitum and were housed in a specific pathogen-free room. The experimental protocol was approved by the Ethics Review Committee for Animal Experimentation of Juntendo University Faculty of Medicine. At 6 weeks of age the mice were randomly divided into 2 groups. One group received CpG-ODN injected intraperitoneally 3 times per week for 12 weeks; the second group (control) was injected with non–CpG-ODN. CpG-ODN and non–CpG-ODN were chemically synthesized (Invitrogen; Thermo Fisher Scientific, Kanagawa, Japan). Sequences of the ODN are TCGTCGTT TTCGGCGCGCGCCG or TGCTGCTTTTGGGGGGCCCCCC (5’/3’) for CpG or non-CpG ODNs, respectively.
Determination of IgA, IgG, IgG-IgA IC, and aberrantly glycosylated IgA in murine serum Blood samples were collected from the buccal vein. Serum IgA, IgG, and IgG-IgA IC were measured by sandwich enzyme-linked immunosorbent assay (ELISA; Bethyl Laboratories, Montgomery, TX) using the modified method based on our previous report.50
Kidney International (2019) -, -–-
7 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778
basic research
779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
Lectin-binding assays were used to access the glycoform of IgA. Biotinylated RCA-I (Vector Laboratories, Burlingame, CA) and Sambucus nigra bark lectin (Vector Laboratories) that recognized galactose and sialic acid attached to galactose (predominantly in a2,6 linkage), respectively, were used in this assay.51 Diluted sera were added at 100 ng of IgA per well. Microtiter plates coated with 1 mg/ ml goat anti-mouse IgA (100 ml/well) for quantification of serum IgA were incubated with these samples, and biotinylated Sambucus nigra agglutinin or RCA-I was then added. Avidin–horseradish peroxidase conjugate (ExtrAvidin; Sigma-Aldrich, St. Louis, MO) was applied. Serum levels of aberrantly glycosylated bound IgA were expressed in units (1 unit as optical density 1.0 measured at 490 nm). Serum level of APRIL and BAFF were measured using a mouse APRIL ELISA kit (MyBioSource, San Diego, CA) and a mouse BAFF ELISA kit (R&D Systems, Minneapolis, MN), according to the manufacturer’s protocols. Assay for Gd-IgA1 produced by human IgA1-secreting cells A sandwich ELISA for Gd-IgA1 was constructed using Gd-IgA1– specific antibody (IBL, Japan).52 Gd-IgA1–specific antibody (7.5 mg/ ml) diluted in phosphate-buffered saline solution was coated onto an ELISA plate for 18 hours at room temperature. Samples were applied and incubated for 2 hours at room temperature. Plates were washed and incubated for 2 hours at room temperature with a 1:1000diluted horseradish peroxidase–conjugated mouse anti-human IgA1 a1-chain–specific monoclonal antibody (Southern Biotech, Birmingham, AL). After washing, plates were developed with SIGMAFAST o-phenylenediamine solution (Sigma-Aldrich) and the reaction was stopped by the addition of 1 M sulfuric acid (Wako, Osaka, Japan). The levels of Gd-IgA1 were extrapolated by referring to a standard curve (4-parameter logistic curve fitting) of optical density at 490 nm and expressed in units. Enzymatically generated Gd-IgA1 from human plasma IgA152 was serially diluted (1.37–1000 ng/ml) to generate a standard curve. In this study, 1 unit was defined as 1 ng/mL of the standard Gd-IgA1.52 Evaluation of renal injury in ddY mice Kidneys were removed after perfusion with normal saline solution. Renal tissue specimens for microscopic examination were fixed in 20% formaldehyde, embedded in paraffin, cut into 3-mm-thick sections, and then stained with periodic acid–Schiff. Specimens were quantitatively analyzed to determine the percentage of glomeruli with segmental and global sclerosis and/or mesangial cell proliferation and/or increase in mesangial matrix. Each section was scored semiquantitatively for percentages of glomeruli with aforementioned lesions (0, 0%; 1, 1% to 24%; 2, 25% to 49%; and 3, >50% of 20 glomeruli).13,53,54 The total maximal score for each section was 9. Renal specimens for immunofluorescence were immersed in optimal cutting temperature compound (Sakura Finetek Japan Co., Tokyo, Japan) and stored at –80 C. The specimens were cut into 3-mmthick sections, fixed with acetone at –20 C for 5 minutes, washed with phosphate-buffered saline solution, blocked with a blocking agent (DS Pharma Biomedical Co., Osaka, Japan) at room temperature for 30 minutes, and then incubated at room temperature for 2 hours with the following primary antibodies: goat anti-murine IgA, Alexa conjugated goat anti-murine IgG, and rat anti-C3 (Bethyl Laboratories). After 3 more washes with phosphate-buffered saline solution, the slides were mounted with mounting medium (Dako, Tokyo, Japan). Samples were analyzed and imaged using confocal laser microscopy (Olympus Corporation, Tokyo, Japan).
Real-time quantitative polymerase chain reaction RNA from spleen cells was extracted using Torizol solution (Invitrogen, Tokyo, Japan) and purified with RNeasy Mini Kit (74106; Qiagen, Valencia, CA). Real-time quantitative polymerase chain reaction was performed using the Applied Biosystems 7500 RealTime polymerase chain reaction system using SYBR Green PCR Master Mix (Applied Biosystems, Tokyo, Japan) and specific primers: mouse TLR9 forward primer TCTCCCAACATGGTTCTCCGTCG, reverse primer TGCAGTCCAGGCCATGA; mouse MyD88 forward primer GCACCTGTGTCTGGTCCATT, reverse primer CTGTTGGA CACCTGGAGACA; and the housekeeping gene glyceraldehyde3-phosphate dehydrogenase forward primer CATTGTGGAAG GGCTCATGA, reverse primer TCTTCTGGGTGGCAGTGATG. The amplification conditions were as follows: preheating at 95 C for 20 seconds and then 40 cycles of denaturation at 95 C for 3 seconds, and annealing and extension at 60 C for 30 seconds. Homo sapiens– specific TaqMan gene expression assays (Life Technologies, Carlsbad, CA) were purchased for the primer of APRIL, Hs00601664_g1 and Mm03809849-s1, and BAFF, Mm01168134-m1. The TaqMan polymerase chain reaction cycling conditions were as follows: preheating at 95 C for 20 seconds and then 40 cycles of denaturation at 95 C for 3 seconds, and annealing and extension at 60 C for 30 seconds. In vitro studies with splenocytes of ddY mice Splenocytes were cultured in Roswell Park Memorial Institute–1640 medium supplemented with 20% fetal calf serum, 100 mg/ml streptomycin, and 100 U/ml penicillin. Red blood cells were lysed in Red Blood Cell Lysing Buffer (R7757; Sigma-Aldrich) at room temperature for 1 minute, followed by washing in Roswell Park Memorial Institute–1640 medium.50 Cell cultures were kept in a humidified incubator at 37 C with 5% CO2. Class C CpG-ODN (TCGTCGTTTTCGGCGCGCGCCG) was used as the TLR9 ligand. Recombinant IL-6, anti–IL-6 antibody, and rat IgG1 isotype control were obtained from R&D Systems. Cells were cultured with either medium or recommended concentrations of CpG-ODN, 10 ng/ml recombinant IL-6, and 100 ng/ml anti-IL6 antibody. IgA, aberrantly glycosylated IgA, IgG-IgA IC, and APRIL produced by splenocytes were measured by ELISA after 72-hour incubation in vitro. In vitro studies with human IgA1-secreting cell lines B cells from the blood of a healthy person were immortalized with Epstein-Barr virus, subcloned to yield IgA1-secreting cell lines, and cultured as described.9 Furthermore, we confirmed expression of receptors for APRIL/BAFF and IL-6. Cells were cultured in Roswell Park Memorial Institute–1640 medium supplemented with 20% fetal calf serum, streptomycin, and penicillin in a humidified incubator at 37 C with 5% CO2. Class B CpG-ODN (TCGTCGTTTTGTCGTTTTGTCGTT) was used as the TLR9 ligand. Recombinant IL-6, recombinant APRIL, anti–IL-6 antibody, and goat IgG control antibody were obtained from R&D Systems. Cells were cultured with either medium or recommended concentrations of CpG-ODN, 50 ng/ml recombinant IL-6, 40 ng/ml recombinant APRIL, and 100 ng/ml anti–IL-6 antibody for 72 hours. Western blotting Supernatants from IgA1-secreting cells were separated by sodium dodecylsulfate– polyacrylamide gel electrophoresis under reducing conditions using 5% to 15% gradient slab gels. The gels were transferred to polyvinylidene diflouride membranes and incubated with antibodies specific for APRIL (Abcam Inc., Cambridge, MA) and glyceraldehyde-3-phosphate dehydrogenase (Abcam Inc). Blots Kidney International (2019) -, -–-
8 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890
basic research
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946
were visualized by chemiluminescence using enhanced chemiluminescence (GE Healthcare, Tokyo, Japan) and luminescence detector (Konica Minolta Healthcare, Tokyo, Japan). Results were evaluated densitometrically. APRIL siRNA knockdown Human IgA1-secreting cells were cultured in 24-well culture plates and transfected with APRIL-specific siRNA (GS8741, Qiagen) or siRNA nontargeting control (GS10673, Qiagen) using the transfection protocol according to the manufacturer’s instructions. After incubation for 24 hours, the cells were incubated with 50 ng/ml recombinant IL-6 (R&D Systems) for 72 hours. After incubation, cells and supernatants were harvested for measurement of IgA and Gd-IgA1. Statistical analysis The correlation between different parameters was analyzed using analysis of variance. Data were expressed as the mean SD or median values. P values < 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism version 6.0 for Windows (GraphPad Software, San Diego, CA). DISCLOSURE All the authors declared no competing interests.
ACKNOWLEDGMENTS
Q11
This study was supported in part by JSPS KAKENHI grant No. 18K08252 and the Practical Research Project for Renal Diseases from the Japan Agency for Medical Research and development, AMED. JN and BAJ were supported in part by National Institutes of Health grants DK078244 and DK082753. We thank Ms. Terumi Shibata and Aki Omori for their excellent technical assistance. We also thank Ms. Takako Ikegami and Ms. Tomomi Ikeda (Division of Molecular and Biochemical Research, Juntendo University Graduate School of Medicine) and Ms. Tamami Sakanishi (Division of Cell Biology, Juntendo University Graduate School of Medicine) for their excellent technical assistance.
Q9
SUPPLEMENTARY MATERIAL Supplementary File (PDF) Figure S1. CpG-oligodeoxynucleotide (ODN)–activated B cells and dendritic cells (DCs) further enhance IgA production. B cells and DCs were isolated from the spleens of ddY mice. CpG-ODN stimulation increased IgA production in the isolated B cells. This increase was further enhanced by co-culturing B cells with DCs. *P < 0.05. Supplementary Methods. REFERENCES 1. Myette JR, Kano T, Suzuki H, et al. A Proliferation Inducing Ligand (APRIL) targeted antibody is a safe and effective treatment of murine IgA nephropathy. Kidney Int. 2019;96:104–116. 2. Levy M, Berger J. Worldwide perspective of IgA nephropathy. Am J Kidney Dis. 1988;12:340–347. 3. D’Amico G. The commonest glomerulonephritis in the world: IgA nephropathy. Q J Med. 1987;64:709–727. 4. Feehally J, Beattie TJ, Brenchley PE, et al. Sequential study of the IgA system in relapsing IgA nephropathy. Kidney Int. 1986;30:924–931. 5. Wyatt RJ, Julian BA. IgA nephropathy. N Engl J Med. 2013;368:2402–2414. 6. Suzuki H, Yasutake J, Makita Y, et al. IgA nephropathy and IgA vasculitis with nephritis have a shared feature involving galactose-deficient IgA1oriented pathogenesis. Kidney Int. 2018;93:700–705. 7. Glassock RJ. Analyzing antibody activity in IgA nephropathy. J Clin Invest. 2009;119:1450–1452.
8. Moldoveanu Z, Wyatt RJ, Lee JY, et al. Patients with IgA nephropathy have increased serum galactose-deficient IgA1 levels. Kidney Int. 2007;71: 1148–1154. 9. Suzuki H, Moldoveanu Z, Hall S, et al. IgA1-secreting cell lines from patients with IgA nephropathy produce aberrantly glycosylated IgA1. J Clin Invest. 2008;118:629–639. 10. Imai H, Nakamoto Y, Asakura K, et al. Spontaneous glomerular IgA deposition in ddY mice: an animal model of IgA nephritis. Kidney Int. 1985;27:756–761. 11. Okazaki K, Suzuki Y, Otsuji M, et al. Development of a model of earlyonset IgA nephropathy. J Am Soc Nephrol. 2012;23:1364–1374. 12. Nishie T, Miyaishi O, Azuma H, et al. Development of immunoglobulin A nephropathy- like disease in beta-1,4-galactosyltransferase-I-deficient mice. Am J Pathol. 2007;170:447–456. 13. Suzuki H, Suzuki Y, Yamanaka T, et al. Genome-wide scan in a novel IgA nephropathy model identifies a susceptibility locus on murine chromosome 10, in a region syntenic to human IGAN1 on chromosome 6q22-23. J Am Soc Nephrol. 2005;16:1289–1299. 14. Takei T, Iida A, Nitta K, et al. Association between single-nucleotide polymorphisms in selectin genes and immunoglobulin A nephropathy. Am J Hum Genet. 2002;70:781–786. 15. Gharavi AG, Yan Y, Scolari F, et al. IgA nephropathy, the most common cause of glomerulonephritis, is linked to 6q22-23. Nat Genet. 2000;26:354–357. 16. Suzuki H, Suzuki Y, Narita I, et al. Toll-like receptor 9 affects severity of IgA nephropathy. J Am Soc Nephrol. 2008;19:2384–2395. 17. Nakata J, Suzuki Y, Suzuki H, et al. Changes in nephritogenic serum galactose-deficient IgA1 in IgA nephropathy following tonsillectomy and steroid therapy. PLoS One. 2014;9:e89707. 18. Sato D, Suzuki Y, Kano T, et al. Tonsillar TLR9 expression and efficacy of tonsillectomy with steroid pulse therapy in IgA nephropathy patients. Nephrol Dial Transplant. 2012;27:1090–1097. 19. Coppo R, Camilla R, Amore A, et al. Toll-like receptor 4 expression is increased in circulating mononuclear cells of patients with immunoglobulin A nephropathy. Clin Exp Immunol. 2010;159:73–81. 20. Maiguma M, Suzuki Y, Suzuki H, et al. Dietary zinc is a key environmental modifier in the progression of IgA nephropathy. PLoS One. 2014;9: e90558. 21. Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol Med. 2007;13:460–469. 22. Kuwata H, Matsumoto M, Atarashi K, et al. IkappaBNS inhibits induction of a subset of Toll-like receptor-dependent genes and limits inflammation. Immunity. 2006;24:41–51. 23. Rostoker G, Rymer JC, Bagnard G, et al. Imbalances in serum proinflammatory cytokines and their soluble receptors: a putative role in the progression of idiopathic IgA nephropathy (IgAN) and HenochSchönlein purpura nephritis, and a potential target of immunoglobulin therapy? Clin Exp Immunol. 1998;114:468–476. 24. Suzuki H, Raska M, Yamada K, et al. Cytokines alter IgA1 O-glycosylation by dysregulating C1GalT1 and ST6GalNAc-II enzymes. J Biol Chem. 2014;289:5330–5339. 25. Yamada K, Huang ZQ, Raska M, et al. Inhibition of STAT3 signaling reduces IgA1 autoantigen production in IgA nephropathy. Kidney Int Rep. 2017;2:1194–1207. 26. Schneider P, MacKay F, Steiner V, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J Exp Med. 1999;189: 1747–1756. 27. Kiryluk K, Li Y, Scolari F, et al. Discovery of new risk loci for IgA nephropathy implicates genes involved in immunity against intestinal pathogens. Nat Genet. 2014;46:1187–1196. 28. Han SS, Yang SH, Choi M, et al. The role of TNF superfamily member 13 in the progression of IgA nephropathy. J Am Soc Nephrol. 2016;27:3430– 3439. 29. Hiki Y, Odani H, Takahashi M, et al. Mass spectrometry proves under-Oglycosylation of glomerular IgA1 in IgA nephropathy. Kidney Int. 2001;59: 1077–1085. 30. Allen AC, Bailey EM, Brenchley PE, et al. Mesangial IgA1 in IgA nephropathy exhibits aberrant O-glycosylation: observations in three patients. Kidney Int. 2001;60:969–973. 31. Hiki Y. O-linked oligosaccharides of the IgA1 hinge region: roles of its aberrant structure in the occurrence and/or progression of IgA nephropathy. Clin Exp Nephrol. 2009;13:415–423. 32. Mestecky J, Tomana M, Moldoveanu Z, et al. Role of aberrant glycosylation of IgA1 molecules in the pathogenesis of IgA nephropathy. Kidney Blood Press Res. 2008;31:29–37.
Kidney International (2019) -, -–-
9 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002
basic research
1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
33. McCarthy DD, Kujawa J, Wilson C, et al. Mice overexpressing BAFF develop a commensal flora-dependent, IgA-associated nephropathy. J Clin Invest. 2011;121:3991–4002. 34. Muto M, Manfroi B, Suzuki H, et al. Toll-like receptor 9 stimulation induces aberrant expression of a proliferation-inducing ligand by tonsillar germinal center B cells in IgA nephropathy. J Am Soc Nephrol. 2017;28:1227–1238. 35. Latz E, Schoenemeyer A, Visintin A, et al. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol. 2004;5:190–198. 36. Hornung V, Rothenfusser S, Britsch S, et al. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol. 2002;168:4531–4537. 37. Kadowaki N, Ho S, Antonenko S, et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med. 2001;194:863–869. 38. He B, Xu W, Santini PA, et al. Intestinal bacteria trigger T cell-independent immunoglobulin A(2) class switching by inducing epithelial-cell secretion of the cytokine APRIL. Immunity. 2007;26:812–826. 39. Mackay F, Schneider P. Cracking the BAFF code. Nat Rev Immunol. 2009;9: 491–502. 40. Kunimoto DY, Nordan RP, Strober W. IL-6 is a potent cofactor of IL-1 in IgM synthesis and of IL-5 in IgA synthesis. J Immunol. 1989;143:2230–2235. 41. Beagley KW, Eldridge JH, Lee F, et al. Interleukins and IgA synthesis. Human and murine interleukin 6 induce high rate IgA secretion in IgA-committed B cells. J Exp Med. 1989;169:2133–2148. 42. Ramsay AJ, Husband AJ, Ramshaw IA, et al. The role of interleukin-6 in mucosal IgA antibody responses in vivo. Science. 1994;264:561– 563. 43. Nurieva RI, Chung Y, Martinez GJ, et al. Bcl6 mediates the development of T follicular helper cells. Science. 2009;325:1001–1005.
44. Poholek AC, Hansen K, Hernandez SG, et al. In vivo regulation of Bcl6 and T follicular helper cell development. J Immunol. 2010;185: 313–326. 45. Jain S, Park G, Sproule TJ, et al. Interleukin 6 accelerates mortality by promoting the progression of the systemic lupus erythematosus-like disease of BXSB.Yaa mice. PLoS One. 2016;11:e0153059. 46. Litinskiy MB, Nardelli B, Hilbert DM, et al. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat Immunol. 2002;3:822–829. 47. Castigli E, Wilson SA, Scott S, et al. TACI and BAFF-R mediate isotype switching in B cells. J Exp Med. 2005;201:35–39. 48. Jourdan M, Cren M, Robert N, et al. IL-6 supports the generation of human long-lived plasma cells in combination with either APRIL or stromal cell-soluble factors. Leukemia. 2014;28:1647–1656. 49. Chu VT, Fröhlich A, Steinhauser G, et al. Eosinophils are required for the maintenance of plasma cells in the bone marrow. Nat Immunol. 2011;12: 151–159. 50. Suzuki H, Suzuki Y, Aizawa M, et al. Th1 polarization in murine IgA nephropathy directed by bone marrow-derived cells. Kidney Int. 2007;72: 319–327. 51. Chintalacharuvu SR, Emancipator SN. The glycosylation of IgA produced by murine B cells is altered by Th2 cytokines. J Immunol. 1997;159:2327– 2333. 52. Yasutake J, Suzuki Y, Suzuki H, et al. Novel lectin-independent approach to detect galactose-deficient IgA1 in IgA nephropathy. Nephrol Dial Transplant. 2015;30:1315–1321. 53. Katafuchi R, Kiyoshi Y, Oh Y, et al. Glomerular score as a prognosticator in IgA nephropathy: its usefulness and limitation. Clin Nephrol. 1998;49:1–8. 54. Ballardie FW, Roberts IS. Controlled prospective trial of prednisolone and cytotoxics in progressive IgA nephropathy. J Am Soc Nephrol. 2002;13: 142–148.
Kidney International (2019) -, -–-
10 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068
www.kidney-international.org
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
Q2Q1
Q12
Q3
TLR9 activation induces aberrant IgA glycosylation via APRIL- and IL-6–mediated pathways in IgA nephropathy
OPEN
Yuko Makita1, Hitoshi Suzuki1, Toshiki Kano1, Akiko Takahata1, Bruce A. Julian2,3, Jan Novak3 and Yusuke Suzuki1 1
Department of Nephrology, Juntendo University Faculty of Medicine, Tokyo, Japan; 2Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, USA; and 3Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama, USA
Galactose-deficient IgA1 (Gd-IgA1) plays a crucial role in the development of IgA nephropathy (IgAN). However, the pathogenic mechanisms driving Gd-IgA1 production have not been fully elucidated. Innate-immune activation via Toll-like receptor 9 (TLR9) is known to be involved in GdIgA1 production. A proliferation inducing ligand (APRIL) and IL-6 are also known to enhance Gd-IgA1 synthesis in IgAN. With this as background, we investigated how TLR9 activation in IgA secreting cells results in overproduction of nephritogenic IgA in the IgAN-prone ddY mouse and in human IgA1-secreting cells. Injection of the TLR9 ligand CpG-oligonucleotides increased production of aberrantly glycosylated IgA and IgG-IgA immune complexes in ddY mice that, in turn, exacerbated kidney injury. CpGoligonucleotide-stimulated mice had elevated serum levels of APRIL that correlated with those of aberrantly glycosylated IgA and IgG-IgA immune complexes. In vitro, TLR9 activation enhanced production of the nephritogenic IgA as well as APRIL and IL-6 in splenocytes of ddY mice and in human IgA1-secreting cells. However, siRNA knockdown of APRIL completely suppressed overproduction of Gd-IgA1 induced by IL-6. Neutralization of IL-6 decreased CpG-oligonucleotide-induced overproduction of Gd-IgA1. Furthermore, APRIL and IL-6 pathways each independently mediated TLR9-induced overproduction of Gd-IgA1. Thus, TLR9 activation enhanced synthesis of aberrantly glycosylated IgA that, in a mouse model of IgAN, further enhanced kidney injury. Hence, APRIL and IL-6 synergistically, as well as independently, enhance synthesis of Gd-IgA1. Kidney International (2019) j.kint.2019.08.022
-, -–-;
https://doi.org/10.1016/
KEYWORDS: APRIL; galactose-deficient IgA1; IgA nephropathy; IL-6; immune complex Copyright ª 2019, International Society of Nephrology. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Correspondence: Yusuke Suzuki, Department of Nephrology, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan. E-mail: [email protected] Received 11 January 2019; revised 30 July 2019; accepted 16 August 2019; published online 5 September 2019
Translational Statement Disease-specific therapy targeting galactose-deficient IgA1 can constitute a future treatment of IgA nephropathy. Results from this study, which demonstrated the involvement of a proliferation inducing ligand (APRIL) and interleukin-6 (IL-6) in overproduction of aberrantly glycosylated IgA, support the rationale for targeting APRIL and IL-6 in IgA nephropathy (IgAN). In fact, a recent study demonstrated positive effects of anti-APRIL monoclonal antibody in murine IgAN,1 and a clinical study with neutralizing APRIL antibody is currently ongoing in patients with IgAN.
gA nephropathy (IgAN), the most common primary glomerulonephritis,2 causes end-stage renal disease in 20% to 40% of patients within 20 years after onset of this disease.3 Although the pathogenesis of IgAN remains to be fully elucidated, episodic macroscopic hematuria concurrent with an infection of the upper respiratory tract suggests that the mucosal immune system plays an important role in the clinical manifestations of IgAN.4 Aberrant glycosylation of IgA is central in the pathogenesis of IgAN. Glomerular IgA in patients with IgAN is restricted to the IgA1 subclass and is enriched for molecules that have some hinge-region O-glycans deficient in galactose (galactose-deficient IgA1 [Gd-IgA1]).5,6 Furthermore, serum levels of Gd-IgA1 and IgA1-containing immune complexes (ICs) with Gd-IgA1–specific autoantibodies are elevated in patients with IgAN.7–9 However, the mechanisms for production of Gd-IgA1 are still not fully understood. We used the IgAN-prone ddY mouse model in this study. ddY mice develop glomerular injuries mimicking those of humans with IgAN.10 Although mice do not have IgA molecules with O-glycans typical for human IgA1, human IgAN and this IgAN-prone ddY mouse model share some diseasespecific features, such as serum elevation of aberrantly glycosylated IgA and IgG-IgA IC.6,11 In fact, aberrant IgA glycosylation due to deficiency of b1,4-galactosylation of Nglycans induces murine IgAN because of elevation of serum levels of high-molecular-weight IgA and IgA-containing IC
I
Kidney International (2019) -, -–-
1 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106
basic research
107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
with their subsequent renal deposition and glomerular injury.12 ddY mice show proteinuria and a mesangial proliferative glomerulonephritis with co-deposition of IgA and C3 in the glomeruli. A genome-wide association study identified candidate loci linked with progression of IgAN in ddY mouse.13 The loci include genes functionally similar to those associated with human IgAN.14,15 These findings suggest that IgAN in ddY mice and in humans may be affected at least in part by the same susceptibility genes. Although the molecular features of murine IgA and human IgA1 differ, aberrantly glycosylated IgA tends to form polymeric IgA and IgG-IgA ICs that subsequently drive progression of renal injury in the ddY murine model of IgAN, as well as in human IgAN. Thus the ddY mice model has some common features with human IgAN and can be a useful tool for analysis of various pathogenetic features of IgAN. Toll-like receptors (TLRs) are key molecules in the innate immune system and have been implicated in the pathogenesis of IgAN.16–20 Exogenous antigens derived from pathogens activate the TLR9-MyD88 signaling pathway.21 This process leads to significantly increased synthesis of inflammatory cytokines, such as type 1 interferon and interleukin-6 (IL-6).22 Recently we demonstrated that TLR9 activation aggravated kidney injury in IgAN-prone ddY mice, with elevation of serum levels of IgA and IgG-IgA ICs.16 Moreover, specific TLR9 polymorphisms associate with disease progression in patients with IgAN.16 Serum levels of tumor necrosis factor–a and IL-6 are elevated in patients with IgAN.23 Moreover, IL-6 and IL-4 increase production of IgA1 and accentuate the degree of galactose deficiency, increasing Gd-IgA1 synthesis by IgA1-secreting cell lines from patients with IgAN.24 These findings suggest that IL-6 may be a key mediator of this process.24,25 The gene of tumor necrosis factor ligand superfamily member 13 (TNFSF13) encodes a proliferation inducing ligand (APRIL) that is a central cytokine for the maturation and survival of B cells.26 APRIL shares some signaling receptors important for B-cell development with another TNF super family ligand, B-cell activating factor (BAFF). BAFF is also involved in affinity maturation of B cells. A genomewide association study identified TNFSF13 as one of the candidate genes associated with IgAN.27 Indeed, in patients with IgAN, serum levels of APRIL are elevated28 and the levels are associated with renal prognosis.28 To gain a better understanding of the underlying mechanisms involved in the overproduction of aberrantly glycosylated IgA via TLR9 activation by the ligand CpG oligodeoxynucleotides (ODNs), we used IgAN-prone ddY mice and human IgA1-secreting cells. RESULTS Activation of TLR9 aggravated renal injury in ddY mice via increased production of nephritogenic IgA
TLR9 can be activated by the corresponding ligands, such as CpG-ODN. To test the effect of TLR9 activation in a murine model of IgAN, we used injection of the ligand in IgAN-prone
ddY mice. Mice injected with CpG-ODN developed mesangial proliferation and extracellular matrix expansion (Figure 1a). Renal histologic scores based on mesangial proliferation and mesangial matrix expansion in mice injected with CpG-ODN were significantly higher than those in control mice (P < 0.01; Figure 1a). Urinary albumin levels in the mice injected with CpG-ODN were significantly elevated compared with those of the control mice (P < 0.01; Figure 1a). Only the mice injected with CpG-ODN developed mesangial deposits of IgA, IgG, and complement C3 (Figure 1b). Mice injected with CpG-ODN showed significantly higher serum levels of IgA (P < 0.01) and IgG (P < 0.01) than did control mice (Figure 1c). Serum IgA from mice injected with CpGODN mice had lower reactivity with Ricinus communis agglutinin-I (RCA-I) and Sambucus nigra agglutinin lectins than Q4 that from control mice (Figure 1c), indicating a lower content of galactose and sialic acid on N-glycans of murine IgA. Furthermore, the serum level of IgG-IgA IC in mice injected with CpGODN was significantly higher than that in control mice (P < 0.05; Figure 1c). These findings indicated that TLR9 activation by CpG-ODN resulted in the overproduction of aberrantly glycosylated IgA and IgG-IgA IC, leading to immune-complex deposition and renal injury. B cells and dendritic cells were involved in the CpG-ODN responses
We investigated which cell types are involved in the induction of overproduction of aberrantly glycosylated IgA in response to CpG-ODN. B cells and dendritic cells (DCs) were isolated from the spleens of ddY mice using anti-mouse CD19 and CD11c antibodies by fluorescence activated cell sorting, Q5 respectively. CpG-ODN stimulation of isolated B cells induced overproduction of IgA. In addition, CpG-ODN significantly increased IgA production when B cells were cocultured with DCs (Supplementary Figure S1). These results suggested that CpG-ODN directly activated B cells and that DCs further enhanced IgA production upon TLR9 activation. Overproduction of APRIL enhanced synthesis of aberrantly glycosylated IgA and IgG-IgA ICs
We assessed whether APRIL and/or BAFF was involved in the synthesis of nephritogenic IgA induced by TLR9 activation. Injection of CpG-ODN in ddY mice significantly elevated serum levels of APRIL and BAFF (Figure 2a). Expression levels of APRIL in splenocytes correlated with production of aberrantly glycosylated IgA and formation of IgG-IgA IC (Figure 2b). Expression levels of BAFF in splenocytes correlated with production of aberrantly glycosylated IgA but not with formation of IgG-IgA IC (Figure 2b). Furthermore, serum levels of APRIL but not BAFF significantly correlated with elevated serum levels of aberrantly glycosylated IgA and IgG-IgA IC in the CpG-ODN–injected mice (Figure 2c). These findings suggest that both APRIL and BAFF may be involved in production of aberrantly glycosylated IgA, although APRIL may be more involved in the production of IgG-IgA IC. Kidney International (2019) -, -–-
2 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218
basic research
b
non–CpG-ODN
non–CpG-ODN
CpG-ODN
a
6 4 2
800
500
IgG (mg/dl)
IgA (mg/dl)
600 400 200
non–CpG-ODN CpG-ODN
400 300 200 100
0
0
2.0
2.0
non–CpG-ODN CpG-ODN
SNA
1.5 1.0 0.5 0.0
non–CpG-ODN CpG-ODN
(OD at 490nm)
RCA-I
20 0
non–CpG-ODN CpG-ODN
(OD at 490nm)
40
0
non–CpG-ODN CpG-ODN
c
50 μm
60 (mg/dl)
8
Urinary albumin
Renal injury score
50 μm
1.5 1.0 0.5 0.0
non–CpG-ODN CpG-ODN
IgG-IgA IC
(OD at 490nm)
2.5
print & web 4C=FPO
219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274
CpG-ODN
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
2.0 1.5 1.0 0.5 0.0
non–CpG-ODN CpG-ODN
Figure 1 | CpG-oligodeoxynucleotide (ODN) stimulation induced production of nephritogenic IgA. Injection with CpG-ODN increased blood levels of aberrantly glycosylated IgA and IgG-IgA immune complex (IC) and exacerbated kidney injury in ddY mice. (a) ddY mice before development of IgA nephropathy (IgAN) were intraperitoneally injected with CpG-ODN thrice weekly for 12 weeks. In histologic analysis of glomerular lesions, mice injected with CpG-ODN showed mesangial cellular proliferation and extracellular matrix expansion. The right panel shows evaluation of renal injuries by semiquantitative scoring. Renal histologic scores, evaluated by percentages of glomeruli with aforementioned lesions, showed that renal injury in the mice injected with CpG-ODN were exacerbated. Urinary albumin levels in the mice injected with CpG-ODN were significantly elevated compared with those of control mice. Bars in the bottom panels ¼ mean SEM. (b) Immunohistochemical analysis of glomerular IgA, IgG, and C3 deposits. Only mice injected with CpG-ODN developed mesangial deposits of IgA, IgG, and C3. (c) Serum levels of IgA, IgG, and IgG-IgA ICs were significantly increased after CpG-ODN treatment for 12 weeks. Serum IgA in mice injected with CpG-ODN showed significantly lower reactivity with Ricinus communis agglutinin-I (RCA-I) and Sambucus nigra agglutinin (SNA) lectins than did the IgA in control mice. These results indicate that injection of CpG-ODN increased serum levels of aberrantly glycosylated IgA. Individual points are shown. *P < 0.05, **P < 0.01. OD, optical density. To optimize viewing of this image, please see the online version of this article at www.kidney-international.org.
Kidney International (2019) -, -–-
3 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
Q10Q13
275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330
basic research
25
15
BAFF (ng/ml)
20 15 10 5 0
10 5 0
non–CpG-ODN CpG-ODN
0.0 0.0 0.5 1.0 1.5 2.0 2.5
0.0 0.0 0.5 1.0 1.5 2.0 2.5
10
15
20
RCA-I
1.0 r = 0.344 P = 0.06
0.0 0.0 0.5 1.0 1.5 2.0 2.5
1.5 1.0 r = 0.646 P < 0.05
0.5 0.0 0
25
10
15
20
25
2.5
1.0 0.5 0.0
5
APRIL (ng/ml)
1.5
1.5
2.0
APRIL (ng/ml)
2.0
0.5
5
0
(OD at 490nm)
r = -0.388 P < 0.05
IgG-IgA IC
1.0
(OD at 490nm)
1.5
r = -0.644 P < 0.05
0.0
2.5
BAFF expression
0.5
APRIL expression
2.0
RCA-I
r = 0.388 P < 0.05
1.0
IgG-IgA IC
0.5
2.5 (OD at 490nm)
1.0
APRIL expression
0.5
RCA-I
1.5
1.5
r = -0.051 P = 0.84 8
BAFF expression
10
12
14
16
BAFF (pg/ml)
IgG-IgA IC
0.0 0.0 0.5 1.0 1.5 2.0 2.5
2.0
(OD at 490nm)
r = -0.388 P < 0.05
IgG-IgA IC
1.0
(OD at 490nm)
1.5
0.5
c
2.5
2.0 (OD at 490nm)
RCA-I
b
non–CpG-ODN CpG-ODN
(OD at 490nm)
APRIL (ng/ml)
a
(OD at 490nm)
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
2.0 1.5 1.0 r = 0.325 P = 0.23
0.5 0.0
0
10
12
14
16
BAFF (pg/ml)
Figure 2 | Correlation between overproduction of a proliferation inducing ligand (APRIL) and aberrantly glycosylated IgA in mice injected with CpG- oligodeoxynucleotide (ODN). (a) Injection of ddY mice with CpG-ODN increased serum levels of B-cell activating factor (BAFF) and APRIL. (b) Expression levels of BAFF in whole splenocytes correlated with reduced reactivity with Ricinus communis agglutinin-I (RCA-I) lectin but did not correlate with formation of IgG-IgA immune complex (IC). Meanwhile, expression levels of APRIL were associated with production of aberrantly glycosylated IgA and formation of IgG-IgA IC. (c) In mice injected with CpG-ODN, serum levels of APRIL were associated with reduced reactivity of IgA with RCA-I lectin and elevated levels of IgG-IgA IC. Serum levels of BAFF did not correlate with production of glycosylated IgA and formation of IgG-IgA IC. Bars ¼ mean SEM. *P < 0.05. OD, optical density.
IL-6 induced production of aberrantly glycosylated IgA
Serum levels of IL-6 in mice injected with CpG-ODN were significantly higher compared with control mice (P < 0.05; Figure 3a). Using splenocytes of IgAN-prone ddY mice, we examined whether TLR9-induced cellular activation and overproduction of aberrantly glycosylated IgA was mediated by IL-6. CpG-ODN stimulation enhanced production of IL-6 by splenocytes in vitro. The addition of IL-6 to the culture medium of splenocytes increased IgA production. Moreover, IL-6 enhanced synthesis of aberrantly glycosylated IgA and formation of IgG-IgA IC and increased APRIL production (Figure 3a). IL-6–neutralizing antibody reduced CpG-ODN– induced total IgA, aberrantly glycosylated IgA production, and IgG-IgA IC formation (Figure 3b). These findings indicate that TLR9 activation was mediated, at least in part, by IL6. Furthermore, another TLR9-mediated pathway(s) may be involved in the production of aberrantly glycosylated IgA. APRIL and IL-6 enhanced synthesis of Gd-IgA1 in human IgA1secreting cells
We further tested whether APRIL and IL-6 are common major mediators that enhance production of nephritogenic IgA in human IgA1-secreting cells. CpG-ODN supplementation enhanced increase of IL-6, expression of APRIL,
production of APRIL protein, and production of IgA and GdIgA1 (Figure 4a). Stimulation with IL-6 and with APRIL enhanced production of IgA and Gd-IgA1 (Figure 4b, c). The effects of CpG-ODN stimulation on production of IgA and Gd-IgA1 were partly reduced by IL-6-neutralizing antibody (Figure 4d). Moreover, APRIL small, interfering (si)RNA knockdown also reduced production of IgA and Gd-IgA1 induced by IL-6 stimulation (Figure 4b), indicating that APRIL and IL-6 synergistically promote the generation of GdIgA1. DISCUSSION
Mesangial IgA in human IgAN is exclusively of the IgA1 subclass that displays abnormal O-glycosylation.29,30 Human IgA1 has a hinge region with O-glycans that is absent from murine IgA.6,31,32 However, aberrant glycosylation of N-glycans is involved in the pathogenesis of a murine model of IgAN in ddY mice, with elevation of aberrantly glycosylated IgA and IgA-containing IC.11,12 Aberrant modifications of IgA carbohydrates in either O- or N-glycans are characteristic properties of nephritogenic IgA-containing IC. Several studies have shown TLR9 activation in progression of IgAN.17–19 In the present study, we have shown that activation of TLR9 by intraperitoneal injection of Kidney International (2019) -, -–-
4 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442
basic research
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
50 0 non CpG-ODN
500 0
0.4 0.3
0
**
400
0.8
**
30 25 20 15
0
10
**
** { PBS z CpG-ODN CpG-ODN + anti–IL-6 CpG-ODN + control IgG
0.40 0.35
2.2
** (OD at 490nm)
**
SNA
RCA-I
1.0
10
0.30
1.4 1.2
10
35
0.45
200 1.6
0
(OD at 490nm)
600
0
rIL-6 (ng/ml)
rIL-6 (ng/ml)
IgG-IgA IC
**
0
(OD at 490nm)
10
IgA (unit)
800
100
**
40
rIL-6 (ng/ml)
b
200
rIL-6 (ng/ml) APRIL (ng/ml)
IgG-IgA IC
(OD at 490nm)
0.5
300
0.8 0.6
10
**
400
1.0
rIL-6 (ng/ml) 0.6
10
CpG-ODN (μg/ml)
SNA
RCA-
(OD at 490nm)
0.8
0
1000
1.2
1.0
0.6
1500
CpG-ODN
**
1.2
2000
0
**
500
**
IgA (unit)
100
2500 (pg/ml)
IL-6 produced by splenocytes
*
150 (pg/ml)
Serum IL-6
a
(OD at 490nm)
443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498
**
**
2.0 1.8 1.6 1.4
Figure 3 | Effect of CpG-oligodeoxynucleotide (ODN) and interleukin (IL)-6 on cultured splenocytes of ddY mice. (a) Serum levels of IL6 in mice injected with CpG-ODN were significantly higher compared with control mice. CpG-ODN stimulation increased production of IL-6 of splenocytes of ddY mice in culture. Incubation of splenocytes of ddY mice with recombinant IL-6 increased production of total IgA and aberrantly glycosylated IgA, resulting in the formation of IgG-IgA immune complex (IC). Recombinant IL-6 increased overproduction of a proliferation inducing ligand (APRIL). (b) Splenocytes in culture were stimulated with CpG-ODN in the presence or absence of IL-6-neutralizing antibody. Anti–IL-6 antibody reduced production of total IgA and aberrantly glycosylated IgA and, consequently, reduced formation of IgG-IgA IC induced by CpG-ODN. Bars ¼ mean SEM. *P < 0.05, **P < 0.01. OD, optical density; PBS, phosphate-buffered saline solution; RCA-I, Ricinus communis agglutinin-I; SNA, Sambucus nigra agglutinin.
CpG-ODN in ddY mice aggravated renal injuries accompanied by glomerular IgA and IgG deposits, likely because of increased serum levels of aberrantly glycosylated IgA and
IgG-IgA IC. Moreover, we showed that TLR9 activation was involved in synthesis of Gd-IgA1 in human IgA1-secreting cell lines.
Kidney International (2019) -, -–-
5 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554
basic research
1.0
5 10
0.0
GAPDH
Gd-IgA1 (unit)
**
300 250 200
0
10
CpG-ODN (μg/ml)
5000 0
10
**
4 2 0
9000 8000 7000 6000
non CpG-ODN
d 15000
45
**
**
**
10000
40 35 30 0
10
CpG-ODN (μg/ml)
**
10 5
IL-6 + siRNA APRIL IL-6 + siRNA control
0 100 rAPRIL (ng/ml)
CpG-ODN
**
50
25
*
10000
6
**
15
**
0 { PBS z IL-6
c
8
CpG non-CpG
350
10000
CpG-ODN (μg/ml)
Relative intensity of APRIL
APRIL
0
**
15000
IgA (unit)
0
CpG-ODN (μg/ml)
IgA (unit)
0
0.5
**
Gd-IgA1 (unit)
10
20000
20
**
Gd-IgA1 (unit)
1.5
IgA (unit)
15
b
**
5000 0
Gd-IgA1 (unit)
**
APRIL expression
IL-6 (pg/ml)
a
IgA (unit)
555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
18 17 16 15 14 13 12
40
**
0 100 rAPRIL (ng/ml)
**
**
**
30 20 10 0
{ PBS z CpG-ODN CpG-ODN + control IgG CpG-ODN + control IgG + siRNA control CpG-ODN + anti IL-6 CpG-ODN + anti IL-6 + siRNA APRIL
Figure 4 | Effect of CpG- oligodeoxynucleotide (ODN) or a proliferation inducing ligand (APRIL) supplementation on human IgA1secreting cell lines on IgA1, galactose-deficient IgA1 (Gd-IgA1), and interleukin (IL)-6 production. (a) CpG-ODN supplementation enhanced production of IL-6. CpG-ODN enhanced gene expression of APRIL. Western blot analysis demonstrated that CpG-ODN increased protein levels of APRIL. Results were evaluated densitometrically. Stimulation with CpG-ODN induced production of IgA and Gd-IgA1. (b) APRIL small, interfering RNA (siRNA) knockdown reduced IL-6–induced overproduction of IgA and Gd-IgA1. (c) IgA1-producing cells stimulated with recombinant APRIL produced more IgA and Gd-IgA1. (d) IgA1-secreting cells were incubated with anti–IL-6 antibody after CpG-ODN stimulation. The enhanced production of IgA and Gd-IgA1 induced by CpG-ODN was reduced by anti–IL-6 antibody and by siRNA knockdown of APRIL. Bars ¼ mean SEM. *P < 0.05, **P < 0.01. GADPH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline solution.
We assessed the mechanism by which TLR9 activation mediated enhanced production of aberrantly glycosylated IgA. BAFF and APRIL are known for their roles in B-cell survival and differentiation. McCarthy et al.33 demonstrated that BAFF-overexpressing transgenic mice develop mesangial IgA deposits with renal injury and urinary abnormalities.33 Recently we demonstrated that gene expression of APRIL is elevated in tonsillar germinal centers of patients with IgAN. Furthermore, overexpression of APRIL in tonsillar germinal centers correlated with serum levels of Gd-IgA1 and disease severity in patients with IgAN.34 These findings suggest that both BAFF and APRIL may be involved in the pathogenesis of IgAN. However, the association between BAFF/APRIL and TLR9 activation is unclear. In the present study, TLR9 activation increased gene expression and serum levels of APRIL. Serum levels of aberrantly glycosylated IgA correlated with expression levels of BAFF and APRIL in splenocytes. However, serum levels of IgG-IgA IC correlated with expression levels of
APRIL but not BAFF. Furthermore, serum levels of APRIL were associated with overproduction of aberrantly glycosylated IgA and IgG-IgA IC in the TLR9-activated mice. In IgA1-secreting cells, TLR9 activation also induced overproduction of Gd-IgA1 via APRIL. These results suggested that APRIL plays an important role in TLR9-induced overproduction of nephritogenic IgA and formation of IgG-IgA IC. The response by cell type to determine the role of the B and T cells and DCs should be clarified. In the present study, we assessed the role of B cells and plasmacytoid DCs. TLR9 is expressed by DCs, B cells, and macrophages but not by T cells.35–37 The contribution of BAFF/APRIL to T cell– independent antibody response is known.38,39 Here we tested whether TLR9 activation can enhance synthesis of aberrantly glycosylated IgA and formation of IgG-IgA IC via APRIL in a T cell–independent manner. We also used cloned human IgA1secreting cell lines and showed that TLR9 activation augmented production of Gd-IgA1 via APRIL and IL-6, Kidney International (2019) -, -–-
6 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666
667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722
Q6
suggesting that the process is T cell–independent. Furthermore, we evaluated the roles of B cells and DCs. We showed that CpGODN specific for B cells and DCs increased production of aberrantly glycosylated IgA in whole splenocytes. Furthermore, we investigated whether CpG-ODN stimulation in vitro can enhance IgA production. CpG-ODN stimulation of isolated B cells induced overproduction of IgA. In addition, CpG-ODN significantly increased IgA production when B cells were cocultured with DCs (Supplementary Figure S1). These results suggest that CpG-ODN activation resulting in greater IgA production and aberrant glycosylation is mediated by TLR9 in a T cell–independent manner. IL-6 is known to accentuate proliferation of immunoglobulin-producing cells and the terminal differentiation of plasma cells.40–42 Furthermore, IL-6 also may be a primary-candidate cytokine for T follicular helper cell differentiation.43,44 T follicular helper cells are essential for B-cell affinity maturation, class switch recombination, and memory B-cell and plasma cell generation within the germinal center.43,44 In a lupus mouse model, IL-6 deficiency prevented T follicular helper cell differentiation and germinal-center B-cell expansion, resulting in reduced autoantibody production.45 The present study clarified that TLR9 activation by CpGODN enhanced IL-6 production in splenocytes of murine IgAN. IL-6 induced overproduction of aberrantly glycosylated IgA and IgG-IgA IC in a murine model of IgAN. In human IgA1-secreting cells, we confirmed that IL-6 enhanced production of Gd-IgA1.24 Our findings suggest that IL-6 may be one of the major molecules inducing overproduction of nephritogenic IgA mediated by TLR9 activation. APRIL plays an important role in IgA-class switching and plasmacytoid differentiation.46,47 IL-6 promotes the terminal differentiation of B cells to IgA-secreting plasma cells.41,42 The present study demonstrated that IL-6 stimulation induced production of APRIL. Then we hypothesized that there was an association between APRIL and IL-6 mediated by TLR9 activation that induced production of aberrantly glycosylated IgA. We found that IL-6–neutralizing antibody did not completely block CpG-ODN–induced overproduction of Gd-IgA1 and that siRNA knockdown of APRIL reduced overproduction of GdIgA1 induced by IL-6. These data suggested that APRIL and IL-6 synergistically promoted the production of Gd-IgA1 mediated by TLR9 activation. Furthermore, both IL-6–neutralizing antibody and siRNA knockdown of APRIL reduced production of IgA and Gd-IgA1 more than did IL-6–neutralizing antibody alone. Thus the TLR9 activation pathway involves IL-6 and APRIL synergistic effect on antibody production and glycosylation (Figure 5). Recent studies also have indicated that IL-6, in combination with APRIL, induced generation and survival of PCs.48,49 However, future studies are required to clarify intercellular signaling pathways between APRIL and IL-6 in the production of nephritogenic IgA. In conclusion, TLR9 activation exacerbated renal injury in a murine model of IgAN by enhancing production of aberrantly glycosylated IgA and formation of IgG-IgA IC. In this process, the overproduction of APRIL and IL-6 induced by
print & web 4C=FPO
basic research
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
Figure 5 | Synergistic role between Toll-like receptor 9 (TLR9), a proliferation inducing ligand (APRIL), and interleukin (IL)-6 in IgA-producing cells in IgA nephropathy (IgAN). TLR9 activation induced production of APRIL and IL-6, resulting in overproduction of aberrantly glycosylated IgA. APRIL and IL-6 function synergistically to promote the generation of aberrantly glycosylated IgA. In addition to APRIL inducing production of IL-6, as previously reported, IL-6 can also enhance synthesis of APRIL. Furthermore, APRIL and IL-6 independently promote production of aberrantly glycosylated IgA. NF-kB, nuclear factor kB.
TLR9 activation enhanced production nephritogenic IgA. In addition, the present study clarified that APRIL and IL-6 function synergistically, as well as independently, to produce aberrantly glycosylated IgA. These findings may inform future development of new therapeutic approaches for IgAN. Q7 METHODS Animals and experimental protocols The IgAN-prone ddY mouse is a known model of spontaneous IgAN with variable incidence and extent of glomerular injury mimicking human IgAN.10 ddY mice are divided into 3 groups based on manifestation of kidney damage: mice with early or late onset and quiescent mice. Early-onset disease in ddY mice presents with proteinuria and IgA deposits in glomerular after 20 weeks of age.13 Q8 Therefore, we used ddY mice within 18 weeks of age to evaluate whether TLR9 activation aggravated IgAN in this model. A total of 30 female ddY mice (SLC Japan, Shizuoka, Japan) were maintained at the animal facility of Juntendo University, Tokyo, Japan. Mice were fed regular chow (Oriental Yeast Co., Tokyo, Japan) and water ad libitum and were housed in a specific pathogen-free room. The experimental protocol was approved by the Ethics Review Committee for Animal Experimentation of Juntendo University Faculty of Medicine. At 6 weeks of age the mice were randomly divided into 2 groups. One group received CpG-ODN injected intraperitoneally 3 times per week for 12 weeks; the second group (control) was injected with non–CpG-ODN. CpG-ODN and non–CpG-ODN were chemically synthesized (Invitrogen; Thermo Fisher Scientific, Kanagawa, Japan). Sequences of the ODN are TCGTCGTT TTCGGCGCGCGCCG or TGCTGCTTTTGGGGGGCCCCCC (5’/3’) for CpG or non-CpG ODNs, respectively.
Determination of IgA, IgG, IgG-IgA IC, and aberrantly glycosylated IgA in murine serum Blood samples were collected from the buccal vein. Serum IgA, IgG, and IgG-IgA IC were measured by sandwich enzyme-linked immunosorbent assay (ELISA; Bethyl Laboratories, Montgomery, TX) using the modified method based on our previous report.50
Kidney International (2019) -, -–-
7 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778
basic research
779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
Lectin-binding assays were used to access the glycoform of IgA. Biotinylated RCA-I (Vector Laboratories, Burlingame, CA) and Sambucus nigra bark lectin (Vector Laboratories) that recognized galactose and sialic acid attached to galactose (predominantly in a2,6 linkage), respectively, were used in this assay.51 Diluted sera were added at 100 ng of IgA per well. Microtiter plates coated with 1 mg/ ml goat anti-mouse IgA (100 ml/well) for quantification of serum IgA were incubated with these samples, and biotinylated Sambucus nigra agglutinin or RCA-I was then added. Avidin–horseradish peroxidase conjugate (ExtrAvidin; Sigma-Aldrich, St. Louis, MO) was applied. Serum levels of aberrantly glycosylated bound IgA were expressed in units (1 unit as optical density 1.0 measured at 490 nm). Serum level of APRIL and BAFF were measured using a mouse APRIL ELISA kit (MyBioSource, San Diego, CA) and a mouse BAFF ELISA kit (R&D Systems, Minneapolis, MN), according to the manufacturer’s protocols. Assay for Gd-IgA1 produced by human IgA1-secreting cells A sandwich ELISA for Gd-IgA1 was constructed using Gd-IgA1– specific antibody (IBL, Japan).52 Gd-IgA1–specific antibody (7.5 mg/ ml) diluted in phosphate-buffered saline solution was coated onto an ELISA plate for 18 hours at room temperature. Samples were applied and incubated for 2 hours at room temperature. Plates were washed and incubated for 2 hours at room temperature with a 1:1000diluted horseradish peroxidase–conjugated mouse anti-human IgA1 a1-chain–specific monoclonal antibody (Southern Biotech, Birmingham, AL). After washing, plates were developed with SIGMAFAST o-phenylenediamine solution (Sigma-Aldrich) and the reaction was stopped by the addition of 1 M sulfuric acid (Wako, Osaka, Japan). The levels of Gd-IgA1 were extrapolated by referring to a standard curve (4-parameter logistic curve fitting) of optical density at 490 nm and expressed in units. Enzymatically generated Gd-IgA1 from human plasma IgA152 was serially diluted (1.37–1000 ng/ml) to generate a standard curve. In this study, 1 unit was defined as 1 ng/mL of the standard Gd-IgA1.52 Evaluation of renal injury in ddY mice Kidneys were removed after perfusion with normal saline solution. Renal tissue specimens for microscopic examination were fixed in 20% formaldehyde, embedded in paraffin, cut into 3-mm-thick sections, and then stained with periodic acid–Schiff. Specimens were quantitatively analyzed to determine the percentage of glomeruli with segmental and global sclerosis and/or mesangial cell proliferation and/or increase in mesangial matrix. Each section was scored semiquantitatively for percentages of glomeruli with aforementioned lesions (0, 0%; 1, 1% to 24%; 2, 25% to 49%; and 3, >50% of 20 glomeruli).13,53,54 The total maximal score for each section was 9. Renal specimens for immunofluorescence were immersed in optimal cutting temperature compound (Sakura Finetek Japan Co., Tokyo, Japan) and stored at –80 C. The specimens were cut into 3-mmthick sections, fixed with acetone at –20 C for 5 minutes, washed with phosphate-buffered saline solution, blocked with a blocking agent (DS Pharma Biomedical Co., Osaka, Japan) at room temperature for 30 minutes, and then incubated at room temperature for 2 hours with the following primary antibodies: goat anti-murine IgA, Alexa conjugated goat anti-murine IgG, and rat anti-C3 (Bethyl Laboratories). After 3 more washes with phosphate-buffered saline solution, the slides were mounted with mounting medium (Dako, Tokyo, Japan). Samples were analyzed and imaged using confocal laser microscopy (Olympus Corporation, Tokyo, Japan).
Real-time quantitative polymerase chain reaction RNA from spleen cells was extracted using Torizol solution (Invitrogen, Tokyo, Japan) and purified with RNeasy Mini Kit (74106; Qiagen, Valencia, CA). Real-time quantitative polymerase chain reaction was performed using the Applied Biosystems 7500 RealTime polymerase chain reaction system using SYBR Green PCR Master Mix (Applied Biosystems, Tokyo, Japan) and specific primers: mouse TLR9 forward primer TCTCCCAACATGGTTCTCCGTCG, reverse primer TGCAGTCCAGGCCATGA; mouse MyD88 forward primer GCACCTGTGTCTGGTCCATT, reverse primer CTGTTGGA CACCTGGAGACA; and the housekeeping gene glyceraldehyde3-phosphate dehydrogenase forward primer CATTGTGGAAG GGCTCATGA, reverse primer TCTTCTGGGTGGCAGTGATG. The amplification conditions were as follows: preheating at 95 C for 20 seconds and then 40 cycles of denaturation at 95 C for 3 seconds, and annealing and extension at 60 C for 30 seconds. Homo sapiens– specific TaqMan gene expression assays (Life Technologies, Carlsbad, CA) were purchased for the primer of APRIL, Hs00601664_g1 and Mm03809849-s1, and BAFF, Mm01168134-m1. The TaqMan polymerase chain reaction cycling conditions were as follows: preheating at 95 C for 20 seconds and then 40 cycles of denaturation at 95 C for 3 seconds, and annealing and extension at 60 C for 30 seconds. In vitro studies with splenocytes of ddY mice Splenocytes were cultured in Roswell Park Memorial Institute–1640 medium supplemented with 20% fetal calf serum, 100 mg/ml streptomycin, and 100 U/ml penicillin. Red blood cells were lysed in Red Blood Cell Lysing Buffer (R7757; Sigma-Aldrich) at room temperature for 1 minute, followed by washing in Roswell Park Memorial Institute–1640 medium.50 Cell cultures were kept in a humidified incubator at 37 C with 5% CO2. Class C CpG-ODN (TCGTCGTTTTCGGCGCGCGCCG) was used as the TLR9 ligand. Recombinant IL-6, anti–IL-6 antibody, and rat IgG1 isotype control were obtained from R&D Systems. Cells were cultured with either medium or recommended concentrations of CpG-ODN, 10 ng/ml recombinant IL-6, and 100 ng/ml anti-IL6 antibody. IgA, aberrantly glycosylated IgA, IgG-IgA IC, and APRIL produced by splenocytes were measured by ELISA after 72-hour incubation in vitro. In vitro studies with human IgA1-secreting cell lines B cells from the blood of a healthy person were immortalized with Epstein-Barr virus, subcloned to yield IgA1-secreting cell lines, and cultured as described.9 Furthermore, we confirmed expression of receptors for APRIL/BAFF and IL-6. Cells were cultured in Roswell Park Memorial Institute–1640 medium supplemented with 20% fetal calf serum, streptomycin, and penicillin in a humidified incubator at 37 C with 5% CO2. Class B CpG-ODN (TCGTCGTTTTGTCGTTTTGTCGTT) was used as the TLR9 ligand. Recombinant IL-6, recombinant APRIL, anti–IL-6 antibody, and goat IgG control antibody were obtained from R&D Systems. Cells were cultured with either medium or recommended concentrations of CpG-ODN, 50 ng/ml recombinant IL-6, 40 ng/ml recombinant APRIL, and 100 ng/ml anti–IL-6 antibody for 72 hours. Western blotting Supernatants from IgA1-secreting cells were separated by sodium dodecylsulfate– polyacrylamide gel electrophoresis under reducing conditions using 5% to 15% gradient slab gels. The gels were transferred to polyvinylidene diflouride membranes and incubated with antibodies specific for APRIL (Abcam Inc., Cambridge, MA) and glyceraldehyde-3-phosphate dehydrogenase (Abcam Inc). Blots Kidney International (2019) -, -–-
8 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890
basic research
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946
were visualized by chemiluminescence using enhanced chemiluminescence (GE Healthcare, Tokyo, Japan) and luminescence detector (Konica Minolta Healthcare, Tokyo, Japan). Results were evaluated densitometrically. APRIL siRNA knockdown Human IgA1-secreting cells were cultured in 24-well culture plates and transfected with APRIL-specific siRNA (GS8741, Qiagen) or siRNA nontargeting control (GS10673, Qiagen) using the transfection protocol according to the manufacturer’s instructions. After incubation for 24 hours, the cells were incubated with 50 ng/ml recombinant IL-6 (R&D Systems) for 72 hours. After incubation, cells and supernatants were harvested for measurement of IgA and Gd-IgA1. Statistical analysis The correlation between different parameters was analyzed using analysis of variance. Data were expressed as the mean SD or median values. P values < 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism version 6.0 for Windows (GraphPad Software, San Diego, CA). DISCLOSURE All the authors declared no competing interests.
ACKNOWLEDGMENTS
Q11
This study was supported in part by JSPS KAKENHI grant No. 18K08252 and the Practical Research Project for Renal Diseases from the Japan Agency for Medical Research and development, AMED. JN and BAJ were supported in part by National Institutes of Health grants DK078244 and DK082753. We thank Ms. Terumi Shibata and Aki Omori for their excellent technical assistance. We also thank Ms. Takako Ikegami and Ms. Tomomi Ikeda (Division of Molecular and Biochemical Research, Juntendo University Graduate School of Medicine) and Ms. Tamami Sakanishi (Division of Cell Biology, Juntendo University Graduate School of Medicine) for their excellent technical assistance.
Q9
SUPPLEMENTARY MATERIAL Supplementary File (PDF) Figure S1. CpG-oligodeoxynucleotide (ODN)–activated B cells and dendritic cells (DCs) further enhance IgA production. B cells and DCs were isolated from the spleens of ddY mice. CpG-ODN stimulation increased IgA production in the isolated B cells. This increase was further enhanced by co-culturing B cells with DCs. *P < 0.05. Supplementary Methods. REFERENCES 1. Myette JR, Kano T, Suzuki H, et al. A Proliferation Inducing Ligand (APRIL) targeted antibody is a safe and effective treatment of murine IgA nephropathy. Kidney Int. 2019;96:104–116. 2. Levy M, Berger J. Worldwide perspective of IgA nephropathy. Am J Kidney Dis. 1988;12:340–347. 3. D’Amico G. The commonest glomerulonephritis in the world: IgA nephropathy. Q J Med. 1987;64:709–727. 4. Feehally J, Beattie TJ, Brenchley PE, et al. Sequential study of the IgA system in relapsing IgA nephropathy. Kidney Int. 1986;30:924–931. 5. Wyatt RJ, Julian BA. IgA nephropathy. N Engl J Med. 2013;368:2402–2414. 6. Suzuki H, Yasutake J, Makita Y, et al. IgA nephropathy and IgA vasculitis with nephritis have a shared feature involving galactose-deficient IgA1oriented pathogenesis. Kidney Int. 2018;93:700–705. 7. Glassock RJ. Analyzing antibody activity in IgA nephropathy. J Clin Invest. 2009;119:1450–1452.
8. Moldoveanu Z, Wyatt RJ, Lee JY, et al. Patients with IgA nephropathy have increased serum galactose-deficient IgA1 levels. Kidney Int. 2007;71: 1148–1154. 9. Suzuki H, Moldoveanu Z, Hall S, et al. IgA1-secreting cell lines from patients with IgA nephropathy produce aberrantly glycosylated IgA1. J Clin Invest. 2008;118:629–639. 10. Imai H, Nakamoto Y, Asakura K, et al. Spontaneous glomerular IgA deposition in ddY mice: an animal model of IgA nephritis. Kidney Int. 1985;27:756–761. 11. Okazaki K, Suzuki Y, Otsuji M, et al. Development of a model of earlyonset IgA nephropathy. J Am Soc Nephrol. 2012;23:1364–1374. 12. Nishie T, Miyaishi O, Azuma H, et al. Development of immunoglobulin A nephropathy- like disease in beta-1,4-galactosyltransferase-I-deficient mice. Am J Pathol. 2007;170:447–456. 13. Suzuki H, Suzuki Y, Yamanaka T, et al. Genome-wide scan in a novel IgA nephropathy model identifies a susceptibility locus on murine chromosome 10, in a region syntenic to human IGAN1 on chromosome 6q22-23. J Am Soc Nephrol. 2005;16:1289–1299. 14. Takei T, Iida A, Nitta K, et al. Association between single-nucleotide polymorphisms in selectin genes and immunoglobulin A nephropathy. Am J Hum Genet. 2002;70:781–786. 15. Gharavi AG, Yan Y, Scolari F, et al. IgA nephropathy, the most common cause of glomerulonephritis, is linked to 6q22-23. Nat Genet. 2000;26:354–357. 16. Suzuki H, Suzuki Y, Narita I, et al. Toll-like receptor 9 affects severity of IgA nephropathy. J Am Soc Nephrol. 2008;19:2384–2395. 17. Nakata J, Suzuki Y, Suzuki H, et al. Changes in nephritogenic serum galactose-deficient IgA1 in IgA nephropathy following tonsillectomy and steroid therapy. PLoS One. 2014;9:e89707. 18. Sato D, Suzuki Y, Kano T, et al. Tonsillar TLR9 expression and efficacy of tonsillectomy with steroid pulse therapy in IgA nephropathy patients. Nephrol Dial Transplant. 2012;27:1090–1097. 19. Coppo R, Camilla R, Amore A, et al. Toll-like receptor 4 expression is increased in circulating mononuclear cells of patients with immunoglobulin A nephropathy. Clin Exp Immunol. 2010;159:73–81. 20. Maiguma M, Suzuki Y, Suzuki H, et al. Dietary zinc is a key environmental modifier in the progression of IgA nephropathy. PLoS One. 2014;9: e90558. 21. Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol Med. 2007;13:460–469. 22. Kuwata H, Matsumoto M, Atarashi K, et al. IkappaBNS inhibits induction of a subset of Toll-like receptor-dependent genes and limits inflammation. Immunity. 2006;24:41–51. 23. Rostoker G, Rymer JC, Bagnard G, et al. Imbalances in serum proinflammatory cytokines and their soluble receptors: a putative role in the progression of idiopathic IgA nephropathy (IgAN) and HenochSchönlein purpura nephritis, and a potential target of immunoglobulin therapy? Clin Exp Immunol. 1998;114:468–476. 24. Suzuki H, Raska M, Yamada K, et al. Cytokines alter IgA1 O-glycosylation by dysregulating C1GalT1 and ST6GalNAc-II enzymes. J Biol Chem. 2014;289:5330–5339. 25. Yamada K, Huang ZQ, Raska M, et al. Inhibition of STAT3 signaling reduces IgA1 autoantigen production in IgA nephropathy. Kidney Int Rep. 2017;2:1194–1207. 26. Schneider P, MacKay F, Steiner V, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J Exp Med. 1999;189: 1747–1756. 27. Kiryluk K, Li Y, Scolari F, et al. Discovery of new risk loci for IgA nephropathy implicates genes involved in immunity against intestinal pathogens. Nat Genet. 2014;46:1187–1196. 28. Han SS, Yang SH, Choi M, et al. The role of TNF superfamily member 13 in the progression of IgA nephropathy. J Am Soc Nephrol. 2016;27:3430– 3439. 29. Hiki Y, Odani H, Takahashi M, et al. Mass spectrometry proves under-Oglycosylation of glomerular IgA1 in IgA nephropathy. Kidney Int. 2001;59: 1077–1085. 30. Allen AC, Bailey EM, Brenchley PE, et al. Mesangial IgA1 in IgA nephropathy exhibits aberrant O-glycosylation: observations in three patients. Kidney Int. 2001;60:969–973. 31. Hiki Y. O-linked oligosaccharides of the IgA1 hinge region: roles of its aberrant structure in the occurrence and/or progression of IgA nephropathy. Clin Exp Nephrol. 2009;13:415–423. 32. Mestecky J, Tomana M, Moldoveanu Z, et al. Role of aberrant glycosylation of IgA1 molecules in the pathogenesis of IgA nephropathy. Kidney Blood Press Res. 2008;31:29–37.
Kidney International (2019) -, -–-
9 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002
basic research
1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035
Y Makita et al.: APRIL and IL-6 mediated aberrant IgA glycosylation
33. McCarthy DD, Kujawa J, Wilson C, et al. Mice overexpressing BAFF develop a commensal flora-dependent, IgA-associated nephropathy. J Clin Invest. 2011;121:3991–4002. 34. Muto M, Manfroi B, Suzuki H, et al. Toll-like receptor 9 stimulation induces aberrant expression of a proliferation-inducing ligand by tonsillar germinal center B cells in IgA nephropathy. J Am Soc Nephrol. 2017;28:1227–1238. 35. Latz E, Schoenemeyer A, Visintin A, et al. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol. 2004;5:190–198. 36. Hornung V, Rothenfusser S, Britsch S, et al. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol. 2002;168:4531–4537. 37. Kadowaki N, Ho S, Antonenko S, et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med. 2001;194:863–869. 38. He B, Xu W, Santini PA, et al. Intestinal bacteria trigger T cell-independent immunoglobulin A(2) class switching by inducing epithelial-cell secretion of the cytokine APRIL. Immunity. 2007;26:812–826. 39. Mackay F, Schneider P. Cracking the BAFF code. Nat Rev Immunol. 2009;9: 491–502. 40. Kunimoto DY, Nordan RP, Strober W. IL-6 is a potent cofactor of IL-1 in IgM synthesis and of IL-5 in IgA synthesis. J Immunol. 1989;143:2230–2235. 41. Beagley KW, Eldridge JH, Lee F, et al. Interleukins and IgA synthesis. Human and murine interleukin 6 induce high rate IgA secretion in IgA-committed B cells. J Exp Med. 1989;169:2133–2148. 42. Ramsay AJ, Husband AJ, Ramshaw IA, et al. The role of interleukin-6 in mucosal IgA antibody responses in vivo. Science. 1994;264:561– 563. 43. Nurieva RI, Chung Y, Martinez GJ, et al. Bcl6 mediates the development of T follicular helper cells. Science. 2009;325:1001–1005.
44. Poholek AC, Hansen K, Hernandez SG, et al. In vivo regulation of Bcl6 and T follicular helper cell development. J Immunol. 2010;185: 313–326. 45. Jain S, Park G, Sproule TJ, et al. Interleukin 6 accelerates mortality by promoting the progression of the systemic lupus erythematosus-like disease of BXSB.Yaa mice. PLoS One. 2016;11:e0153059. 46. Litinskiy MB, Nardelli B, Hilbert DM, et al. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat Immunol. 2002;3:822–829. 47. Castigli E, Wilson SA, Scott S, et al. TACI and BAFF-R mediate isotype switching in B cells. J Exp Med. 2005;201:35–39. 48. Jourdan M, Cren M, Robert N, et al. IL-6 supports the generation of human long-lived plasma cells in combination with either APRIL or stromal cell-soluble factors. Leukemia. 2014;28:1647–1656. 49. Chu VT, Fröhlich A, Steinhauser G, et al. Eosinophils are required for the maintenance of plasma cells in the bone marrow. Nat Immunol. 2011;12: 151–159. 50. Suzuki H, Suzuki Y, Aizawa M, et al. Th1 polarization in murine IgA nephropathy directed by bone marrow-derived cells. Kidney Int. 2007;72: 319–327. 51. Chintalacharuvu SR, Emancipator SN. The glycosylation of IgA produced by murine B cells is altered by Th2 cytokines. J Immunol. 1997;159:2327– 2333. 52. Yasutake J, Suzuki Y, Suzuki H, et al. Novel lectin-independent approach to detect galactose-deficient IgA1 in IgA nephropathy. Nephrol Dial Transplant. 2015;30:1315–1321. 53. Katafuchi R, Kiyoshi Y, Oh Y, et al. Glomerular score as a prognosticator in IgA nephropathy: its usefulness and limitation. Clin Nephrol. 1998;49:1–8. 54. Ballardie FW, Roberts IS. Controlled prospective trial of prednisolone and cytotoxics in progressive IgA nephropathy. J Am Soc Nephrol. 2002;13: 142–148.
Kidney International (2019) -, -–-
10 FLA 5.6.0 DTD KINT1777_proof 27 September 2019 3:28 pm ce
1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068