- Email: [email protected]
Touchdown digital polymerase chain reaction for quantification of highly conserved sequences in the HIV-1 genome
Analytical Biochemistry 439 (2013) 201–203
Contents lists available at SciVerse ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Touchdown digital polymerase chain reaction for quantification of highly conserved sequences in the HIV-1 genome Ward De Spiegelaere a,b,⇑, Eva Malatinkova a, Maja Kiselinova a, Pawel Bonczkowski a, Chris Verhofstede c, Dirk Vogelaers a,b, Linos Vandekerckhove a,b,c a b c
Department of Internal Medicine, Faculty of Medicine and Health Sciences, Ghent University, 9000 Ghent, Belgium HIV Translational Research Unit, Department of General Internal Medicine, Ghent University Hospital, 9000 Ghent, Belgium AIDS Reference Laboratory, Department of Clinical Chemistry, Microbiology, and Immunology, Ghent University, 9000 Ghent, Belgium
a r t i c l e
i n f o
Article history: Received 18 February 2013 Received in revised form 22 April 2013 Accepted 23 April 2013 Available online 7 May 2013 Keywords: HIV-1 Digital PCR Total HIV DNA Touchdown PCR
a b s t r a c t Digital polymerase chain reaction (PCR) is an emerging absolute quantification method based on the limiting dilution principle and end-point PCR. This methodology provides high flexibility in assay design without influencing quantitative accuracy. This article describes an assay to quantify HIV DNA that targets a highly conserved region of the HIV-1 genome that hampers optimal probe design. To maintain high specificity and allow probe binding and hydrolysis of a probe with low melting temperature, a two-stage touchdown PCR was designed with a first round of amplification at high temperature and a subsequent round at low temperature to allow accumulation of fluorescence. Ó 2013 Elsevier Inc. All rights reserved.
Digital polymerase chain reaction (PCR)1 is emerging as a novel tool for PCR-based absolute quantification. During digital PCR, binary data are obtained by performing limiting dilution end-point PCR in multiple replicate reactions that are assigned positive or negative (hence digital). Subsequently, absolute quantification is performed by using Poisson statistics on the binary data [1]. Digital PCR was already proposed during the 1990s to enable absolute quantification without requiring a standard curve and with minor influence of poor reaction efficiency on quantitative power [2]. This improves quantitative accuracy, especially in samples with low abundant target where the use of real-time PCR may result in high technical variability [3,4]. Despite these advantages, digital PCR remained cumbersome due to the laborious procedures and high reagent costs to produce sufficient replicate reactions. Recent technological advances, including microfluidic generation of droplet in oil suspensions, now permit assessment of thousands of picoliter-scale PCRs without extensive procedures and at reasonable costs [4,5]. So far, classical real-time quantitative PCR (qPCR) has remained the optimal tool for quantification of DNA. However, PCR quantification is hampered by inherent limitations because it is based on ⇑ Corresponding author. Address: Department of Internal Medicine, Faculty of Medicine and Health Sciences, Ghent University, De Pintelaan 185, 9000 Ghent, Belgium. E-mail address: [email protected] (W. De Spiegelaere). 1 Abbreviations used: PCR, polymerase chain reaction; qPCR, quantitative PCR; ddPCR, droplet digital PCR; PBMC, peripheral blood mononuclear cell. 0003-2697/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ab.2013.04.024
relative quantification [6]. Quantitative data are plotted on a standard curve to deduce absolute quantities. Consequently, differences in amplification efficiencies may introduce bias in qPCR data, hampering absolute quantification [7–9]. This is especially true for samples with low numbers of target DNA because technical variation increases with more amplification cycles and a higher number of cycles is required to reach the cycle of quantification for these samples [3]. Digital PCR is now being explored in numerous applications, including cancer screening [10] and screening of occult viruses and bacteria [11,12]. In HIV research, digital PCR may well become an important technique because HIV DNA in patients on antiretroviral treatment is detectable but not easily quantifiable with qPCR due to decreased accuracy at the lower limit of detection [3,13]. Digital PCR application narrows the gap between the limit of detection and the limit of quantification, allowing more accurate monitoring of low levels of viral RNA and DNA. The end-point assessment of digital PCR strategies provides extra flexibility for assay design, permitting users to enjoy the high flexibility of classical end-point PCR without losing quantitative accuracy. This will enhance assay design for difficult targets and provide novel opportunities for PCR-based quantification. One of the major issues in HIV diagnostics is the high variability encountered in the HIV genome both within and between patients. This hampers the development of assays that cover most known HIV variants. Recently, van der Sluis and coworkers developed a sequence-specific primer and probe combination designed in a
202
Notes & Tips / Anal. Biochem. 439 (2013) 201–203
highly conserved region of all known HIV-1 variants as recorded by the HIV sequence database (http://www.hiv.lanl.gov) [14]. Because only a limited sequence could be targeted to design the assay, the validated probe is characterized by a low melting temperature, hampering hydrolysis of the probe at stringent PCR conditions. To resolve this issue, a minor groove binder was added by the authors to increase the melting temperature [14]. Yet, these modifications are expensive. In the current study, we investigated the use of a touchdown droplet digital PCR (ddPCR) strategy using the QX100 Droplet Digital PCR platform (Bio-Rad) to maintain the high specificity of the PCR without the necessity of using a modified probe. A touchdown strategy cannot be easily implemented in qPCR because it affects reaction efficiency and will introduce experimental bias. However, in digital PCR, touchdown strategies can be considered because small changes in efficiency will not hamper quantitative accuracy. Initially, the HIV-1-specific primers and probes were tested on plasmids containing the HIV-1 NL4-3 sequence by a gradient ddPCR with different annealing temperatures (Ta). PCR mix was made by adding 1 ll of HIV-1 NL4-3 plasmids to a 2 ddPCR Supermix (Bio-Rad) for probes with 200 nM of primers and probes (HIVPf, forward: GCCTCAATAAAGCTTGCCTTGA; HIVPr, reverse: GGGCGCCACTGCTAGAGAT; HIVPpr, probe: 50 -FAM-GTA[a/t/ g]CTAGAGATCCCTCAGA [14]). All probes were quenched with double quenchers, that is, a 30 Iowa Black dark quencher (IBFQ) com-
Fig.1. Dot plots of the fluorescence intensity of droplets (individual reactions) of a ddPCR. (A) Gradient ddPCR results of the total HIV primers. At 54.5 °C, the reaction is positive, but positive droplets are not well discernible from the negative population. (B) Comparison of different two-step touchdown reactions: (1) 30 58 °C + 6 53 °C; (2) 33 58 °C + 6 50 °C; (3) 24 58 °C + 15 50 °C; (4) 30 58 °C + 9 50 °C. Optimal fluorescent signal and discrimination of positive droplets was obtained using the 30 + 9 cycle setup (4).
bined with an internal ZEN quencher (Integrated DNA Technologies). Droplets were generated in the droplet generator, and PCR was performed in a T100 thermal cycler (Bio-Rad). PCR amplification reactions consisted of an initial denaturation at 95 °C for 5 min, 39 cycles of 15 s denaturation at 95 °C, and 1 min of annealing/elongation at the annealing temperature (Ta = 60–54 °C). After PCR, readout of droplet fluorescence was performed with the droplet reader and analyzed with the QuantaSoft software (version 1.2.3.0, Bio-Rad). Gradient ddPCR revealed lowlevel amplification of plasmid DNA at an annealing temperature lower than 55 °C (Fig. 1A). Assessment of positive versus negative droplets was hindered by the unclear distinction of positive droplets from the negative population. In addition, the amount of positive reactions was too low compared with a total HIV DNA assay on ddPCR with primers specific for the HIV-1 NL4-3 strain that are designed in a less conserved region for in vivo use on all HIV-1 variants (LTR forward: AGCTTGCCTTGAGTGCTTCAA; LTR reverse: TGACTAAAAGGGTCTGAGGGATCT; LTR probe: 50 -FAM-TTACCAGAGTCACACAACAGACGGGCA) (data not shown). We hypothesized that the low background-to-noise signal obtained during standard ddPCR conditions was due to the low melting temperature of the HIVPpr probe. A lower annealing temperature allows probe binding and hydrolysis, but nonspecific amplification is likely to occur. Consequently, a two-stage touchdown ddPCR was optimized, including a first round of amplification at stringent Ta (58 °C, optimal annealing for the primer pair) and a second amplification at 50 °C. The stringent conditions prevent nonspecific amplification, whereas the second round allows accumulation of fluorescent signal. Different cycle numbers for both PCR amplifications were tested to maximize the fluorescent signal of positive reactions while maintaining a high number of PCR cycles at stringent conditions to maintain specificity. This comparison indicated that a strategy with 30 cycles at 58 °C combined with 9 cycles at 50 °C resulted in an optimal differentiation of positive versus negative droplets in the ddPCR (Fig. 1B). In addition, quantitative output of the PCRs with the touchdown ddPCR procedure and the HIV-1-specific assay resulted in a similar number of HIV genomes compared with the HIV NL4-3-specific assay as observed by comparing a 2-fold standard dilution series of experimentally infected cells evaluated by both assays (Pearson product moment correlation = 0.994) (Fig. 2A). To assess whether this assay works on patient-derived material, DNA was isolated from 16 HIV-infected patients, of which 8 were therapy naive viremic and elite controllers and 8 were HIV progressors on antiretroviral therapy as described previously [15]. Total DNA was isolated from peripheral blood mononuclear cells (PBMCs) using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma–Aldrich). The DNA was restricted for 2 h by EcoRI digestion (Promega) using 1 lg of DNA per 20-ll reaction. The restriction digest was used directly on ddPCR to avoid loss of small restricted DNA fragments. ddPCR was performed according to the optimal touchdown protocol, and an assay for the RPP30 gene was used to normalize for the amount of cellular input material (forward: AGATTTGGACCTGCGAGCG; reverse: GAGCGGCTGTCTCC ACAAGT; probe: 50 -HEX-TTCTGACCTGAAGGCTCTGCGCG). Two patients, one elite controller and one progressor on therapy, were omitted from the study because of low RPP30 levels due to suboptimal DNA isolation. The data revealed that HIV-1 DNA can be measured effectively by the touchdown ddPCR strategy (Fig. 2B). The current report provides proof of concept that a ddPCR strategy permits high flexibility in assay optimization without hampering assay robustness. Touchdown qPCR has been described for quantification of difficult targets, but these assays are based on a gradual temperature decline limited to the first 7 to 11 cycles of the PCR [16,17]. This affects reaction efficiency, hindering absolute quantification and increasing variation toward the lower limit of
Notes & Tips / Anal. Biochem. 439 (2013) 201–203
203
limiting the design of alternative assays such as allele-specific PCR, methylation-specific PCR, intron-spanning primers/probes, and assays targeting small but highly conserved regions. Acknowledgments The authors acknowledge Karen Vervisch for technical assistance. L.V. was supported by the Research Foundation–Flanders (FWO) (Grant 1.8.020.09.N.00). E.M. and P.B. were supported by the Agency for Innovation by Science and Technology in Flanders (IWT) (Grants 111286 and 111393). References
Fig.2. (A) Comparison of twofold dilution series of infected cells assessed with both ddPCR assays, showing good correlation and linearity in both curves (adjusted R2 values = 0.989 for the HIV-1 assay and 0.999 for the NL4-3 assay). (B) Comparison of HIV progressing patients on antiretroviral therapy (ART) versus therapy naive elite controllers (EC) and viremic controllers (VC). No statistically significant difference was found among these patient groups.
detection. With end-point ddPCR, a two-stage touchdown PCR can be performed, maintaining high specificity in the first 30 cycles. This strategy would not be possible on a qPCR platform because the abrupt accumulation of fluorescence in the 31st cycle would hamper quantification based on cycle of quantification determination. Theoretically, digital PCR can quantify down to one copy of DNA in a sample. Yet, a so-called ‘‘rain’’ of droplets with an intermediate fluorescent signal between positive and negative droplets may hamper unambiguous single-copy detection. Mathematical models to define the threshold have been described [18]. However, false positives that cannot be assigned to the rain have also been observed by multiple authors [1,18]. These data indicate that high numbers of negative control samples should be used to allow unambiguous determination of low-level copy numbers in samples. Because digital PCR is becoming widely available, the full potential of this technique is only now being explored. The current investigation reveals that the independence of variation in reaction efficiency on the quantitative power enables high flexibility in assay design and optimization. A highly specific PCR can be combined with accurate quantification. This allows a flexible assay design for primers and probes when specific genomic regions are
[1] B.J. Hindson, K.D. Ness, D.A. Masquelier, P. Belgrader, N.J. Heredia, A.J. Makarewicz, I.J. Bright, M.Y. Lucero, A.L. Hiddessen, T.C. Legler, T.K. Kitano, M.R. Hodel, J.F. Petersen, P.W. Wyatt, E.R. Steenblock, P.H. Shah, L.J. Bousse, C.B. Troup, J.C. Mellen, D.K. Wittmann, N.G. Erndt, T.H. Cauley, R.T. Koehler, A.P. So, S. Dube, K.A. Rose, L. Montesclaros, S.L. Wang, D.P. Stumbo, S.P. Hodges, S. Romine, F.P. Milanovich, H.E. White, J.F. Regan, G.A. Karlin-Neumann, C.M. Hindson, S. Saxonov, B.W. Colston, High-throughput droplet digital PCR system for absolute quantitation of DNA copy number, Anal. Chem. 83 (2011) 8604– 8610. [2] V. Taly, D. Pekin, A. El Abed, P. Laurent-Puig, Detecting biomarkers with microdroplet technology, Trends Mol. Med. 18 (2012) 405–416. [3] V. Bernardo, L.F. Ribeiro Pinto, R.M. Albano, Gene expression analysis by realtime PCR: experimental demonstration of PCR detection limits, Anal. Biochem. 432 (2013) 131–133. [4] L.B. Pinheiro, V.A. Coleman, C.M. Hindson, J. Herrmann, B.J. Hindson, S. Bhat, K.R. Emslie, Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification, Anal. Chem. 84 (2012) 1003– 1011. [5] Q. Zhong, S. Bhattacharya, S. Kotsopoulos, J. Olson, V. Taly, A.D. Griffiths, D.R. Link, J.W. Larson, Multiplex digital PCR: breaking the one target per color barrier of quantitative PCR, Lab Chip 11 (2011) 2167–2174. [6] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE guidelines: minimum information for publication of quantitative realtime PCR experiments, Clin. Chem. 55 (2009) 611–622. [7] C.H. Lin, Y.C. Chen, T.M. Pan, Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay, PLoS One 6 (2011) e29101. [8] W. De Spiegelaere, P. Cornillie, M. Van Poucke, L. Peelman, C. Burvenich, W. Van den Broeck, Quantitative mRNA expression analysis in kidney glomeruli using microdissection techniques, Histol. Histopathol. 26 (2011) 267–275. [9] W. De Spiegelaere, T. Erkens, J. De Craene, C. Burvenich, L. Peelman, W. Van den Broeck, Elimination of amplification artifacts in real-time reverse transcription PCR using laser capture microdissected samples, Anal. Biochem. 382 (2008) 72–74. [10] D. Pekin, Y. Skhiri, J.C. Baret, D. Le Corre, L. Mazutis, C.B. Salem, F. Millot, A. El Harrak, J.B. Hutchison, J.W. Larson, D.R. Link, P. Laurent-Puig, A.D. Griffiths, V. Taly, Quantitative and sensitive detection of rare mutations using dropletbased microfluidics, Lab Chip 11 (2011) 2156–2166. [11] T.J. Henrich, S. Gallien, J.Z. Li, F. Pereyra, D.R. Kuritzkes, Low-level detection and quantitation of cellular HIV-1 DNA and 2-LTR circles using droplet digital PCR, J. Virol. Methods 186 (2012) 68–72. [12] R.A. White, S.R. Quake, K. Curr, Digital PCR provides absolute quantitation of viral load for an occult RNA virus, J. Virol. Methods 179 (2012) 45–50. [13] M.C. Strain, D.D. Richman, New assays for monitoring residual HIV burden in effectively treated individuals, Curr. Opin. HIV AIDS 8 (2013) 106–110. [14] R.M. van der Sluis, T. van Montfort, M. Centlivre, N.C. Schopman, M. Cornelissen, R.W. Sanders, B. Berkhout, R.E. Jeeninga, W.A. Paxton, G. Pollakis, Quantitation of HIV-1 DNA with a sensitive Taqman assay that has broad subtype specificity, J. Virol. Methods 187 (2013) 94–102. [15] P. Messiaen, W. De Spiegelaere, J. Alcami, K. Vervisch, P. Van Acker, B. Verhasselt, P. Meuwissen, E. Calonge, N. Gonzalez, F. Gutierrez-Rodero, C. Rodriguez-Martin, E. Sermijn, B. Poppe, D. Vogelaers, C. Verhofstede, L. Vandekerckhove, Characterization of LEDGF/p75 genetic variants and association with HIV-1 disease progression, PLoS One 7 (2012) e50204. [16] H.H. Larsen, H. Masur, J.A. Kovacs, V.J. Gill, V.A. Silcott, P. Kogulan, J. Maenza, M. Smith, D.R. Lucey, S.H. Fischer, Development and evaluation of a quantitative, touch-down, real-time PCR assay for diagnosing Pneumocystis carinii pneumonia, J. Clin. Microbiol. 40 (2002) 490–494. [17] K. Kesanopoulos, G. Tzanakaki, S. Levidiotou, C. Blackwell, J. Kremastinou, Evaluation of touch-down real-time PCR based on SYBR Green I fluorescent dye for the detection of Neisseria meningitidis in clinical samples, FEMS Immunol. Med. Microbiol. 43 (2005) 419–424. [18] M.C. Strain, S.M. Lada, T. Luong, S.E. Rought, S. Gianella, V.H. Terry, C.A. Spina, C.H. Woelk, D.D. Richman, Highly precise measurement of HIV DNA by droplet digital PCR, PLoS One 8 (2013) e55943.
Contents lists available at SciVerse ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Touchdown digital polymerase chain reaction for quantification of highly conserved sequences in the HIV-1 genome Ward De Spiegelaere a,b,⇑, Eva Malatinkova a, Maja Kiselinova a, Pawel Bonczkowski a, Chris Verhofstede c, Dirk Vogelaers a,b, Linos Vandekerckhove a,b,c a b c
Department of Internal Medicine, Faculty of Medicine and Health Sciences, Ghent University, 9000 Ghent, Belgium HIV Translational Research Unit, Department of General Internal Medicine, Ghent University Hospital, 9000 Ghent, Belgium AIDS Reference Laboratory, Department of Clinical Chemistry, Microbiology, and Immunology, Ghent University, 9000 Ghent, Belgium
a r t i c l e
i n f o
Article history: Received 18 February 2013 Received in revised form 22 April 2013 Accepted 23 April 2013 Available online 7 May 2013 Keywords: HIV-1 Digital PCR Total HIV DNA Touchdown PCR
a b s t r a c t Digital polymerase chain reaction (PCR) is an emerging absolute quantification method based on the limiting dilution principle and end-point PCR. This methodology provides high flexibility in assay design without influencing quantitative accuracy. This article describes an assay to quantify HIV DNA that targets a highly conserved region of the HIV-1 genome that hampers optimal probe design. To maintain high specificity and allow probe binding and hydrolysis of a probe with low melting temperature, a two-stage touchdown PCR was designed with a first round of amplification at high temperature and a subsequent round at low temperature to allow accumulation of fluorescence. Ó 2013 Elsevier Inc. All rights reserved.
Digital polymerase chain reaction (PCR)1 is emerging as a novel tool for PCR-based absolute quantification. During digital PCR, binary data are obtained by performing limiting dilution end-point PCR in multiple replicate reactions that are assigned positive or negative (hence digital). Subsequently, absolute quantification is performed by using Poisson statistics on the binary data [1]. Digital PCR was already proposed during the 1990s to enable absolute quantification without requiring a standard curve and with minor influence of poor reaction efficiency on quantitative power [2]. This improves quantitative accuracy, especially in samples with low abundant target where the use of real-time PCR may result in high technical variability [3,4]. Despite these advantages, digital PCR remained cumbersome due to the laborious procedures and high reagent costs to produce sufficient replicate reactions. Recent technological advances, including microfluidic generation of droplet in oil suspensions, now permit assessment of thousands of picoliter-scale PCRs without extensive procedures and at reasonable costs [4,5]. So far, classical real-time quantitative PCR (qPCR) has remained the optimal tool for quantification of DNA. However, PCR quantification is hampered by inherent limitations because it is based on ⇑ Corresponding author. Address: Department of Internal Medicine, Faculty of Medicine and Health Sciences, Ghent University, De Pintelaan 185, 9000 Ghent, Belgium. E-mail address: [email protected] (W. De Spiegelaere). 1 Abbreviations used: PCR, polymerase chain reaction; qPCR, quantitative PCR; ddPCR, droplet digital PCR; PBMC, peripheral blood mononuclear cell. 0003-2697/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ab.2013.04.024
relative quantification [6]. Quantitative data are plotted on a standard curve to deduce absolute quantities. Consequently, differences in amplification efficiencies may introduce bias in qPCR data, hampering absolute quantification [7–9]. This is especially true for samples with low numbers of target DNA because technical variation increases with more amplification cycles and a higher number of cycles is required to reach the cycle of quantification for these samples [3]. Digital PCR is now being explored in numerous applications, including cancer screening [10] and screening of occult viruses and bacteria [11,12]. In HIV research, digital PCR may well become an important technique because HIV DNA in patients on antiretroviral treatment is detectable but not easily quantifiable with qPCR due to decreased accuracy at the lower limit of detection [3,13]. Digital PCR application narrows the gap between the limit of detection and the limit of quantification, allowing more accurate monitoring of low levels of viral RNA and DNA. The end-point assessment of digital PCR strategies provides extra flexibility for assay design, permitting users to enjoy the high flexibility of classical end-point PCR without losing quantitative accuracy. This will enhance assay design for difficult targets and provide novel opportunities for PCR-based quantification. One of the major issues in HIV diagnostics is the high variability encountered in the HIV genome both within and between patients. This hampers the development of assays that cover most known HIV variants. Recently, van der Sluis and coworkers developed a sequence-specific primer and probe combination designed in a
202
Notes & Tips / Anal. Biochem. 439 (2013) 201–203
highly conserved region of all known HIV-1 variants as recorded by the HIV sequence database (http://www.hiv.lanl.gov) [14]. Because only a limited sequence could be targeted to design the assay, the validated probe is characterized by a low melting temperature, hampering hydrolysis of the probe at stringent PCR conditions. To resolve this issue, a minor groove binder was added by the authors to increase the melting temperature [14]. Yet, these modifications are expensive. In the current study, we investigated the use of a touchdown droplet digital PCR (ddPCR) strategy using the QX100 Droplet Digital PCR platform (Bio-Rad) to maintain the high specificity of the PCR without the necessity of using a modified probe. A touchdown strategy cannot be easily implemented in qPCR because it affects reaction efficiency and will introduce experimental bias. However, in digital PCR, touchdown strategies can be considered because small changes in efficiency will not hamper quantitative accuracy. Initially, the HIV-1-specific primers and probes were tested on plasmids containing the HIV-1 NL4-3 sequence by a gradient ddPCR with different annealing temperatures (Ta). PCR mix was made by adding 1 ll of HIV-1 NL4-3 plasmids to a 2 ddPCR Supermix (Bio-Rad) for probes with 200 nM of primers and probes (HIVPf, forward: GCCTCAATAAAGCTTGCCTTGA; HIVPr, reverse: GGGCGCCACTGCTAGAGAT; HIVPpr, probe: 50 -FAM-GTA[a/t/ g]CTAGAGATCCCTCAGA [14]). All probes were quenched with double quenchers, that is, a 30 Iowa Black dark quencher (IBFQ) com-
Fig.1. Dot plots of the fluorescence intensity of droplets (individual reactions) of a ddPCR. (A) Gradient ddPCR results of the total HIV primers. At 54.5 °C, the reaction is positive, but positive droplets are not well discernible from the negative population. (B) Comparison of different two-step touchdown reactions: (1) 30 58 °C + 6 53 °C; (2) 33 58 °C + 6 50 °C; (3) 24 58 °C + 15 50 °C; (4) 30 58 °C + 9 50 °C. Optimal fluorescent signal and discrimination of positive droplets was obtained using the 30 + 9 cycle setup (4).
bined with an internal ZEN quencher (Integrated DNA Technologies). Droplets were generated in the droplet generator, and PCR was performed in a T100 thermal cycler (Bio-Rad). PCR amplification reactions consisted of an initial denaturation at 95 °C for 5 min, 39 cycles of 15 s denaturation at 95 °C, and 1 min of annealing/elongation at the annealing temperature (Ta = 60–54 °C). After PCR, readout of droplet fluorescence was performed with the droplet reader and analyzed with the QuantaSoft software (version 1.2.3.0, Bio-Rad). Gradient ddPCR revealed lowlevel amplification of plasmid DNA at an annealing temperature lower than 55 °C (Fig. 1A). Assessment of positive versus negative droplets was hindered by the unclear distinction of positive droplets from the negative population. In addition, the amount of positive reactions was too low compared with a total HIV DNA assay on ddPCR with primers specific for the HIV-1 NL4-3 strain that are designed in a less conserved region for in vivo use on all HIV-1 variants (LTR forward: AGCTTGCCTTGAGTGCTTCAA; LTR reverse: TGACTAAAAGGGTCTGAGGGATCT; LTR probe: 50 -FAM-TTACCAGAGTCACACAACAGACGGGCA) (data not shown). We hypothesized that the low background-to-noise signal obtained during standard ddPCR conditions was due to the low melting temperature of the HIVPpr probe. A lower annealing temperature allows probe binding and hydrolysis, but nonspecific amplification is likely to occur. Consequently, a two-stage touchdown ddPCR was optimized, including a first round of amplification at stringent Ta (58 °C, optimal annealing for the primer pair) and a second amplification at 50 °C. The stringent conditions prevent nonspecific amplification, whereas the second round allows accumulation of fluorescent signal. Different cycle numbers for both PCR amplifications were tested to maximize the fluorescent signal of positive reactions while maintaining a high number of PCR cycles at stringent conditions to maintain specificity. This comparison indicated that a strategy with 30 cycles at 58 °C combined with 9 cycles at 50 °C resulted in an optimal differentiation of positive versus negative droplets in the ddPCR (Fig. 1B). In addition, quantitative output of the PCRs with the touchdown ddPCR procedure and the HIV-1-specific assay resulted in a similar number of HIV genomes compared with the HIV NL4-3-specific assay as observed by comparing a 2-fold standard dilution series of experimentally infected cells evaluated by both assays (Pearson product moment correlation = 0.994) (Fig. 2A). To assess whether this assay works on patient-derived material, DNA was isolated from 16 HIV-infected patients, of which 8 were therapy naive viremic and elite controllers and 8 were HIV progressors on antiretroviral therapy as described previously [15]. Total DNA was isolated from peripheral blood mononuclear cells (PBMCs) using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma–Aldrich). The DNA was restricted for 2 h by EcoRI digestion (Promega) using 1 lg of DNA per 20-ll reaction. The restriction digest was used directly on ddPCR to avoid loss of small restricted DNA fragments. ddPCR was performed according to the optimal touchdown protocol, and an assay for the RPP30 gene was used to normalize for the amount of cellular input material (forward: AGATTTGGACCTGCGAGCG; reverse: GAGCGGCTGTCTCC ACAAGT; probe: 50 -HEX-TTCTGACCTGAAGGCTCTGCGCG). Two patients, one elite controller and one progressor on therapy, were omitted from the study because of low RPP30 levels due to suboptimal DNA isolation. The data revealed that HIV-1 DNA can be measured effectively by the touchdown ddPCR strategy (Fig. 2B). The current report provides proof of concept that a ddPCR strategy permits high flexibility in assay optimization without hampering assay robustness. Touchdown qPCR has been described for quantification of difficult targets, but these assays are based on a gradual temperature decline limited to the first 7 to 11 cycles of the PCR [16,17]. This affects reaction efficiency, hindering absolute quantification and increasing variation toward the lower limit of
Notes & Tips / Anal. Biochem. 439 (2013) 201–203
203
limiting the design of alternative assays such as allele-specific PCR, methylation-specific PCR, intron-spanning primers/probes, and assays targeting small but highly conserved regions. Acknowledgments The authors acknowledge Karen Vervisch for technical assistance. L.V. was supported by the Research Foundation–Flanders (FWO) (Grant 1.8.020.09.N.00). E.M. and P.B. were supported by the Agency for Innovation by Science and Technology in Flanders (IWT) (Grants 111286 and 111393). References
Fig.2. (A) Comparison of twofold dilution series of infected cells assessed with both ddPCR assays, showing good correlation and linearity in both curves (adjusted R2 values = 0.989 for the HIV-1 assay and 0.999 for the NL4-3 assay). (B) Comparison of HIV progressing patients on antiretroviral therapy (ART) versus therapy naive elite controllers (EC) and viremic controllers (VC). No statistically significant difference was found among these patient groups.
detection. With end-point ddPCR, a two-stage touchdown PCR can be performed, maintaining high specificity in the first 30 cycles. This strategy would not be possible on a qPCR platform because the abrupt accumulation of fluorescence in the 31st cycle would hamper quantification based on cycle of quantification determination. Theoretically, digital PCR can quantify down to one copy of DNA in a sample. Yet, a so-called ‘‘rain’’ of droplets with an intermediate fluorescent signal between positive and negative droplets may hamper unambiguous single-copy detection. Mathematical models to define the threshold have been described [18]. However, false positives that cannot be assigned to the rain have also been observed by multiple authors [1,18]. These data indicate that high numbers of negative control samples should be used to allow unambiguous determination of low-level copy numbers in samples. Because digital PCR is becoming widely available, the full potential of this technique is only now being explored. The current investigation reveals that the independence of variation in reaction efficiency on the quantitative power enables high flexibility in assay design and optimization. A highly specific PCR can be combined with accurate quantification. This allows a flexible assay design for primers and probes when specific genomic regions are
[1] B.J. Hindson, K.D. Ness, D.A. Masquelier, P. Belgrader, N.J. Heredia, A.J. Makarewicz, I.J. Bright, M.Y. Lucero, A.L. Hiddessen, T.C. Legler, T.K. Kitano, M.R. Hodel, J.F. Petersen, P.W. Wyatt, E.R. Steenblock, P.H. Shah, L.J. Bousse, C.B. Troup, J.C. Mellen, D.K. Wittmann, N.G. Erndt, T.H. Cauley, R.T. Koehler, A.P. So, S. Dube, K.A. Rose, L. Montesclaros, S.L. Wang, D.P. Stumbo, S.P. Hodges, S. Romine, F.P. Milanovich, H.E. White, J.F. Regan, G.A. Karlin-Neumann, C.M. Hindson, S. Saxonov, B.W. Colston, High-throughput droplet digital PCR system for absolute quantitation of DNA copy number, Anal. Chem. 83 (2011) 8604– 8610. [2] V. Taly, D. Pekin, A. El Abed, P. Laurent-Puig, Detecting biomarkers with microdroplet technology, Trends Mol. Med. 18 (2012) 405–416. [3] V. Bernardo, L.F. Ribeiro Pinto, R.M. Albano, Gene expression analysis by realtime PCR: experimental demonstration of PCR detection limits, Anal. Biochem. 432 (2013) 131–133. [4] L.B. Pinheiro, V.A. Coleman, C.M. Hindson, J. Herrmann, B.J. Hindson, S. Bhat, K.R. Emslie, Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification, Anal. Chem. 84 (2012) 1003– 1011. [5] Q. Zhong, S. Bhattacharya, S. Kotsopoulos, J. Olson, V. Taly, A.D. Griffiths, D.R. Link, J.W. Larson, Multiplex digital PCR: breaking the one target per color barrier of quantitative PCR, Lab Chip 11 (2011) 2167–2174. [6] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE guidelines: minimum information for publication of quantitative realtime PCR experiments, Clin. Chem. 55 (2009) 611–622. [7] C.H. Lin, Y.C. Chen, T.M. Pan, Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay, PLoS One 6 (2011) e29101. [8] W. De Spiegelaere, P. Cornillie, M. Van Poucke, L. Peelman, C. Burvenich, W. Van den Broeck, Quantitative mRNA expression analysis in kidney glomeruli using microdissection techniques, Histol. Histopathol. 26 (2011) 267–275. [9] W. De Spiegelaere, T. Erkens, J. De Craene, C. Burvenich, L. Peelman, W. Van den Broeck, Elimination of amplification artifacts in real-time reverse transcription PCR using laser capture microdissected samples, Anal. Biochem. 382 (2008) 72–74. [10] D. Pekin, Y. Skhiri, J.C. Baret, D. Le Corre, L. Mazutis, C.B. Salem, F. Millot, A. El Harrak, J.B. Hutchison, J.W. Larson, D.R. Link, P. Laurent-Puig, A.D. Griffiths, V. Taly, Quantitative and sensitive detection of rare mutations using dropletbased microfluidics, Lab Chip 11 (2011) 2156–2166. [11] T.J. Henrich, S. Gallien, J.Z. Li, F. Pereyra, D.R. Kuritzkes, Low-level detection and quantitation of cellular HIV-1 DNA and 2-LTR circles using droplet digital PCR, J. Virol. Methods 186 (2012) 68–72. [12] R.A. White, S.R. Quake, K. Curr, Digital PCR provides absolute quantitation of viral load for an occult RNA virus, J. Virol. Methods 179 (2012) 45–50. [13] M.C. Strain, D.D. Richman, New assays for monitoring residual HIV burden in effectively treated individuals, Curr. Opin. HIV AIDS 8 (2013) 106–110. [14] R.M. van der Sluis, T. van Montfort, M. Centlivre, N.C. Schopman, M. Cornelissen, R.W. Sanders, B. Berkhout, R.E. Jeeninga, W.A. Paxton, G. Pollakis, Quantitation of HIV-1 DNA with a sensitive Taqman assay that has broad subtype specificity, J. Virol. Methods 187 (2013) 94–102. [15] P. Messiaen, W. De Spiegelaere, J. Alcami, K. Vervisch, P. Van Acker, B. Verhasselt, P. Meuwissen, E. Calonge, N. Gonzalez, F. Gutierrez-Rodero, C. Rodriguez-Martin, E. Sermijn, B. Poppe, D. Vogelaers, C. Verhofstede, L. Vandekerckhove, Characterization of LEDGF/p75 genetic variants and association with HIV-1 disease progression, PLoS One 7 (2012) e50204. [16] H.H. Larsen, H. Masur, J.A. Kovacs, V.J. Gill, V.A. Silcott, P. Kogulan, J. Maenza, M. Smith, D.R. Lucey, S.H. Fischer, Development and evaluation of a quantitative, touch-down, real-time PCR assay for diagnosing Pneumocystis carinii pneumonia, J. Clin. Microbiol. 40 (2002) 490–494. [17] K. Kesanopoulos, G. Tzanakaki, S. Levidiotou, C. Blackwell, J. Kremastinou, Evaluation of touch-down real-time PCR based on SYBR Green I fluorescent dye for the detection of Neisseria meningitidis in clinical samples, FEMS Immunol. Med. Microbiol. 43 (2005) 419–424. [18] M.C. Strain, S.M. Lada, T. Luong, S.E. Rought, S. Gianella, V.H. Terry, C.A. Spina, C.H. Woelk, D.D. Richman, Highly precise measurement of HIV DNA by droplet digital PCR, PLoS One 8 (2013) e55943.