ROCK activation

European Journal of Pharmacology 697 (2012) 88–96

Contents lists available at SciVerse ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Cardiovascular pharmacology

Tonic arterial contraction mediated by L-type Ca2 þ channels requires sustained Ca2 þ influx, G protein-associated Ca2 þ release, and RhoA/ROCK activation Miguel Ferna´ndez-Tenorio 1, Cristina Porras-Gonza´lez, Antonio Castellano, ˜a n Jose´ Lo´pez-Barneo, Juan Uren ´dica y Biofı´sica, Hospital Universitario Virgen del Rocı´o/CSIC/Universidad de Sevilla, Spain Instituto de Biomedicina de Sevilla (IBIS) and Dpto. Fisiologı´a Me

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 April 2012 Received in revised form 20 September 2012 Accepted 21 September 2012 Available online 7 October 2012

KCl-evoked sustained contraction requires L-type Ca2 þ channel activation, metabotropic Ca2 þ release from the sarcoplasmic reticulum (mechanism denoted Calcium Channel-Induced Ca2 þ Release) and RhoA/Rho associated kinase activation. Although high K þ solutions are used to depolarize myocytes, these solutions can stimulate other signaling pathways such as those triggered by the activation of muscarinic and purinergic receptors. The present study examines the functional role of Calcium Channel-Induced Ca2 þ Release under pharmacological activation of L-type Ca2 þ channel without significant membrane depolarization. It also analyzes the role of the ‘‘steady-state’’ Ca2 þ influx through L-type Ca2 þ channels on myocyte sustained contraction. Measurement of contractility in arterial rings was done on a vessel myograph. Membrane potential was measured by fluorescence techniques loading intact myocytes with a membrane potential sensitive dye, and a reversible permeabilization method was used to load myocytes in intact arteries with GDPbS and Cav1.2 siRNA. Application of an L-type Ca2 þ channel agonist, without effect on membrane potential, evoked sustained contraction via G-protein induced Ca2 þ release from the sarcoplasmic reticulum and RhoA/Rho associated kinase activation. Tonic myocyte contractions mediated by L-type Ca2 þ channel activation required sustained Ca2 þ influx through the channels and Ca2 þ uptake by the sarcoplasmic reticulum. Because L-type Ca2 þ channels participate in numerous pathophysiological processes mediated by maintained arterial contraction, our data could help to optimize therapeutic treatment of arterial vasospasm. & 2012 Elsevier B.V. All rights reserved.

Keywords: L-type Ca2 þ channel FPL64176 Sarcoplasmic reticulum Basilar artery Vasoconstriction

1. Introduction Elevation of intracellular calcium concentration ([Ca2 þ ]i) is a major variable that regulates contraction of vascular smooth muscle (VSM). The rise of [Ca2 þ ]i can be mediated by Ca2 þ influx from the extracellular medium or Ca2 þ release from the sarcoplasmic reticulum (SR) after activation of inositol 1,4,5-trisphosphate (InsP3) and ryanodine receptors (Bolton, 1979). The SR is also specialized in Ca2 þ storage by removing Ca2 þ from the cytoplasm via SR Ca2 þ -ATPase (SERCA). Besides exerting direct control of myosin light chain (MLC) phosphorylation, cytosolic Ca2 þ also influences VSM contraction through enhancement of the sensitivity of the contractile apparatus, a process called ‘‘Ca2 þ sensitization’’, which is mediated by the small monomeric G-protein RhoA and its target Rho-associated kinase (ROCK). n

Corresponding author. Tel.: þ34 955 923060. ˜ a). E-mail address: [email protected] (J. Uren 1 Present address: Department of Physiology, University of Bern, Buehlplatz 5, CH-3012 Bern, Switzerland. 0014-2999/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ejphar.2012.09.047

An important pathway for Ca2 þ influx in VSM are L-type voltage-dependent Ca2 þ channels (VGCCs) which can interact with the SR. In recent years a new SR Ca2 þ release mechanism, depolarization-induced Ca2 þ release (DICR), has been described (del Valle-Rodrı´guez et al., 2003; Ganitkevich and Isenberg, 1993; Itoh et al., 1992; Liu et al., 2009; Mahaut-Smith et al., 1999). DICR refers to Ca2 þ release from the SR in the absence of any transmembrane Ca2 þ influx, and takes place by means of a metabotropic pathway that involves G-protein/phospholipase C (PLC) activation and subsequent synthesis of InsP3 (Araya et al., 2003; del Valle-Rodrı´guez et al., 2006). We have proposed that VGCCs play an important role in the metabotropic coupling of membrane depolarization to SR Ca2 þ release in VSM cells (del Valle-Rodrı´guez et al., 2003; Ferna´ndez-Tenorio et al., 2010; ˜ a et al., 2007). We have shown that this mechanism, denoted Uren as CCICR (Calcium Channel-Induced Calcium Release), participates in the maintenance of the KCl-evoked contraction through activation of the RhoA/ROCK sensitization pathway (Ferna´ndezTenorio et al., 2011). In these experiments a high KCl solution was used to depolarize myocytes and to activate VGCCs, hence it could

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

be argued that some of the effects of high external K þ were due to stimulation of other complex cell signaling systems rather than to VGCCs activation. For instance, KCl can influence G-protein coupled receptors independently of the change in membrane potential (Pitt et al., 2005), and KCl-evoked depolarization can induce direct control of G-protein coupled receptors (Ben-Chaim et al., 2006; Mahaut-Smith et al., 2008). Here, we have studied the functional role of CCICR when VGCCs are activated pharmacologically, without the need of membrane depolarization, using FPL64176 (Rampe and Lacerda, 1991), a Ca2 þ channel agonist that facilitates CCICR in basilar arteries (del Valle-Rodrı´guez et al., 2003,2006). Because at depolarized voltages (in a potential range intermediate between current activation and complete inactivation) a population of VGCC allows a ‘‘steady state’’ Ca2 þ influx via a so-called VGCC window current (Fleischmann et al., 1994), we have also investigated whether this residual Ca2 þ current influences sustained arterial contraction. We report that, as observed in the response to KCl, Gprotein mediated Ca2 þ release from the SR and RhoA/ROCK sensitization pathway participates in the sustained contraction evoked by pharmacological activation of VGCCs. Our results also show that long and maintained depolarization-evoked contractions require Ca2 þ influx through VGCCs and Ca2 þ uptake by the SR.

2. Materials and methods 2.1. Preparation of dispersed basilar myocytes Rats were housed in a temperature-controlled room on a 12 h light-dark cycle and provided with access to food and water ad libitum. All animals and experimental protocols were in accordance with guidelines established by Spanish legislation (RD 1201/2005). Experiments were approved by the Ethics Committee of the University of Seville. Adult Wistar rats (250–300 g) were anesthetized, decapitated and the brains were rapidly extracted and placed in cold Hank’s solution. Basilar arteries were dissected, cut into pieces and incubated at 4 1C for 3 h and then in Hank’s solution containing 12.46 IU/ml papain, 620.4 IU/ml collagenase, and 1 mg/ml BSA (bovine serum albumin), at 37 1C for 10 min. Cells were mechanically dispersed and plated on coverslips and stored at room temperature until use. 2.2. Confocal microscopy and immunocytochemistry Isolated cells were placed on coverslips and fixed with 4% paraformaldehyde in PBS (phosphate-buffered saline) solution for 20 min. Subsequently, cells were rinsed in this solution and incubated 1 h in non-specific binding solution (PBS, 10% fetal bovine serum, 1 mg/ml BSA, 0.1% Triton X-100). We used mouse antiRhoA antibody (Santa Cruz, USA) and rabbit anti-mouse FITC (conjugated to fluorescein isothiocyanate) (Sigma-Aldrich, USA) secondary antibody to stain RhoA. Cells were incubated for 1 h at room temperature in mouse anti-RhoA diluted 1:200 in non-specific binding solution. Cells were rinsed in PBS and incubated for 1 h in rabbit anti-mouse FITC diluted 1:1000 in non-specific binding solution. The cell nucleus was marked using propidium iodide (1 mg/ml). Finally, coverslips were rinsed in PBS and mounted onto slides. Fluorescence was observed using a confocal microscope (TCS SP2, Leica, Germany). Excitation was done with an Argon–Kripton laser (488 nm) and the emitted fluorescence (500–535 nm) was recorded through an oil immersion objective (40  1.25). 2.3. Measurement of contractility in arterial rings Arteries were cleaned of connective tissue, cut in rings ( 2 mm) and mounted on a small vessel myograph (Danish Myo Thecnology,

89

Denmark), to measure isometric tension, connected to a digital recorder (AcqKnowledge 3.8.1, BIOPAC System). The rings were placed on a chamber filled with the Kreb’s solution and bubbled with 95% O2 and 5% CO2 at pH 7.4. Before the experiments, the segments were subjected to an optimal tension (90% of tension equivalent to an intramural pressure of 100 mm Hg) and stabilized for at least 1 h. All the drugs used were added directly to the chamber while vessel tension was monitored. Experiments were performed at 30 1C. 2.4. Simultaneous measurement of intracellular [Ca2 þ ] and arterial diameter Experiments in intact arteries were done using rat basilar arteries incubated for 1 h in Hank’s solution containing 4 mM Fura-2 AM at room temperature. Arteries were cannulated at each end in a temperature-controlled perfusion chamber (Living Systems Instrumentation, USA), pressurized to 60 mmHg, and perfused with standard Kreb’s solution (5 ml/min, 37 1C) for 40 min to allow stabilization. An optical-based measuring system (Myocam, IonOptix Corporation, USA), coupled to an inverted microscope (Axiovert 35 Zeiss, Germany), was used for simultaneous monitoring of Ca2 þ concentration and outer arterial diameter. The Fura-2 loaded artery was alternately excited at 340 or 380 nm and [Ca2 þ ] was monitored by the 340/380 ratio of the fluorescence intensities measured at 510 nm. Fluorescence was background-corrected. Arterial diameter and [Ca2 þ ] signals were digitized at 2 Hz and analyzed using IonWizard edge-detection software (IonOptix Corporation, USA). 2.5. Reversible arterial permeabilization Reversible permeabilization was achieved by a modification of previous methods (Kobayashi et al., 1989; Lesh et al., 1995). To load arteries with the Cav1.2 siRNA, vessels were incubated in the following sequence of solutions maintained at 4 1C (in mM): (1) 10 EGTA, 120 KCl, 5 ATP, 2 MgCl2, 20 TES (N-tris[hydroxymethyl]methyl-2-aminoethanesulfonic acid) (pH 6.8; 20 min); (2) 120 KCl, 5 ATP, 2 MgCl2, 20 TES and 20 nM of Cav1.2 siRNA (pH 6.8; 3 h); and (3) 120 KCl, 5 ATP, 10 MgCl2, 20 TES and 20 nM of Cav1.2 siRNA (pH 6.8; 30 min). Subsequently, arteries were bathed in a fourth solution containing (in mM): 140 NaCl, 5 KCl, 10 MgCl2, 5 glucose, and 2 MOPS (3-[N-morpholino]propanesulfonic acid) (pH 7.1, 22 1C) in which [Ca2 þ ] was gradually increased from 0.01 to 0.1 to 1.8 mM every 15 min. The rings were then incubated for 1–7 days in DMEM/F-12 culture medium (supplemented with 1 mM L-glutamine, 50 U/ml penicillin, and 50 mg/ml streptomycin) and maintained at 37 1C, in a 5% CO2 atmosphere. The medium was changed every day. This reversible permeabilization method was also used to load arteries with GDPbS. In these experiments 10 mM GDPbS was used in (2) and (3), instead of the Cav1.2 siRNA. 2.6. Conventional and real time RT-PCR Total RNA was extracted, from at least 3 basilar arteries per experiment, using the Nucleospin RNA II kit (Macherey-Nagel, Germany). Total RNA was reverse transcribed (to obtain cDNA) using the Superscript II RNase H- RT kit (Invitrogen, USA). Relative quantification of gene expression was performed by real-time PCR (qRT-PCR) using the SYBR Green Master Mix with the ABI Prism 7000 or 7500 Sequence Detection Systems (Applied Biosystems, USA). Cycle threshold (Ct) values were normalized to Ct values of the ribosomal RNA 18 S, used as endogenous gene. Oligonucleotide sequences to Cav1.2 were: Forward 50 TCATCTTCAGCCCAAACAACAG30 and Reverse 50 TTGGTGAAGATCGTGTCTTGAC30 .

90

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

2.7. Determination of membrane potential Changes in membrane potential were measured using the potentiometric fluorescence dye DiBAC4 (3) (bis-[1,3-dibutylbarbituric acid]trimethine oxonol). Membrane depolarization evokes the dye influx into the myocytes and an increase in emitted fluorescence. Isolated smooth muscle cells were loaded with the dye at 37 1C for 10 min. After loading, cells were placed in a chamber filled with phosphate saline solution (PSS). Fluorescence intensities were recorded every 1 s and background signal was subtracted. Fluorescence intensities emitted at an excitation wavelength of 488 nm were obtained using an inverted microscope (Zeiss Axiovert 200, Germany). 2.8. Cytosolic Ca2 þ measurements in isolated myocytes Myocytes were incubated in Hanks’ solution with 1.4 mM Fura 2-AM for 15 min at room temperature. A coverslip with cells was placed on a recording chamber mounted on the stage of an inverted microscope (Axiovert35, Zeiss, Germany) equipped with epifluorescence and photometry. Alternating excitation wavelengths of 340 and 380 nm were used, and background fluorescence was subtracted before obtaining the F340/F380 ratio. Experiments were performed at room temperature (22 1C). 2.9. Solutions, drugs and chemicals The composition of Hank’s solution (in mM) was: 125 NaCl, 5.36 KCl, 5 NaHCO3, 0.34 Na2HPO4, 0.44 KH2PO4, 10 glucose, 1.45 sucrose, and 10 Hepes, pH 7.4. The composition of PBS solution (in mM) was: 137 NaCl, 2.68 KCl, 4.02 Na2HPO4, 1.76 KH2PO4, pH 7.4. The composition of PSS solution (in mM) was: 140 NaCl, 5 KCl, 2.5 CaCl2, 1 MgCl2, 10 Hepes, 10 glucose, pH 7.4. The composition of Kreb’s solution (in mM) was: 119 NaCl, 4.7 KCl, 1.17 KH2HPO4, 24 NaHCO3, 2.5 CaCl2, 1.17 MgSO4, 5.5 glucose. The 70 K þ (70K) and 120 K þ (120K) solution were obtained by replacing 70 mM and 120 mM of NaCl with KCl. In nominally 0Ca2 þ solution CaCl2 was omitted ([Ca2 þ ]E7 mM) and the 0Ca2 þ solution was obtained by substituting Mg2 þ for Ca2 þ and with 1 mM EGTA added ([Ca2 þ ]i o100 nM). [Ca2 þ ] contained in these solutions was measured using a calcium ion activity electrode (Orion Calcium Electrode, Thermo, Electron Corp., USA). FPL64176 (2,5-Dimethyl-4-[2-(phenylmethyl)benzoyl]-1H-pyrrole-3-carboxylic acid methyl ester) was used as a VGCCs agonist. All drugs were purchased from Sigma-Aldrich, USA.

Valle-Rodrı´guez et al., 2003). Fig. 1A and C shows that high K þ solutions (35 K, 70 K), caused a gradual and marked membrane depolarization of isolated basilar arterial myocytes, as indicated by an increase in DiBAC4(3) fluorescence. However, the fluorescence emitted by the dye remained unchanged when myocytes were treated with FPL64176 (Fig. 1B and C). Therefore, FPL64176 application was used to study the functional role of CCICR without changing the membrane potential. Fig. 2A shows that, similar to high K þ solutions (see Ferna´ndez-Tenorio et al., 2011), repeated exposure to FPL64176 (0.5 mM) evoked arterial ring contractions which often had two components, an initial, rapid, phasic component (6.670.5 mN, n ¼9) and a second, slower, tonic component (7.671.0 mN, measured 5 min after the peak of the phasic contraction, n ¼9). The role of Ca2 þ uptake into intracellular stores on contraction was initially studied by bathing arterial rings with thapsigargin, a SR ATPase inhibitor (Thastrup et al., 1990) that selectively reduces the tonic component of the depolarization-evoked contraction (Ferna´ndez-Tenorio et al., 2011). The two components of the FPL64176-induced contraction showed distinct sensitivity to the inhibitor. Fig. 2B–D shows that thapsigargin selectively reduced the tonic component of the FPL64176-evoked contraction, with no significant effect on the phasic component. To evaluate the role of SR Ca2 þ release in the FPL64176-evoked contraction, arterial rings were bathed with a nominally Ca2 þ -free solution (Ca2 þ omitted from the extracellular medium, estimated [Ca2 þ ]e E 7 mM) (Ferna´ndezTenorio et al., 2011). In this situation, with no significant influx of Ca2 þ from the extracellular medium and without a significant activation of the calcium induced calcium release mechanism (Collier et al., 2000), FPL64176 (added at the same concentration, 0.5 mM) induced a powerful contraction (570.6 mN, n ¼24,

2.10. Statistical analysis Data are expressed as mean 7S.E.M. and the statistical significance was estimated using the Student’s t test. Values of Po0.05 were considered significant.

3. Results 3.1. FPL64176-evoked sustained arterial rings contraction requires G-protein mediated Ca2 þ release from the SR and RhoA/ROCK activation Although high K þ solutions are often used as a tool to activate VGCCs by depolarizing membrane potential, this solution can activate other signaling pathways (Ben-Chaim et al., 2006; Mahaut-Smith et al., 2008; Pitt et al., 2005; Ratz et al., 2005). In order to use an L-type Ca2 þ channel activator without effect on membrane potential, initial experiments were done to test the effect of FPL64176, a VGCCs agonist that activates CCICR (del

Fig. 1. Fluorescence emitted by isolated arterial myocytes loaded with DiBAC4(3), a potential-sensitive dye. (A) Fluorescence increase in response to KCl depolarization (35K and 70K). (B) Lack of fluorescence increase during FPL64176 treatment. Posterior exposure to 70K, elicited an increase in fluorescence. (C) Summary of gradual changes in fluorescence emitted by myocytes loaded with DiBAC4 (3) and treated with 35K and 70K, and lack of response in the presence of FPL64176. Values are represented as mean 7S.E.M., **P o0.01, n¼ 5.

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

91

Fig. 2. Effect of thapsigargin on the FPL64176-evoked contraction. (A) Isometric contraction of arterial rings induced by repeated FPL64176 (0.5 mM) expositions showing phasic and tonic components. (B) Thapsigargin (2 mM) selectively reduced the tonic component of the FPL64176-evoked contraction, leaving the phasic component unaffected. Effect of thapsigargin (relative to control conditions) on the phasic (C) and tonic (D) components of the FPL64176-induced arterial rings contraction. Values are represented as mean 7 S.E.M., **Po 0.01, n¼ 9.

measured 5 min after addition of FPL64176), which was significantly reduced in amplitude in a second exposure to the Ca2 þ channel agonist (Fig. 3A and B). This observation suggested that repeated exposure to FPL64176 in cells bathed in nominally 0Ca2 þ leads to progressive depletion of the intracellular Ca2 þ stores. FPL64176-evoked contraction returned to control levels once the intracellular stores were refilled bathing arterial rings in the presence of extracellular Ca2 þ (see Fig. 3A). Treating arterial rings with ryanodine, a Ca2 þ release modulator (Sutko et al., 1997), significantly reduced the FPL64176-evoked contraction (Fig. 3A and B). Caffeine-evoked contraction, that reflects Ca2 þ release from intracellular stores, was markedly reduced when arterial rings were bathed with ryanodine (2.470.5 mN, n ¼4 in 0Ca2 þ solution; 0.7770.3 mN n ¼11 in 0Ca2 þ þ ryanodine solution) (Fig. 3A). Similar inhibitory effects on FPL64176-evoked contractions were observed when ryanodine receptors activity and SR ATPase were blocked with the local anesthetic tetracaine and cyclopiazonic acid (CPA), respectively (Fig. 3C and D). These data indicate that similar to depolarization with high K þ (Ferna´ndez-Tenorio et al., 2011), FPL64176-elicited tonic arterial contraction required Ca2 þ release from the SR, possibly secondary to activation of the G protein-PLC pathway. Support for the notion that G-proteins participate in the maintenance of the FPL64176-induced contraction came from experiments on intact arteries whose myocytes had been reversibly permeabilized in the presence of GDPbS to inhibit G protein activation (del Valle-Rodrı´guez et al., 2003; Kobayashi et al., 1989). Initial control experiments suggested that this technique could be effective in our preparation, as 70 K, FPL64176 and caffeine were effective to induce contraction in rings from arteries reversibly permeabilized in the presence of Fura-2 pentapotassium salt, an impermeable fluorescence dye (Fig. 4A). Myocytes isolated from these arteries emitted fluorescence in response to excitation with a wavelength of 380 nm (Fig. 4B), which suggested that the permeabilization protocol was effective to

facilitate the loading of myocytes present in intact arteries. Although both components of FPL64176-evoked contraction were reduced in permeabilized arteries, the sustained component of the FPL64176-evoked arterial rings contraction was significantly reduced in the presence of GDPbS, whereas the mechanical signal induced by caffeine (a drug that directly elicits Ca2 þ release from the SR) was unaltered (Fig. 4C and D). As reported before, GDPbS treatment also reduced the sustained component of the 70Kevoked arterial rings contraction (Fig. 4C and D; Ferna´ndezTenorio et al., 2011). As in VSM a Ca2 þ sensitization mechanism mediated by the RhoA/ROCK pathway participates in the depolarization-evoked contraction (Ferna´ndez-Tenorio et al., 2011; Mita et al., 2002; Sakurada et al., 2003; Yanagisawa and Okada, 1994), we tested in immunostained isolated myocytes the redistribution of activated RhoA and its displacement towards the plasma membrane in response to FPL64176. Fig. 5 shows confocal immunofluorescent images of RhoA distribution in a single basilar smooth muscle cell at rest (A) and after stimulation with FPL64176 (B). The averaged peripheral/cytosolic (Fm/Fc) RhoA ratios for two central z sections in control conditions and when VGCCs were activated with FPL64176 are represented in Fig. 5C. The increase in the Fm/Fc ratio in myocytes treated with FPL64176 indicates that RhoA was translocated to the membrane (activated) in the presence of the VGCCs agonist. As ROCK is a RhoA downstream effector, we studied the effect of Y27632, a ROCK inhibitor (Uehata et al., 1997), on the mechanical responses of arterial rings to FPL64176. Fig. 5D shows the vasorelaxant effect of Y27632 ((R)-( þ)-trans-4(1-Aminoethyl)-N-(4-Pyridyl) cyclohexanecarboxamide dihydrochloride) on arterial rings precontracted with FPL64176. The potential involvement of the myosin light chain phosphatase (MLCP) in FPL64176-induced contraction was assessed in arterial rings treated with the MLCP inhibitor calyculin A. Calyculin A (100 nM) abolished the effect of Y27632 (Fig. 5D and E), suggesting that the vasorelaxant response to the ROCK inhibitor

92

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

Fig. 3. Role of sarcoplasmic reticulum Ca2 þ release on contractions elicited by FPL64176. (A) Effect of ryanodine (10 mM) on arterial ring contractions induced by repeated exposures to FPL64176 (0.5 mM) in a nominally Ca2 þ -free solution (CaCl2 was omitted from the extracellular medium). To facilitate SR refilling, arterial rings were bathed with an extracellular solution containing 2.5 mM Ca2 þ for 20 min (double slash). Caffeine (10 mM) was used to test the contraction evoked by Ca2 þ release from the SR. (B) Quantitative summary of the action of ryanodine on the FPL64176-evoked contractions (n ¼14). (C and D) FPL64176-elicited arterial contractions are significantly reduced in arterial rings bathed with CPA (10 mM, n¼4) and tetracaine (150 mM, n¼ 4) in a nominally Ca2 þ -free solution. Force, measured 5 min after stimulus application, is represented relative to the first response evoked by FPL64176. Values are represented as mean 7 S.E.M., *Po 0.05, **Po 0.01.

Fig. 4. Participation of G-proteins on FPL64176-evoked contractions. (A) 70K, FPL64176 and caffeine-evoked contractions in a permeabilized arterial ring in the absence of GDPbS. (B) Fluorescence emitted by isolated myocytes from permeabilized arterial rings treated with the Fura-2 pentapotassium salt. As this form of the dye cannot permeate through the intact myocyte membrane, this figure illustrates the efficiency of the permeabilization method. Scale bar ¼ 15 mm. (C) Effect of GDPbS (10 mM) on contractions induced by FPL64176 (0.5 mM) and caffeine (10 mM) in reversibly permeabilized arteries. (D) Quantitative summary of isometric force developed in response to the different stimulus (70K, FPL64176 and caffeine, n ¼11). Bathing arterial rings with GDPbS reduced the tonic component of the FPL64176 and 70K-induced contractions measured 10 min after the peak. Caffeine-evoked contraction was not reduced in GDPbS treated arteries. Values are presented as mean 7S.E.M., *P o 0.05.

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

93

Fig. 5. Cytosolic distribution of RhoA in isolated myocytes and effect of Y27632 on the FPL64176-induced contraction in control solution. (A) and (B) Confocal immunofluorescent images of RhoA distribution (RhoA, green; cell nucleus, red) in a single basilar smooth muscle cell at rest (A) and after stimulation with FPL64176 (0.5 mM) (B). Scale bars ¼ 7 mm. (C) Averaged peripheral:cytosolic (Fm/Fc) RhoA ratios for the central z-section in control and FPL64176 treated arteries (*Po 0.05, n¼3). (D and E) Effect of the ROCK inhibitor Y27632 (5 mM) on the FPL64176-evoked contraction. Calyculin A (100 nM), a MLCP inhibitor, abolished the effect of Y27632. Values are presented as mean 7S.E.M., **P o 0.01, n¼ 4.

requires a fully functional MLCP. Together, these results support the notion that, similar to KCl, FPL64176-evoked VGCCs activation and contraction is mediated by G-protein induced Ca2 þ release from the SR and the activation of the RhoA/ROCK sensitization pathway. 3.2. Depolarization-evoked tonic contractions require Ca2 þ influx through VGCCs and SR Ca2 þ uptake As previous results indicated that FPL64176 can activate the same signaling pathway that the KCl depolarizing solution (Ferna´ndez-Tenorio et al., 2011), we have measured arterial ring contraction in response to different levels of long-lasting depolarizations to determine the relationships between Ca2 þ influx through VGCCs and arterial contraction. We used 70K and 120K solutions which depolarized the resting potential of myocytes toE 22 mV andE  8 mV, respectively, since in these cells the membrane potential is mainly dependent on the K þ equilibrium potential. Depolarization with 70K triggered an isometric contraction that showed an initial fast, transient (phasic) component followed by a sustained (tonic) component, which was generated by a steady-state Ca2 þ influx (see Ferna´ndez-Tenorio et al., 2011) and maintained until the end of the stimulus (Fig. 6A and Supplementary Fig. 1). However, the tonic component of the 120K-evoked contraction slowly declined even in the presence of the depolarizing solution (Fig. 6B). Fig. 6C shows the quantitative analyses of isometric force when arterial rings were treated with both solutions. The 120K-evoked contraction presented a non-significant increase in the phasic and initial tonic components (3 min after stimulation). However, the 120K-induced tonic contraction significantly decreased when arterial rings were depolarized for a long time (60 min) (Fig. 6B and C). Since these results suggested an important role for Ca2 þ influx through VGCCs in the maintenance of the moderate depolarization-

Fig. 6. Voltage-dependence of arterial ring contraction. (A) Low level of depolarization (70K) generated an initial rapid contraction (phasic component) and a sustained tonic component that persisted while the stimulus was present. (B) A stronger depolarization (120K) evoked an initial contraction and a posterior component that clearly declined in the presence of the stimulus. (C) Averaged force during the phasic and tonic components during the 70K and 120K-evoked contractions. The tonic component was measured at 3 min and 60 min after the peak of contraction. Values are presented as mean 7 S.E.M., *Po 0.05, n ¼6.

evoked contraction, we performed pharmacological experiments to investigate whether the sustained contraction was affected by pharmacological agents that inhibit Ca2 þ influx from the extracellular

94

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

medium. Supplementary Fig. 2A and E shows that 0.5 mM Ni2þ , a non-specific cation channel blocker, relaxed arterial rings previously contracted with 70K. Similar vasorelaxant effect was observed when Ca2 þ influx was inhibited with 50 mM Cd2 þ or 0.2 mM nifedipine, antagonists of VGCCs and L-type Ca2 þ channels, respectively (Supplementary Fig. 2B, C, and E). As depolarization-evoked Ca2þ release could activate store-operated channels (SOCs), we treated precontracted arterial rings with diethylstilbestrol (DES) an inhibitor of these channels (Caldero´n-Sa´nchez et al., 2009). Supplementary Fig. 2D and E shows that DES (1 mM; IC50 E260 nM) did not significantly reduce the contraction induced by 70K, suggesting a minor role for these channels in the sustained component of the depolarization-evoked contraction. The role of Ca2þ influx through VGCCs on high K þ evoked contraction was also confirmed in reversibly permeabilized arteries treated with the Cav1.2 siRNA. These arteries showed a significant difference in Cav1.2 mRNA levels, as measured using qRT-PCR (Supplementary Fig. 3A). The amount of functional Ca2 þ channels were estimated by measuring the rise of cytosolic [Ca2þ ] (fluorescence ratio) induced by 70K in dispersed myocytes obtained from permeabilized arteries (Supplementary Fig. 3B). Cav1.2 siRNA treatment produced a significant reduction in the 70K-evoked Ca2 þ increase (Supplementary Fig. 3C). Consistent with these results, both phasic and tonic components of the 70K-induced contraction were significantly reduced in arterial rings treated with the Cav1.2 siRNA,

while the caffeine-evoked contraction was not significantly affected (Supplementary Fig. 3D–F). As caffeine induces intracellular Ca2þ release from ryanodine sensitive stores (Kobayashi et al., 1989), these results suggest that the reduction of the 70K-evoked contraction is not an unspecific effect of the experimental procedure. Altogether, these data confirm that Ca2þ influx through VGCCs is involved in both components of the depolarization-evoked contraction. To study whether Ca2 þ entering the cell during the sustained activation of VGCCs is stored into the SR before acting on the contractile machinery, intracellular Ca2 þ reservoirs were depleted by removing extracellular Ca2 þ for long periods (arterial rings were bathed in 0Ca2 þ plus 1 mM EGTA solution, estimated [Ca2 þ ]o 100 nM). Under these conditions, SR was passively emptied by leakage of Ca2 þ to the cytoplasm, and then to the extracellular medium. SR Ca2 þ depletion was tested with caffeine, to directly elicit Ca2 þ release from ryanodine sensitive SR stores. Caffeine (10 mM) response was absent after treating basilar arterial rings with this solution for 30 min (data not shown). The maintained contraction evoked by 70K, measured 10 min after stimulus application, was significantly reduced in arterial rings previously treated for 45 min in 0Ca2 þ plus EGTA. However, this treatment had no effect on the initial phasic component of contraction (Fig. 7A and C). As SERCA activity is necessary for Ca2 þ uptake to the SR, we facilitated SR depletion by adding CPA (cyclopiazonic acid), a SERCA inhibitor (Seidler et al., 1989), to the 0Ca2 þ plus EGTA solution. In the presence of CPA, the sustained component of the 70K-evoked contraction was markedly reduced, leaving unaffected the phasic component (Fig. 7B and C). The tonic component of the depolarization-evoked contraction was restored after SR refilling, once arterial rings were treated with an external solution containing 2.5 mM Ca2 þ . These results strengthen the idea that the sustained component of the depolarization-evoked contraction requires Ca2 þ influx through VGCCs from the extracellular medium, and Ca2 þ uptake and release from the SR (see Ferna´ndezTenorio et al., 2011).

4. Discussion

Fig. 7. Role of the SR on the 70K-evoked contraction in rat basilar arterial rings. (A and C) Isometric contractions in response to 70K in control solution (2.5 mM Ca2 þ ). The sustained component of the 70K-evoked contraction was selectively reduced after bathing arterial rings in a 0Ca þEGTA (1 mM) solution during 45 min, to deplete intracellular stores (double slash). (B and C) The vasorelaxing effect evoked by the 0Caþ EGTA solution was potentiated in the presence of CPA (10 mM). Note that the 70K-evoked contraction was restored by repeated exposures to 70K in control solution. Values are represented as mean 7 S.E.M., *Po 0.05, **Po 0.01, n¼ 10.

In this paper we show that, similar to membrane depolarization with KCl, application of FPL64176, an agonist that activates VGCCs without changing the membrane potential in VSM cells, can induce sustained arterial contractions mediated by G-protein activation, Ca2 þ release from the SR and RhoA/ROCK activation. Our results also suggest that the sustained contraction (induced either by FPL64176 or membrane depolarization) requires Ca2 þ influx through VGCCs to refill intracellular stores. High KCl is often used as a tool to activate VGCCs by changing the K þ equilibrium potential and clamping membrane potential above resting level. However, the effect of KCl can be questionable because this solution can stimulate various membrane proteins independently of changes in membrane potential. It is known that Na þ , K þ -ATPase activity (Beauge´ and Glynn, 1980) and liganddependent activation of P2Y receptors (Pitt et al., 2005) are regulated by membrane potential. It has also been shown that muscarinic receptors have intrinsic voltage dependence (Ben-Chaim et al., 2006; Liu et al., 2009), and that there are membrane voltage sensors which cause calcium release from intracellular stores mediated by G-protein/PLC/InsP3, independently of calcium influx (De Crescenzo et al., 2006; Ryglewski et al., 2007). Our results show that similar to KCl (Ferna´ndezTenorio et al., 2011), FPL64176, a VGCCs activator with no effect on membrane potential, can contract arterial rings by activating RhoA/ROCK through a metabotropic pathway. Several lines of evidence suggest that the FPL64176-evoked contraction is mediated by Ca2 þ channel-dependent metabotropic Ca2 þ release

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

from the SR (CCICR) and RhoA/ROCK activation: (a) FPL64176induced arterial ring contraction presents an initial and rapid (phasic) component followed by an almost sustained or tonic component. The latter component is reduced by SERCA and ryanodine receptor inhibitors, thus suggesting that SR Ca2 þ uptake and release participate in the maintenance of the FPL64176-evoked tonic contraction; (b) FPL64176-evoked arterial ring contraction is reduced in reversibly permeabilized arteries loaded with GDPbS, a G protein inhibitor, while caffeine-evoked contraction remains unaltered; (c) In immunostained isolated myocytes, activated RhoA is redistributed and translocated to the plasma membrane after FPL64176 treatment; (d) Pharmacological inhibition of ROCK (a downstream effector of RhoA) markedly inhibits the tonic phase of the FPL64176evoked arterial rings contraction. Altogether these data support the view that, similar to KCl (Ferna´ndez-Tenorio et al., 2011), the FPL64176-evoked sustained contraction requires, at least in part, G-protein mediated Ca2 þ release from the SR and RhoA/ROCK activation. As FPL64176 is a VGCCs agonist that potentiate CCICR (del Valle-Rodrı´guez et al., 2006), our results suggest that this mechanism play an important role in the maintenance of the depolarization-evoked contraction, minimizing the possible unspecific effects on vascular contraction of the depolarizationevoked by KCl solutions. Although in previous papers (Ferna´ndez-Tenorio et al., 2010,2011) we suggested that Ca2 þ influx through VGCCs was essential for the depolarization-evoked SR calcium release and arterial contraction, the role of depolarization level on arterial contraction was not tested. The results in this report show that long-lasting depolarizations of moderate amplitude (application of 70K external solution) can evoke prolonged and sustained arterial ring contraction. In contrast, isometric force markedly declines with time when myocytes or arterial rings were subjected to stronger depolarizations (application of 120K external solution). These results are in agreement with previous observations showing sustained rises in [Ca2 þ ]i in voltage-clamped myocytes stimulated with long depolarizations of small amplitude, while larger depolarizations elicited transient changes in [Ca2 þ ]i (Fleischmann et al., 1994). The role of Ca2 þ influx through VGCCs on the depolarization-evoked contraction has also been confirmed in reversibly permeabilized arteries treated with the Cav1.2 siRNA and in pharmacological experiments. In precontracted arterial rings a marked vasorelaxant effect was present when Ca2 þ influx was inhibited with Ni2 þ , Cd2 þ and nifedipine. These observations suggest that although VGCCs mainly become inactivated during sustained depolarizations, a small Ca2 þ influx through VGCCs can still be present. Steady-state currents through VGCCs (‘‘window currents’’) have been reported at moderately depolarized membrane potentials in cerebral artery smooth muscle cells (Langton and Standen, 1993; Rubart et al., 1996). In agreement with this hypothesis, we have described distinct inhibitory effects of nifedipine on the phasic and tonic components of the depolarization-evoked contraction, suggesting that the affinity of dihydropyridines for the VGCCs depends on the channel conformational state (Ferna´ndez-Tenorio et al., 2011). When the channel is open, the antagonist concentration needed to block is much higher than when the channel is in the inactivated state or switching between the open and inactivated states (Bean, 1984). In addition, as the SR ATPase inhibition with CPA selectively reduced the sustained component of the depolarization-evoked contraction, our results suggest that Ca2 þ entering through VGCCs during long depolarizations could be stored in the SR and, in turn, released by the CCICR mechanism. Therefore, it is possible that a residual transmembrane Ca2 þ influx, without effect on the contractile machinery per se, contributes to the refilling of the peripherally located SR, regions

95

where membranes of the plasmalemma and the superficial SR come close together (van Breemen et al., 1995). Accumulation of Ca2 þ in the SR would then allow the subsequent release of enough Ca2 þ to activate or sensitize the contractile apparatus.

5. Conclusion Our results indicate that depolarization or pharmacological VGCCs activation can evoke sustained arterial contraction through G-protein/SR release/RhoA/ROCK pathway. This mechanism requires continuous Ca2 þ influx through VGCCs to maintain Ca2 þ levels in the SR. As sustained VSM depolarization and VGCC activation mediate numerous pathophysiological processes, our data could help to optimize therapeutic treatment for clinical conditions where Ca2 þ channels antagonists are recommended (Abernethy and Schwartz, 1999).

Acknowledgments This work was supported by Grant PI060137 and Red RECAVA of the Spanish Ministry of Health, and by the ‘‘Proyecto de Excelencia (P08-CTS-03530)’’ of the ‘‘Consejerı´a de Innovacio´n y Ciencia de la Junta de Andalucı´a’’ and European Union. We also acknowledge the support of the Botin Foundation. Authors wish to thank Dr. Konstantin Levitsky (Instituto de Biomedicina de Sevilla) for technical help with confocal microscopy.

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ejphar.2012. 09.047.

References Abernethy, D.R., Schwartz, J.B., 1999. Calcium-antagonist drugs. N. Engl. J. Med. 341, 1447–1457. Araya, R., Liberona, J.L., Cardenas, J.C., Riveros, N., Estrada, M., Powell, J.A., Carasco, M.A., Jaimovich, E., 2003. Dihydropyridine receptors as voltage sensors for a depolarization-evoked, IP3R-mediated, slow calcium signal in skeletal muscle cells. J. Gen. Physiol. 121, 3–16. Bean, B.P., 1984. Nitrendipine block of cardiac calcium channels: high-affinity binding to the inactivated state. Proc. Natl. Acad. Sci. USA 81, 6388–6392. Beauge´, L.A., Glynn, I.M., 1980. The equilibrium between different conformations of the unphosphorylated sodium pump: effects of ATP and of potassium ions, and their relevance to potassium transport. J. Physiol. 299, 367–383. Ben-Chaim, Y., Chanda, B., Dascal, N., Bezanilla, F., Parnas, I., Parnas, H., 2006. Movement of ‘gating charge’ is coupled to ligand binding in a G-proteincoupled receptor. Nature 444, 106–109. Bolton, T.B., 1979. Mechanisms of action of transmitters and other substances on smooth muscle. Physiol. Rev. 59, 606–718. ˜ ez, A., Lo´pez-Barneo, J., Uren ˜ a, Caldero´n-Sa´nchez, E., Ferna´ndez-Tenorio, M., Ordo´n J., 2009. Hypoxia inhibits vasoconstriction induced by metabotropic Ca2 þ 2þ channel- induced Ca release in mammaliam coronary arteries. Cardiovasc. Res. 82, 115–124. Collier, M.L., Ji, G., Wang, Y., Kotlikoff, M.I., 2000. Calcium-induced calcium release in smooth muscle: loose coupling between the action potential and calcium release. J. Physiol. 115, 653–662. De Crescenzo, V., Fogarty, K.E., Zhuge, R., Tuft, R.A., Lifshitz, L.M., Carmichael, J., Bellve´, K.D., Baker, S.P., Zissimopoulos, S., Lai, F.A., Lemos, J.R., Walsh Jr., J.V., 2006. Dihydropyridine receptors and type 1 ryanodine receptors constitute the molecular machinery for voltage-induced Ca2 þ release in nerve terminals. J. Neurosci. 26, 7565–7574. ˜ a, J., 2003. Ca2 þ channeldel Valle-Rodrı´guez, A., Lo´pez-Barneo, J., Uren sarcoplasmic reticulum coupling: a mechanism of arterial myocyte contraction without Ca2 þ influx. EMBO J. 22, 4337–4345. ˜ ez, A., Lo´pez-Barneo, J., Uren ˜ a, del Valle-Rodrı´guez, A., Caldero´n, E., Ruiz, M., Ordo´n J., 2006. Metabotropic Ca2 þ channel-induced Ca2 þ release and ATP-dependent facilitation of arterial myocyte contraction. Proc. Natl. Acad. Sci. USA 103, 4316–4321.

96

´ndez-Tenorio et al. / European Journal of Pharmacology 697 (2012) 88–96 M. Ferna

Ferna´ndez-Tenorio, M., Gonza´lez-Rodrı´guez, P., Porras, C., Castellano, A., Moos˜ a, J., Lo´pez-Barneo, J., 2010. Genetic ablation of Lmang, S., Hofmann, F., Uren type Ca2 þ channels abolishes depolarization-induced Ca2 þ release in arterial smooth muscle. Circ. Res. 106, 1285–1289. Ferna´ndez-Tenorio, M., Porras-Gonza´lez, C., Castellano, A., del Valle-Rodrı´guez, A., ˜ a, J., 2011. Metabotropic regulation of RhoA/RhoLo´pez-Barneo, J., Uren associated kinase by L-type Ca2 þ channels: new mechanism for depolarization- evoked mammalian arterial contraction. Circ. Res. 108, 348–357. Fleischmann, B.K., Murray, R.K., Kotlikoff, M.I., 1994. Voltage-window for sustained elevation of cytosolic calcium in smooth muscle cells. Proc. Natl. Acad. Sci. USA 91, 11914–11918. Ganitkevich, V.Ya., Isenberg, G., 1993. Membrane potential modulates inositol 1,4,5- trisphosphate-mediated Ca2 þ transients in guinea-pig coronary myocytes. J. Physiol. 470, 35–44. Itoh, T., Seki, N., Suzuki, S., Ito, S., Kajikuri, J., Kuriyama, H., 1992. Membrane hyperpolarization inhibits agonist-induced synthesis of inositol 1,4,5-trisphosphate in rabbit mesentery artery. J. Physiol. 451, 307–328. Kobayashi, S., Kitazawa, T., Somlyo, A.V., Somlyo, A.P., 1989. Cytosolic heparin inhibits muscarinic and a-adrenergic Ca2 þ release in smooth muscle. J. Biol. Chem. 264, 1797–1804. Langton, P.D., Standen, N.B., 1993. Calcium currents elicited by voltages steps and steady voltages in myocytes isolated from the basilar artery. J. Physiol. 469, 535–548. Lesh, R.E., Somlyo, A.P., Owens, G.K., Somlyo, A.V., 1995. Reversible permeabilization. A novel technique for the intracellular introduction of antisense oligodeoxynucleotides into intact smooth muscle. Circ. Res. 77, 220–230. Liu, Q.H., Zheng, Y.M., Korde, A.S., Yadav, V.R., Rathore, R., Wess, J., Wang, Y.X., 2009. Membrane depolarization causes a direct activation of G proteincoupled receptors leading to local Ca2 þ release in smooth muscle. Proc. Natl. Acad. Sci. USA 106, 11418–11423. Mahaut-Smith, M.P., Hussain, J.F., Mason, M.J., 1999. Depolarization-evoked Ca2 þ release in a non-excitable cell, the rat megakaryocyte. J. Physiol. 515, 385–390. Mahaut-Smith, M.P., Martinez-Pinna, J., Gurung, I.S., 2008. A role for membrane potential in regulating GPCRs? Trends Pharmacol. Sci. 29, 421–429. Mita, M., Yanagihara, H., Hishinuma, S., Saito, M., Walsh, M.P., 2002. Membrane depolarization-induced contraction of rat caudal arterial smooth muscle involves Rho-associated kinase. Biochem. J. 364, 431–440. Pitt, S.J., Martinez-Pinna, J., Barnard, E.A., Mahaut-Smith, M.P., 2005. Potentiation of P2Y receptors by physiological elevations of extracellular K þ via a mechanism independent of Ca2 þ influx. Mol. Pharmacol. 67, 1705–1713.

Rampe, D., Lacerda, A.E., 1991. A new site for the activation of cardiac calcium channels defined by the nondihydropyridine FPL64176. J. Pharmacol. Exp. Ther. 259, 982–987. Ratz, P.H., Berg, K.M., Urban, N.H., Miner, A.S., 2005. Regulation of smooth muscle calcium sensitivity: KCl as a calcium-sensitizing stimulus. Am. J. Physiol. 288, C769–C783. Rubart, M., Patlak, J.B., Nelson, M.T., 1996. Ca2 þ currents in cerebral artery smooth muscle cells of rat at physiological Ca2 þ concentrations. J. Gen. Physiol. 107, 459–472. Ryglewski, S., Pflueger, H.J., Duch, C., 2007. Expanding the neuron’s calcium signaling repertoire: intracellular calcium release via voltage-induced PLC and IP3R activation. PLoS Biol. 5, e66. Sakurada, S., Takuwa, N., Sugimoto, N., Wang, Y., Seto, M., Sasaki, Y., Takuwa, Y., 2003. Ca2 þ -dependent activation of Rho and Rho-kinase in membrane depolarization induced and receptor stimulation-induced vascular smooth muscle contraction. Circ. Res. 93, 548–556. Seidler, N.W., Jona, I., Vegh, M., Martonosi, A., 1989. Cyclopiazonic acid is a specific inhibitor of the Ca2 þ -ATPase of sarcoplasmic reticulum. J. Biol. Chem. 264, 17816–17823. Sutko, J.L., Airey, J.A., Welch, W., Ruest, L., 1997. The pharmacology of ryanodine and related compounds. Pharmacol. Rev. 49, 53–98. Thastrup, O., Cullen, P.J., Drobak, B.K., Hanley, M.R., Dawson, A.P., 1990. Thapsigargin, a tumor promoter, discharges intracellular Ca2 þ stores by specific inhibition of the endoplasmic reticulum Ca2 þ -ATPase. Proc. Natl. Acad. Sci. USA 87, 2466–2470. Uehata, M., Ishizaki, T., Satoh, H., Ono, T., Kawahara, T., Morishita, H., Tamakawa, H., Yamagami, K., Inui, J., Maekawa, M., Narumiya, S., 1997. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389, 990–994. ˜ a, J., del Valle-Rodrı´guez, A., Lo´pez-Barneo, J., 2007. Metabotropic Ca2 þ Uren channel-induced calcium release in vascular smooth muscle. Cell Calcium 42, 513–520. van Breemen, C., Chen, Q., Laher, I., 1995. Superficial buffer barrier function of smooth muscle sarcoplasmic reticulum. Trends Pharmacol. Sci. 16, 98–105. Yanagisawa, T., Okada, Y., 1994. KCl depolarization increases Ca2 þ sensitivity of contractile elements in coronary arterial smooth muscle. Am. J. Physiol. 267, H614–H621.