Touchdown–touchup nested PCR for low-copy gene detection of benzimidazole-susceptible Wuchereria bancrofti with a Wolbachia endosymbiont imported by migrant carriers

Experimental Parasitology 127 (2011) 559–568

Contents lists available at ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

Touchdown–touchup nested PCR for low-copy gene detection of benzimidazole-susceptible Wuchereria bancrofti with a Wolbachia endosymbiont imported by migrant carriers Prapassorn Pechgit a, Apiradee Intarapuk b,c, Danai Pinyoowong b,c, Adisak Bhumiratana a,b,c,⇑ a b c

Department of Parasitology and Entomology, Faculty of Public Health, Mahidol University, Bangkok 10400, Thailand Center for EcoHealth Disease Modeling and Intervention Development Research, Faculty of Public Health, Mahidol University, Bangkok 10400, Thailand Environmental Pathogen Molecular Biology and Epidemiology Research Unit, Faculty of Veterinary Medicine, Mahanakorn University of Technology, Bangkok 10530, Thailand

a r t i c l e

i n f o

Article history: Received 2 February 2010 Received in revised form 27 October 2010 Accepted 28 October 2010 Available online 11 November 2010 Keywords: Benzimidazole susceptibility b-tubulin DNA isolation ftsZ PCR amplification Touchdown–touchup nested PCR Wolbachia Wuchereria bancrofti

a b s t r a c t A novel, sensitive and specific touchdown–touchup nested PCR (TNPCR) technique based on two useful molecular markers, a Wuchereria bancrofti b-tubulin gene involved in benzimidazole susceptibility and a Wolbachia ftsZ gene involved in cell division, was developed to simultaneously detect the parasite W. bancrofti (W1) with its Wolbachia endosymbiont (W2) from both microfilaremic and post-treatment samples of at-risk migrant carriers infected with geographical W. bancrofti isolates. The detection and characterization of authentically low-copy gene-derived amplicons revealed no false positive identifications in amicrofilaremia with or without antigenemia. The W1-TNPCR was 100-fold more sensitive than the W2-TNPCR regardless of the microfilarial DNA isolation method and compared well with the thick blood film and membrane filtration techniques. These locus-specific TNPCRs could also detect Wolbachiacarrying W. bancrofti genotype in addition to a link to benzimidazole sensitivity among those with unknown infection origins that exhibited microfilaremia responsiveness against treatment with diethylcarbamazine plus albendazole. These TNPCR methods can augment the results of microscopic detection of the parasite because these methods enhance DNA isolation and PCR amplification capabilities. Ó 2010 Elsevier Inc. All rights reserved.

1. Introduction Lymphatic filariasis caused by Wuchereria bancrofti, Brugia malayi and Brugia timori is one of the major public health problems in South-East Asia (SEA). This mosquito-borne disease accounts for the highest proportion of the population at risk, or half of the worldwide cases (WHO, 2001, 2008; Ottesen et al., 2008). Currently, this SEA poverty-attributed disease is controlled on a large-scale by an annual mass drug administration (MDA) using a single 6 mg/kg dose of diethylcarbamazine (DEC) plus 400 mg albendazole; this approach is part of the National Program to Eliminate Lymphatic Filariasis (PELF) guided by the World Health Organization (WHO). For monitoring and evaluating the effectiveness of the implementation of PELF (Kyelem et al., 2008), several key determinants focus not only on the microscopic detection of either microfilariae (Mf) present in the blood of infected persons or L1–L3 larvae in infected mosquitoes, but also on the detection of the parasite’s antigen in humans (More and Copeman, 1990; Chanteau ⇑ Corresponding author. Address: Department of Parasitology and Entomology, Faculty of Public Health, Mahidol University, 420/1 Rajvithi Road, Rajthewee, Bangkok 10400, Thailand. Fax: +66 02644 5130. E-mail address: [email protected] (A. Bhumiratana). 0014-4894/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2010.10.022

et al., 1994b; Weil et al., 1997) or the parasite’s DNA in both mosquito and human (Lizotte et al., 1994; Chanteau et al., 1994a). Although the availability of these diagnostics (microfilariae and antigen) is not ideal for the surveillance and monitoring of the impacts of MDA on the parasite populations, field applications of microscopy-based methods are still part of the MDA 2-drug program. The potential benefits of using advanced tools in the PELF should, therefore, not only be aimed at how to assess the responsible genotypes of the parasite populations in different settings of geographical MDA coverage, but also how to design strategic approaches to molecularly diagnose and monitor the infections under suppression by the MDA 2-drug regimen. Recent reports have shown promise for W. bancrofti Mf DNA detection by polymerase chain reaction (PCR)-based methods, and the choice of a PCR technique depends mostly on the purity and quantity of the microfilariae for different sample preparations (Cox-Singh et al., 2000; Pradeep Kumar et al., 2002; Fischer et al., 2003; Kanjanavas et al., 2005; Nuchprayoon et al., 2007). For instance, purified Mf DNA can be isolated either from a viable Mf population recovered by filtering microfilaremia through a Millipore membrane with a further Percoll density gradient centrifugation (Pradeep Kumar et al., 2002) or directly from microfilaremia-embedded Whatman

560

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

FTA papers (Nuchprayoon et al., 2007), this DNA can then be used in PCR-based DNA fingerprinting studies. Furthermore, Giemsastained blood films of W. bancrofti microfilariae (WbMf) can be used to detect Mf DNA and Wolbachia DNA (Bisht et al., 2006). A Wolbachia endosymbiont is maternally transmitted vertically from a W. bancrofti female worm to its offspring, and intriguingly, it is clinically implicated in microfilaremia and drug responsiveness in infected patients (Taylor and Hoerauf, 1999; Fenn and Blaxter, 2004). Therefore, the molecular detection and monitoring of Wolbachia-carrying W. bancrofti infections that are genotypically associated with benzimidazole sensitivity are ideal for the reciprocal detection of the genetically-stable W. bancrofti b-tubulin isotype 1 (Wbtubb) gene responsible for benzimidazole susceptibility (Schwab et al., 2005; Hoti et al., 2009; Bhumiratana et al., 2010) and the Wolbachia ftsZ (WWbftsZ) gene, which is involved in cell division (Bandi et al., 1998). Moreover, the possibility that the cross-border movement of migrant workers carrying W. bancrofti infections with unknown origins and exposed to multiple infective bites in multiple locations can spread the disease is very interesting. Our knowledge is quite rudimentary concerning the factors that shape W. bancrofti populations in these migrants when they are no longer receiving the MDA 2-drug regimen (Koyadun and Bhumiratana, 2005; Yongyuth et al., 2006; Bhumiratana et al., 2010). More interestingly, the question remains regarding the genetic stability of benzimidazole-susceptible W. bancrofti within a SEA region where migrant carriers naturally acquire the Wolbachiacarrying W. bancrofti infections from endemic settings with poor geographical MDA coverage. In this study, to address the problem of the low-copy of the Wbtubb and WWbftsZ genes used as molecular markers, we have successfully developed a novel, sensitive and specific touchdown–touchup nested PCR (TNPCR) assay. The benzimidazole-susceptible W. bancrofti infections in imported bancroftian filariasis (IBF) cases, which were selected from the at-risk cross-border Myanmar migrants, were examined. Regarding the amplification efficiency (specificity and sensitivity) and characterization of the TNPCR products, two main determinants, the Mf DNA isolation method and exposure to the DEC plus albendazole treatment, were scrutinized to evaluate the empirical use of these locus-specific TNPCRs.

2. Materials and methods 2.1. Subject selection, recruitment and case definition Night blood surveys of 1178 male and female Myanmar migrant workers aged P20 years were carried out in Phang-nga, southern Thailand, between 2007 and 2009, with the assistance of welltrained Myanmar translators. Of the nine microfilaremic IBF carriers, seven participants gave their informed consent. These included four that received treatment and had follow-up samples (namely, MKA2, MRA3, MME4 and MMO5) and three that had only pretreatment samples (namely, MDA1, MMO6 and MMO7). As recommended by the provincial migrant worker health service program in Thailand, the four treated subjects were given a 300-mg oraldose of DEC (for IBF treatment) and 400 mg of albendazole (for helminthiasis treatment) (Yongyuth et al., 2006). Intravenous blood samples of these microfilaremic (WbMf) individuals (approximately 4 ml each) were collected, near the time of microfilarial peak density (0100 h) into ethylenediamine tetra-acetic acid (EDTA), an anticoagulant, both before and at 1–2 months after treatment. Antigenemia was confirmed using the NOWÒ ICT Filariasis card test (Binax, USA) specific for the W. bancrofti circulating filarial antigen (WbAg) (Bhumiratana et al., 2005). The three untreated subjects whose microfilaremia samples were collected only

pre-treatment were also examined for the presence of WbMf and WbAg, and eventually, they were given the same treatment that the treated subjects had received. At each time of blood collection, fresh specimens were stored in coolers during transfer to the laboratory, where they were then stored at 4 °C until use. Blood examination for species identification and microfilarial count was conducted using the thick blood film and membrane filtration techniques (Bhumiratana et al., 2005, 2010). Ethical clearance and approval for the study (MU 2007-059 and MU-IRB 2008/ 290.1301) was obtained from the Institutional Review Board at Mahidol University. 2.2. Genomic DNA extraction 2.2.1. Membrane filter-archived gDNA One milliliter of each of the microfilaremia (WbMf+/Ag+) samples was separately filtered through a polycarbonate membrane (Bhumiratana et al., 2010). The isolation of DNA extracts archived from the Mf-containing filter (M-DNA) was performed using a QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Germany) with some modifications. Briefly, an M-DNA filter was initially placed onto a clean microscopic slide and aseptically cut into small pieces with scissors. These pieces were transferred into the bottom of a 2-ml sterilized homogenizer containing 200 ll of 0.9% normal saline solution in the presence of 20 ll of QIAGEN protease, followed by the addition of 200 ll of lysis buffer AL. The lysate was 30-stroke homogenized with a pestle. The lysis reaction was incubated in the homogenizer at 56 °C for 10 min. Then, 200 ll of absolute ethanol was added and the solution was mixed thoroughly by pulsevortexing for 5 s. The clear lysate (approximately 400 ll) was subsequently filtered through a QIAamp spin column, followed by the downstream procedure described by the manufacturer. Finally, a pure eluted M-DNA solution with an A260/A280 ratio of 1.7–1.9 was obtained. The seven M-DNA samples from the four treated samples at the time-0 month and the three untreated samples, were further used to test the amplification efficiency of the locus-specific TNPCR methods. 2.2.2. Microfilaremia-archived gDNA Two hundred microliters of each of the microfilaremia (WbMf+/ Ag+) samples of the four subjects who were monitored both before and at post-treatment 1–2 months were used to prepare Mf DNA extracts (C-DNA), using the same QIAamp DNA Blood Mini Kit according to the procedure described by the manufacturer. There was no 2-month MRA3 sample due to the subject’s migration. Finally, purified C-DNA was obtained from all eleven samples. Similar to the untreated M-DNA samples mentioned above, the seven C-DNA samples were also used to test the amplification efficiency of the locus-specific TNPCR methods. 2.2.3. Amicrofilaremia-archived gDNA Importantly, due to human DNA contamination in both microfilaremic M-DNA and C-DNA samples, every microgram of purified gDNA usually contains more human DNA than W. bancrofti and Wolbachia DNA. That is, the negative control included amicrofilaremic migrant subjects, 10 WbMf/Ag+ and 9 WbMf/Ag. Among them, there were four malaria cases co-infected with Plasmodium falciparum and Plasmodium vivax (two each with WbMf/Ag+ and WbMf/Ag). Their resulting blood exams were all confirmed negative by the thick blood film (WbMf) and either concordantly negative (WbAg) or discordantly positive (WbAg+) by the ICT card test. The purified DNA extracts (C-DNA) from these amicrofilaremia samples were obtained by using the same QIAamp DNA Blood Mini Kit as described above. In addition, unrelated gDNA purified by phenol/chloroform extraction was obtained from bacterial

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

cultures of Vibrio parahaemolyticus, Vibrio cholerae, enterohemorrhagic Escherichia coli (EHEC) and enterotoxigenic E. coli (ETEC). 2.3. Primer design and annealing temperature algorithm The target nucleotide sequences of the annotated genes of the TUBB-ftsZ superfamily from W. bancrofti (Wbtubb), Wolbachia (WWbftsZ) and Homo sapiens (Hstubb) were deposited in the genome databases and were designated as shown in Fig. 1. All of the locus-specific primers (Table 1) were analyzed for homology as described elsewhere (Bhumiratana et al., 2010). Due to its rearrangement and bias of codon usage, exon 4 (Gly93 to Gln291) of the Hstubb gene shared <93% homology at the protein level with the conserved domain of b-tubulin of W. bancrofti and other human filariids. In the homologous segment, W. bancrofti possesses two distinct exons, 4 (Gly132 to Lys174) and 5 (Val175 to Leu228), with flanking intron sequences (Fig. 1A; Bhumiratana et al., 2010). Thus, this segment was used to design Wbtubb locus-specific primers to discriminate between Wbtubb and Hstubb. For the Wolbachia lineage found in W. bancrofti, the consensus open reading frame (Leu57 to Glu373) of the WWbftsZ gene shares unanimous homology (99– 100%) at the DNA level, whereas the homology is 97% for the closely related lineages in B. malayi and B. pahangi (Foster et al., 2005). The WWbftsZ locus-specific primers can bind to the target sequences while mismatching with nucleotide substitutions for non-sense mutations among the other orthologs (Fig. 1B). Due to the different amounts of human, W. bancrofti and Wolbachia gDNA that exist in a single source of M-DNA, the optimization of a specific primer-template annealing temperature was performed by using gradient PCR, for which a bracket of higher and

561

lower temperatures of a calculated primer melting point, or Tm, was empirically determined. Based on the primer range of the 18–24 residues shown in Table 1, the Tm calculations of the designed primers were performed online as described elsewhere (Panjkovich and Melo, 2005; Kibbe, 2007) to generate the following values: Tm1 (basic melting temperature), Tm2 (salt-adjusted melting temperature) and Tm3 (nearest-neighbor melting temperature). A 96-well MyCycler™ Thermal Cycler (BIORAD, USA) was used to test the amplification specificity of the locus-specific primer sets in a 25-ll optimized nested PCR assay, allowing for establishment of thermocycling TNPCR protocols that stringently amplified both the Wbtubb (W1-TNPCR) and WWbftsZ (W2TNPCR) loci but not the Hstubb locus (H-TNPCR), as described below. 2.4. Locus-specific TNPCR assays The optimized 25-ll PCR mixtures used for the W1-TNPCR and W2-TNPCR reactions consisted of 20–50 ng microfilaremic DNA template (M-DNA or C-DNA), the primer set (1.0 lM each primer) and Go TaqÒ Green Master Mix (Promega, USA): Go TaqÒ DNA Polymerase, Green Go TaqÒ Reaction Buffer (pH 8.5), 200 lM of each deoxyribonucleotide triphosphate (dATP, dGTP, dCTP and dTTP) and 1.5 mM MgCl2. The primary PCR, using either the BT9/ BT12 or WftsZ1/WftsZ4 primer set, was performed with an initial denaturation at 95 °C for 4 min, followed by a touchdown program (or TD6056) for 5 cycles with successive annealing temperature decrements of 1.0 °C in every cycle. For these first 5 cycles, the reaction was denatured at 95 °C for 1 min, followed by annealing at 60 °C ? 56 °C for 1 min and polymerization at 72 °C for 1 min.

Fig. 1. Diagrams of locus-specific TNPCRs. (A) The Wbtubb-derived (607 and 174 bp) and Hstubb-derived (595 and 288 bp) DNA fragments are copied in the stringent reactions of the W1-TNPCR and H-TNPCR assays respectively, in which the specific primer sets mismatch base-pairing on coding segments of two homologous b-tubulin genes. (B) The expected amplified fragments (730 and 314 bp) are obtained by the W2-TNPCR reaction, in which the WWbftsZ primers specifically amplify target sequences with nucleotide substitutions retained in the open reading frame of WWbftsZ locus.

562

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

Table 1 Primers used in this study. Primer name

Sequence (50 –30 )

Direction

G–C (%)

Tm1/Tm2/ Tm3 (°C)

Length (bases)

Annealing temp. (°C) algorithms for TNPCR

Expected size of amplicons (bp)

Reference

BT9

CAGGTACAGATTGCTACAGT

Forward

45

50/56/50

20

Decrement/60 ? 56

607c

Bhumiratana et al. (2010)

BT12 BT121a

GCGATTTAAACCCGACAGC GGATCCGTATCAGATGTTGTG

Reverse Forward

53 48

51/57/52 52/60/51

19 21

Increment/56 ? 60

174

Bhumiratana et al. (2010)

BT122b BT17O BT18O BT17 BT18 WftsZ1 WftsZ4 WftsZ11 WftsZ14

GAATTCCAAGTGGTTGAGGTCG TCAGTCTGGGGCAGGTAACAAC CTGGGTGAGTTCCGGCACTGTGAG GGCTTCCAGCTGACCCACTCACTG GTGGTTCAGATCCCCGTAGGTTGG CACTGGAACAGGTGCAGC CTCCTCTGAAGTCTCGTCTTG TGCGTATTGCGGAGCTTG CGGATTAGATATTGCAGCTTCTG

Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

50 55 63 63 58 61 52 56 43

55/62/54 57/64/55 63/71/61 63/71/61 61/69/58 53/58/52 54/61/54 50/56/54 53/61/52

22 22 24 24 24 18 21 18 23

Decrement/68 ? 64

595d

This study

Increment/64 ? 68

288

This study

e

This study

314

This study

Decrement/60 ? 56 Increment/56 ? 60

730

50 modifications with additional recognition sequences. a BamH I (GGATCC). b EcoR I (GAATTC). c Retrieved Wuchereria bancrofti genome Accession Nos. (positions): AY705383 (181–787) and GU190718–24 (1–607). d Homo sapiens: AB023051 (81, 863–81, 269), AB088100 (3630–4224), AB103606 (3630–4224), AB202098 (3630–4224), AC006165 (35, 781–35, 187), AL662796 (46, 426– 47, 020), AL662848 (31, 521–32, 115), AL845353 (106, 573–107, 167), BA000025 (1, 218, 847–1, 218, 253), BX248307 (25, 601–26, 195), BX927283 (28, 008–28, 602), CR759873 (65, 078–65, 672), CR788240 (56, 876–57, 470), CR936878 (44, 441–45, 035) and J00314 (3004–3598). e Wolbachia endosymbiont of W. bancrofti: AF081198 (123–852), DQ093831–3 (184–913), DQ093834–5 (183–912) and DQ093830 (180–909).

The subsequent 35 cycles of amplification were similar, except that the annealing temperature was 56 °C for 1 min. The final extension was performed at 72 °C for 5 min. The second PCR, which employed either the BT121/122 or WfstZ11/WfstZ14 primer set, was performed using the same reaction mixture components, except that 2 ll of the first reaction product was used as the template. A touchup program (or TU5660) was performed with an initial denaturation at 95 °C for 1 min, followed by 5 cycles with successive annealing temperature increments of 1.0 °C in every cycle. For these first 5 cycles, the reaction was heated at 95 °C for 1 min, followed by annealing at 56 °C ? 60 °C for 1 min and polymerization at 72 °C for 1 min. The subsequent 35 cycles of amplification were similar, except that the annealing temperature was 56 °C for 1 min. Lastly, the extension was performed at 72 °C for 5 min. The Hstubb locus-specific TNPCR (H-TNPCR) utilized the same reaction mixture components as the W1-TNPCR and the W2-TNPCR. However, the two TNPCR programs relied on higher annealing temperature decrements/increments than those for the Hstubb primers. Similar to the reactions described above, the PCR containing the BT17O/ BT18O primer set was initially performed with a denaturation step at 95 °C for 5 min, followed by a touchdown program (TD6864). The first 5 cycles consisted of denaturation at 95 °C for 1 min, annealing at 68 °C ? 64 °C for 1 min and extension at 72 °C for 1 min. The following 35 cycles of amplification employed an annealing temperature of 64 °C for 1 min. The last extension step was at 72 °C for 5 min. The second PCR contained the primer set BT17/BT18, and the touchup program (TU6468) included an initial denaturation at 95 °C for 1 min, followed by successive temperature increments from 64 °C ? 68 °C increased by 1.0 °C in every cycle for the first 5 cycles. The subsequent 35 thermocycles were carried out with a 68 °C annealing step for 1 min. The final extension was performed at 72 °C for 5 min.

and nuclease-free water instead of DNA. The sensitivity (i.e., the detection limit, the lowest amount of microfilaremic M-DNA detected by the W1-TNPCR and the W2-TNPCR) was tested with a 10-fold serial dilution, 10 ng to 1 pg. In this study, the main effects of the Mf DNA isolation method and the DEC plus albendazole treatment could have influenced the amplification sensitivity of both the W1-TNPCR and W2-TNPCR assays. Because of the potential for M-DNA refinement to cause an increase in the aggregate Mf numbers of samples contaminated with human DNA, serially-diluted M-DNA samples were assessed by three TNPCR tests and compared to the membrane filtration results for the corresponding microfilaremia samples (Mf/ml) as a reference. In individual patients infected with W. bancrofti, the amount of microfilaremia is due to the number of parasites that harbor the most viable Mf, and the drug-responsive microfilaremia is due to the affected parasite population harboring a diverse range of viable and non-viable Mf. That is, to determine whether drug-responsive microfilaremia could influence the detection of the target low-copy genes, the microfilaremic C-DNA samples were used to analyze the amplification sensitivity of both the W1TNPCR and W2-TNPCR assays as compared to the thick blood film (Mf/60 ll) or membrane filtration (Mf/ml) results of corresponding microfilaremia samples obtained from all four treated subjects. For quality control, TNPCR amplifications were performed in triplicate throughout the study, and the TNPCR products (one-fifth each) were electrophoresed on gels (1.2–1.5%) at a constant voltage (10 V cm1) and then stained with 0.5 lg/ml ethidium bromide. Subsequently, the sequencing of purified DNA fragments and the determination of homology at the DNA and protein levels were accomplished according to methods described elsewhere (Bhumiratana et al., 2010). The nucleotide sequences from this study were deposited in the GenBank database: W. bancrofti (GU190725–GU190728) and Wolbachia (GU196270–GU196272).

2.5. Post TNPCR analysis

3. Results and discussion

The amplification efficiency (specificity and sensitivity) and fidelity of the W1-TNPCR and W2-TNPCR assays were determined and compared to the H-TNPCR as follows. The specificity, i.e., the lack of cross-hybridization of the designed primer set against non-target sequences) was analyzed using both the amplification of microfilaremic M-DNA and C-DNA samples compared to negative controls

3.1. Annealing temperature algorithm The goal of this study was to develop a Tm-dependent algorithm optimized for locus-specific TNPCR by which low-copy Wbtubb and WWbftsZ genes can be simultaneously amplified in a singlesource Mf DNA extract without amplifying human genomic DNA.

563

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

Based on the Tm algorithms for the primer sets shown in Table 1, 30-ng M-DNA templates from 3 of the microfilaremia samples: MRA3 (485 Mf/ml), MMO5 (591 Mf/ml) and MMO7 (1246 Mf/ml) provided the most reliable amplification patterns for the specific nested PCR primer-template combinations (Fig. 2A–C). Both the Wbtubb and WWbftsZ primers annealed at roughly the same Tm interval (ranging from 54–62 °C) in two successive reactions, as expected (Fig. 2A and B). The Hstubb primers contrasted with this nested PCR profile; high copies of two DNA fragments (595 and 288 bp) were amplified roughly at Tm ranging from 57–68 °C (Fig. 2C). In general, both parasite genome analysis and low-copy gene detection by conventional PCR have several common constraints (Singh, 1997). Primers, even those designed with sophisticated computer programs, can bind to non-specific sequences of DNA template and lagging products are often amplified due to exponential polymerase amplification. Poor primers and low-copy template are the most common problems; consequently, copies of the desired sequence in the initial geometric amplification fail to yield product under ordinary cycling parameters, requiring the employment of more than 30 thermocycles. Nested PCR is a modified PCR technique that can reduce primer-template mismatches and artifactual amplicons, which occur due to the amplification of unexpected primer binding sites in the parasite genome, and hence, increase amplification efficiency (Snounou et al., 1993; Singh, 1997; Cox-Singh et al., 2000; Kanjanavas et al., 2005). In Fig. 2A and B, the nested PCR patterns demonstrate that, although an M-DNA extract might normally have a high abundance of human DNA, the Wbtubb and WWbftsZ primers have similar accuracies in primer binding specificity when only the W. bancrofti and Wolbachia genomes are used as PCR templates under the same amplification conditions. The discrepancy in DNA detection between the two genomes was due to the abundance of the first PCR products. In Fig. 2C, the primary reactions containing a high

abundance of the Hstubb products gave rise to the geometric amplification of artifactual amplicons of the human genome in spite of the specificity of the primer binding sites. With regards to the PCR factors involved, the capacity for DNA detection relied primarily on the annealing temperatures by which the specific primer binding sites on the discrete W. bancrofti, Wolbachia and human genes were restricted. The novelty of the TNPCR method is the use of touchdown PCR (annealing temperature decrement) to empirically determine the specificity of primer annealing to avoid amplifying non-specific sequences, using a program with an annealing temperature decrease for every subsequent PCR cycle. Touchup PCR (annealing temperature increment), an inversion of touchdown PCR, is performed with low annealing temperatures at early steps followed by gradually increasing annealing temperatures. In this manner, non-specific base pairings between the primer and template become less stable during subsequent rounds (Don et al., 1991; Roux, 1994; Hecker and Roux, 1996). Hence, both W1-TNPCR (Wbtubb gene) and W2-TNPCR (WWbftsZ gene) involved the amplification of two primer sets in such a way that the first set amplified a specific sequence in a touchdown manner and the second set amplified an internal sequence within the primary product in a touchup PCR cycle. Thus, the main aim of this study was to show how these two locus-specific TNPCR methods can increase the amplification efficiency (both specificity and sensitivity) for detecting low-copy genes while reducing false positives. 3.2. Amplification specificity of locus-specific TNPCR Both the optimized W1-TNPCR and W2-TNPCR had very good specificity, or no false positive identifications, because they exhibited no cross-hybridization against non-target sequences from either the amicrofilaremic C-DNA or the bacterial gDNA tested in this study. The two TNPCR formats did not yield expected amplicons for reactions containing either C-DNA samples of the WbMf/Ag+ or WbMf/Ag (Table 2 and Fig. 3B and C) controls. The W1-TNPCR seemed to work very well based upon the Wbtubb primers that specifically amplified the genetically-stable Wbtubb gene present in both microfilaremic (WbMf+/Ag+) M-DNA and C-DNA templates (Table 2 and Fig. 3B). Only when microfilaremic DNA corresponded to a low Mf burden (between 13 and 252 Mf/ ml or up to 50 ng tested) did W2-TNPCR with the WWbftsZ primers produce a false negative result (Table 2 and Fig. 3C). However, microfilaremic DNA templates of both M-DNA and C-DNA were susceptible to DNA polymerase and tested positive for the H-TNPCR (Hstubb gene) (Table 2 and Fig. 3D). Undoubtedly, the W. bancrofti Mf populations that were either retained on the membrane or circulating in the blood were the primary sources of M-DNA and C-DNA; however, amicrofilaremic antigenemia contained no DNA target sequences that could serve as a template for

Table 2 Specificity of the locus-specific TNPCRs. Source

Sample no.

No. of positive samples Wbtubb

+

Fig. 2. The Tm algorithm for the locus-specific nested PCR profiles using a singlesource M-DNA. The successive reactions of the gradient PCR for the set of annealing temperature decrements (°C): 70.0, 68.5, 66.0, 62.2, 57.5, 53.9, 51.5 and 50.0 are shown for both the first (lanes 1–8) and second (lanes 9–16) PCR products and compared to a 100-bp DNA ladder used as a molecular weight marker (lane M). (A) Wbtubb primers (607 and 174 bp). (B) WWbftsZ primers (730 and 314 bp). (C) Hstubb primers (595 and 288 bp).

+

WbMf /Ag M-DNA WbMf+/Ag+ C-DNA WbMf/Ag+ C-DNA WbMf/Ag C-DNA Other bacterial gDNA a b c d e

a

7 7a 10b 9c 4

7 7 0 0 0

WWbftsZ d

6 3e 0 0 0

Hstubb 7 7 10 9 0

All asymptomatic microfilaremics. Amicrofilaremics: 3 acute lymphatic inflammation and 7 asymptomatic cases. Amicrofilaremics: 2 hydrocele grade I and 7 asymptomatic cases. One M-DNA with 13 Mf/ml. Four C-DNA samples with 13–252 Mf/ml had a negative amplification result.

564

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

Fig. 3. Amplification efficiency of W1-TNPCR and W2-TNPCR using representative C-DNA template. (A) Of the four IBF microfilaremic (WbMf+/Ag+) cases (front nos.: MKA2, MRA3, MME4 and MMO5), amplification patterns of microfilaremic C-DNA samples were obtained before (0) and between 1 and 2 months after treatment (rear nos.) are shown in comparison with pooled C-DNA samples (P) and negative controls, including amicrofilaremic C-DNA and bacterial DNA. The corresponding WbMf counts examined either by the thick blood film (Mf/60 ll) or membrane filtration (Mf/ml) method are shown for microfilaremic C-DNA, compared to that of amicrofilaremic C-DNA (WbMf). (B–D) Positive (d) and negative (s) identifications of 2° TNPCR products with expected sizes (bp) originally derived from three distinct genes of W. bancrofti (174), Wolbachia (314) and human (288) DNA are shown in reference to their 1° TNPCR products. Abbreviations: EHEC, enterohemorrhagic E. coli; ETEC, enterotoxigenic E. coli; M, 100-bp DNA ladder; Pf, P. falciparum; Pv, P. vivax; Vc, V. cholerae; Vp, V. parahaemolyticus; Wb, W. bancrofti; WbMf+/Ag+, microfilaremic antigenemia; WbMf/Ag+, amicrofilaremic antigenemia.

coupled Wuchereria–Wolbachia gene amplifications. Also, differences in purified DNA preparations did not interfere with PCR amplification. Thus, W1-TNPCR was able to detect W. bancrofti microfilariae, and therefore, the W2-TNPCR for detection of its Wolbachia endosymbiont was based on this methodology. 3.3. Amplification sensitivity of locus-specific TNPCR The purified DNA preparations mentioned above were sensitive to DNA polymerase, but there appeared to be some counterintuitive effects for both gene amplifications. Membrane filtration can recover the Mf populations from microfilaremic blood of both untreated subjects and those treated with antifilarial agents; in this manner, a larger volume (up to more than 1 ml) of microfilaremic blood can be used. At the same time, white blood cell components are filtered whereas the amounts of the EDTA anticoagulant and red blood cells are reduced. Due to human DNA contamination, the M-DNA (of 1 ml blood) had an average gDNA content of 430 lg/ml, 8-fold greater than that of C-DNA (54 lg/ml) from 0.2 ml of archived blood. For this reason, tenacious filtration could isolate alive, dying or dead Mf populations, and M-DNA could yield Mf DNA, allowing for samples with little Wolbachia DNA to be easily subjected to TNPCR. The more sensitive amplification of W1-TNPCR relied on detectable Mf DNA present in M-DNA samples with high Mf numbers, while there appeared to be a threshold for the detection of Wolbachia

DNA with W2-TNPCR (Table 3 and Fig. 4). The W1-TNPCR had an increased sensitivity with increasing Mf numbers, P10 Mf/ml, showing detection limits of 10–0.1 ng M-DNA (Table 3). Microfilaremia sample MMO7, which had 1246 Mf/ml, could detect as low as 0.1 ng M-DNA by W1-TNPCR (Fig. 5A); this was 100-fold more sensitive than W2-TNPCR, which had a detection limit of 10 ng MDNA for the samples with P100 Mf/ml (Fig. 4B and C). Additionally, when three microfilaremic C-DNA samples (MMO6 (13 Mf/ml), MDA1 (252 Mf/ml) and MMO7 (1246 Mf/ml); Table 2) were simultaneously amplified with W1-TNPCR and W2-TNPCR in a multiplex reaction, the W1-TNPCR reactions were still 100-fold more sensitive than the W2-TNPCRs (Fig. 5B). Conversely, H-TNPCR had a detection limit of as low as 1 pg of M-DNA (Table 3 and Fig. 4B). However, among the pre-treatment samples tested, all three of the locus-specific TNPCRs had detection limit windows when 10-fold serially diluted M-DNA from three microfilaremia samples with 13–591 Mf/ ml were analyzed (Fig. 4). In this study, the saturation of human gDNA molecules and steric hindrance of its genome structure and size did not interfere with the low-copy gene detection of W. bancrofti and its Wolbachia endosymbiont when amplifying the target loci. The W1-TNPCR technique can provide proof of Mf DNA detection in microfilaremic sample preparations, and it improved upon our previously developed Wbtubb locus-specific nested PCR method, which had a detection limit of as low as 1 ng of Mf gDNA (Bhumiratana et al., 2010). Also, these findings agree with the findings of Cox-Singh et al. (2000), who demonstrated that nested PCR

565

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568 Table 3 Sensitivity of the M-DNA-based locus-specific TNPCRs using the membrane filtration technique as a reference.

a b c d

Membrane filtration (Mf/ml)

Sample no.

10–400 401–800 >800 Detection limit

4a 2b 1c 7

Detectable M-DNA samples (ng) Wbtubb

WWbftsZ

Hstubb

10 10–1 0.1 10–0.1

10d 10 10 10

0.01–0.001 0.01–0.001 0.001 0.01–0.001

Mf density (Mf/ml): MMO6 (13), MME4 (93), MKA2 (107) and MDA1 (252). Mf density (Mf/ml): MRA3 (485) and MMO5 (591). Mf density (Mf/ml): MMO7 (1246). MMO6 had a negative amplification result.

Fig. 4. Sensitivity of three TNPCRs using the M-DNA samples equivalent to the noted Mf densities (Mf/ml): (A) MMO6 (13 Mf/ml); (B) MRA3 (485 Mf/ml); (C) MMO5 (591 Mf/ml). In each panel, two successive reactions were performed on a 10-fold serial dilution, 10 ng to 1 pg, with locus-specific primers: lanes 1–5, Wbtubb; lanes 6–10, WWbftsZ; lanes 11–15, Hstubb. The 2° TNPCR products with their expected sizes (bp): Wb – W. bancrofti (174), WWb – endosymbiotic Wolbachia of W. bancrofti (314) and Hs – Homo sapiens (288), are shown as compared to the 100-bp DNA ladder (M).

of Mf DNA of viable Mf population archived from a membrane filter increased in sensitivity with increasing Mf numbers. The samples with P10 Mf/ml were consistently positive. Positive identifications, which were not due to an intrinsic bias of exponential polymerase amplification, were truly associated with the presence of microfilaremia in infected individuals. False negative identifications observed in this study were the result of Mf numbers below the borderline. Nonetheless, it is unwise to suggest that the amounts of M-DNA that tested positive by W1-TNPCR are indicative of quantitative identifications of Mf infection loads. As for harboring Wolbachia, the microfilaremia samples with P100 Mf/ml seemed to have the same detection limit of 10-ng M-DNA for Wolbachia DNA detection by W2-TNPCR. It appeared as if vast numbers of isolated W. bancrofti Mf that had high concentrations of Wolbachia multiplied specifically in tissues of Mf population (Taylor and Hoerauf, 1999; Fenn and

Fig. 5. Sensitivity of W1-TNPCR. (A) A 174-bp Wbtubb-derived DNA fragment was obtained by testing an M-DNA sample of MMO7 with 1246 Mf/ml, serially-diluted at 10, 1, 0.1, 0.01 and 0.001 ng shown in comparison to 20 ng* used in the optimized W1-TNPCR method. (B) C-DNA samples of corresponding Mf densities (13–1246 Mf/ml) gave positive identifications when simultaneously amplified using the Wbtubb locus and WWbftsZ locus-specific primer sets. A MMO7 sample yielded the only 314-bp WWbftsZ-derived amplicon, as compared to the 100-bp DNA ladder (M).

Blaxter, 2004). Perhaps not all Mf accommodate this intracellularly obligate organism. The W2-TNPCR had a high sensitivity for detecting Wolbachia DNA only when a large number of Mf was used. A 100fold increase in the sensitivity for W2-TNPCR would be expected if there were a 10-fold increase in the Mf number in an M-DNA sample. In addition, the 300 mg of DEC (plus 400 mg albendazole) currently used in IBF control efforts might reduce the Mf density in susceptible migrant carriers (Bhumiratana et al., 2010). The experiment shown in Fig. 3 examined four IBF carriers treated with the combined drugs to determine the effect of drug responsiveness on changes in numbers of Mf with sessile Wolbachia because the Mf are the only target of this treatment. In this experiment, the sensitive amplification of W. bancrofti that retained Wolbachia was challenged based on the W1-TNPCR (Wbtubb gene) and W2-TNPCR (WWbftsZ gene) results. Using the thick blood film (per 60 ll) method as a reference,

566

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

the C-DNA based W1-TNPCR positively amplified samples harboring P2 Mf (Fig. 3B). The detection of the Wbtubb gene seemed to correlate well with the Mf numbers of alive or dying Mf because this gene could not be detected when Mf disappeared 1-month post-treatment. The W2-TNPCR could detect Wolbachia in the reactions for samples harboring P12 Mf (Fig. 3C). In one treated sample carrying 33 Mf, Wolbachia was not detected. Another pre-treatment sample carrying 29 Mf was positive when tested at a concentration of CDNA greater than 30 ng. The WWbftsZ gene seemed to be sufficiently sensitive when samples with P10 Mf were tested. Again, the HTNPCR gave putatively positive amplification results for all of the samples tested (Fig. 3D). Interestingly, when pooled C-DNA samples (i.e., from which 50 ll of blood from each of the monitored samples was taken) from Mf individuals were used in this experiment, the Wbtubb gene was detected in all four pooled C-DNA samples by W1-TNPCR, while the WWbftsZ gene could only be detected in some pooled samples by W2-TNPCR (Fig. 3B and C). These findings suggest that the Wbtubb gene responsible for benzimidazole sensitivity is genetically stable because the individuals all responded to the treatment and this gene was detected. That is, this gene can be a surrogate measure for monitoring the susceptibility of organisms in treated patients and even mosquito pools in the sentinel sites targeted by the PELF. A cohort of larger sample pools, especially from treated patients under field conditions, will further support the usefulness of this method for the long-term monitoring of mass treatment impacts on W. bancrofti. Surprisingly, Wolbachia gene detection is much less sensitive than the detection of the gene responsible for susceptibility in IBF cases. Some positive identifications of WWbftsZ genecontaining C-DNA were found for the Mf of some patients (MRA3 and MMO5) who responded well to the treatment in this study (Fig. 6). If there is obligate mutualism, whether or not the Mf is recognized by inflammatory responses could somewhat determine the in situ discharge of Wolbachia bacteria. Otherwise, many of them will contain Wolbachia within their body parts (Taylor and Hoerauf, 1999; Fenn and Blaxter, 2004). As yet, the effect of the drug treatment on the detection of the Wbtubb gene in patients receiving DEC plus albendazole treatment is unclear.

3.4. Characterization of W. bancrofti with its Wolbachia symbiont and implications The W. bancrofti 607-bp amplicon, which was obtained in the W1-TNPCR reactions using the pre-treatment C-DNA samples (MKA2, MRA3, MME4 and MMO5) and 1-month post-treatment samples (MRA3 and MMO5), was sequenced. This DNA fragment shared 100% homology at both the DNA and protein levels with the W. bancrofti b-tubulin homolog deposited in the genome databases, which was identified from different isolates confined to South-East Asia and Africa (Hoti et al., 2003; Schwab et al., 2005; Bhumiratana et al., 2010). The genomic characterization of the geographical W. bancrofti isolates imported by cross-border Myanmar carriers, who responded well to the DEC plus albendazole treatment, has shown that IBF exhibited benzimidazole susceptibility because the isolates did not confer a hypothetical point mutation at position Phe200Tyr on exon 5 of the Wbtubb gene. In this study, our inquiry has not yet provided additional data as to the link between the fitness of W. bancrofti and the infections carrying the wild-type Wbtubb gene. Importantly, due to the movement of the IBF carriers and differences in treatment-seeking behaviors in different health settings between Thailand and Myanmar, IBF may occur if there is some vulnerability due to patient behavior in how the parasite can be transmitted and thrive. As long as they are sensitive to DEC, the predominantly susceptible W. bancrofti organisms may have still been eliminated by the PELFs in the SEA region (Hoti et al., 2009; Bhumiratana et al., 2010). For Wolbachia, a 730-bp WWbftsZ locus-derived amplicon was not obtained from any of the W2-TNPCR reactions using the CDNA samples or even M-DNA samples tested in this study. The only 314-bp amplicon obtained from the pre-treatment C-DNA samples (MRA3, MME4 and MMO5) and 1-month post-treatment samples (MRA3 and MMO5) was sequenced. This authentic fragment shared 100% homology at DNA level with the target ftsZ gene, belonging to the Wolbachia (alpha-proteobacteria) symbiont found in W. bancrofti var. pacifica (Tahiti) and to the closely related lineages of B. pahangi and B. malayi (97–98%) and Litomosoides

Fig. 6. Microscopy of W. bancrofti microfilaremia responsiveness against the DEC plus albendazole treatment in a representative subject, MMO5. Inflammatory responses to Mf are shown on a Giemsa-stained thick smear (A and B) and membrane filter, an average 5-lm pore size (C and D). These susceptible Mf were monitored at 1-month posttreatment and elicited positive identifications of both the Wbtubb and WWbftsZ genes. The bar is equal to 100 lm.

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

sigmodontis (96%). This was the first time that a Wolbachia found in a W. bancrofti Myanmar strain that is susceptible to benzimidazole has shared an evolutionarily genetic entity with clade D isolated from filarial hosts (Bandi et al., 1998; Taylor and Hoerauf, 1999; Foster et al., 2005; Plichart and Legrand, 2005). Culex quinquefasciatus is a common vector of this nocturnal parasite. Human migration allows for multiple exposure to bites of Cx. quinquefasciatus or other arthropod vectors carrying Wolbachia. Intriguingly, the IBF could have been carried axenically by Wolbachia among the seven geographical isolates (e.g., three Moulmein isolates and one isolate from each Dawei, Kawthoung, Myeik and Rangoon) as the IBF carriers might have more chances to come into close contact with various bites at the multiple locations. However, based on the WWbftsZ locus, the genetic stability of Wolbachia was likely vertically transmitted from W. bancrofti adult female worms to offspring microfilariae (Fenn and Blaxter, 2004). Again, this genetic information will be helpful if there is a need for screening W. bancrofti in the at-risk population in PELF-targeted transmission areas where there are new infections or a recrudescence of infections could possibly occur. 3.5. Utilization The novel, sensitive locus-specific TNPCR methods for both W1TNPCR (Wbtubb) and W2-TNPCR (WWbftsZ) can provide proof of Mf DNA detection in microfilaremic samples, even if they are subject to different DNA isolation methods. Several important determinants were empirically examined for their optimal sensitivity and specificity, including sample preparation and quality, primer design, optimization of amplification conditions and control of carry-over amplicons and environmental contamination. Microfilarial infection loads in patients that are either untreated or treated with antifilarial drugs are considered as a limiting factor, which influences low-copy gene detection by these two locus-specific TNPCRs. Interestingly, the amount of microfilaremia is a function of naturally acquired infection loads, which can be diagnosed by standard microscopic detection methods such as the thick blood film and membrane filtration methods. On the other hand, these methods cannot differentiate the genotypes of Wolbachia-carrying parasite. In regard to the enhancements of DNA isolation and PCR amplification involved, both locus-specific TNPCRs can increase the value of the standard microscopic detection of the parasite, especially when Mf DNA can be archived from the parasite culture-containing membrane (Fig. 6). Moreover, in terms of cost-effectiveness, the direct cost for W1-TNPCR together with W2-TNPCR using a singlesource C-DNA was determined to be 16 USD, which is 5- to 10-fold higher than the cost of the membrane filtration (3.2 USD) and thick blood film (1.5 USD) methods. The increased expense associated with the TNPCR tests requires their use to be logically analyzed to ensure that this approach is beneficial to the diagnosis and monitoring of new or recurrent cases; these tests may be especially useful to prevent conditions such as elephantiasis that cannot be treated without very high costs of surgery or medication. Last, this advancement of PCR detection would benefit the surveillance and monitoring of mass treatment impacts on Wolbachia-carrying W. bancrofti in sentinel sites in endemic countries in SEA or elsewhere that are annually implementing the MDA 2-drug regimen (6 mg/kg DEC plus 400 mg albendazole) (WHO, 2001, 2008, 2009). Acknowledgments This study was supported by the China Medical Board–Mahidol University Fund (Grant Nos. CMB06/2006 and PHRU/CMB 07/ 2008), Faculty of Public Health, Mahidol University. The authors acknowledged Pisit Yongyuth, Surachart Koyadun, Chumsin Siriaut and Intira Supapetch for their support in the community survey

567

and organization, night blood survey, drug administration and monitoring and blood specimen collection. We thank Prof. Dr. Orasa Suthienkul, Prof. Dr. Peerapan Tan-ariya and Dr. Saravudh Suvannadabba, for kindly providing bacterial cultures and scientific criticisms. We also thank the Myanmar translators and subjects recruited into the study. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.exppara.2010.10.022. References Bandi, C., Anderson, T.J., Genchi, C., Blaxter, M.L., 1998. Phylogeny of Wolbachia in filarial nematodes. Proceedings of the Royal Society of London Series B 265, 2407–2413. Bhumiratana, A., Koyadun, S., Srisuphanunt, M., Satitvipawee, P., Limpairojn, N., Gaewchaiyo, G., 2005. Border and imported bancroftian filariases: baseline seroprevalence in sentinel populations exposed to infections with Wuchereria bancrofti and concomitant HIV at the start of diethylcarbamazine mass treatment in Thailand. Southeast Asian Journal of Tropical Medicine and Public Health 36, 390–407. Bhumiratana, A., Pechgit, P., Koyadun, S., Siriaut, C., Yongyuth, P., 2010. Imported bancroftian filariasis: diethylcarbamazine response and benzimidazole susceptibility of Wuchereria bancrofti in dynamic cross-border migrant population targeted by the National Program to Eliminate Lymphatic Filariasis in South Thailand. Acta Tropica 113, 121–128. Bisht, R., Hoti, S.L., Tangadurai, R., Das, P.K., 2006. Isolation of Wuchereria bancrofti microfilariae from archived stained blood slides for use in genetic studies and amplification of parasite and endosymbiont genes. Acta Tropica 99, 1–5. Chanteau, S., Luquiaud, P., Failloux, A.B., Williams, S.A., 1994a. Detection of Wuchereria bancrofti larvae in pools of mosquitoes by the polymerase chain reaction. Transactions of the Royal Society of Tropical Medicine and Hygiene 88, 665–666. Chanteau, S., Moulia-Pelat, J.P., Glaziou, P., Nguyen, N.L., Luquiaud, P., Plichart, C., Martin, P.M., Cartel, J.L., 1994b. Og4C3 circulating antigen: a marker of infection and adult worm burden in Wuchereria bancrofti filariasis. The Journal of Infectious Diseases 170, 247–250. Cox-Singh, J., Pomrehnb, A.S., Wolfec, N.D., Rahmand, H.A., Lua, H., Singha, B., 2000. Sensitivity of the nested-polymerase chain reaction (PCR) assay or Brugia malayi and significance of ‘free’ DNA in PCR-based assays. International Journal for Parasitology 30, 1177–1179. Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K., Mattick, J.S., 1991. ‘Touchdown’ PCR to circumvent spurious priming during gene amplification. Nucleic Acids Research 19, 4008. Fenn, K., Blaxter, M., 2004. Are filarial nematode Wolbachia obligate mutualist symbionts? Trends in Ecology and Evolution 19, 163–166. Fischer, P., Boakye, D., Hamburger, J., 2003. Polymerase chain reaction-based detection of lymphatic filariasis. Medical Microbiology and Immunology 192, 3–7. Foster, J., Ganatra, M., Kamal, I., Ware, J., Makarova, K., Ivanova, N., Bhattacharyya, A., Kapatral, V., Kumar, S., Posfai, J., Vincze, T., Ingram, J., Moran, L., Lapidus, A., Omelchenko, M., Kyrpides, N., Ghedin, E., Wang, S., Goltsman, E., Joukov, V., Ostrovskaya, O., Tsukerman, K., Mazur, M., Comb, D., Koonin, E., Slatko, B., 2005. The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode. PLoS Biology 3, e121. doi:10.1371/ journal.pbio.0030121. Hecker, K.H., Roux, K.H., 1996. High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR. Biotechniques 20, 478– 485. Hoti, S.L., Dhamodharan, R., Subramaniyan, K., Das, P.K., 2009. An allele specific PCR assay for screening drug resistance among Wuchereria bancrofti populations in India. The Indian Journal of Medical Research 130, 193–199. Hoti, S.L., Subramaniyan, K., Das, P.K., 2003. Detection of codon of amino acid 200 in isotype 1 beta-tubulin gene of Wuchereria bancrofti isolates, implicated in resistance to benzimidazole in other nematodes. Acta Tropica 88, 77–81. Kanjanavas, P., Tan-ariya, P., Khawsak, P., Pakpitcharoena, A., Phantana, S., Chansiri, K., 2005. Detection of lymphatic Wuchereria bancrofti in carriers and long-term storage blood samples using semi-nested PCR. Molecular and Cellular Probes 19, 169–172. Kibbe, W.A., 2007. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Research 35, W43–W46. Koyadun, S., Bhumiratana, A., 2005. Surveillance for imported bancroftian filariasis after two-year multiple-dose diethylcarbamazine treatment. Southeast Asian Journal of Tropical Medicine and Public Health 36, 822–831. Kyelem, D., Biswas, G., Bockarie, M.J., Bradley, M.H., El-Setouhy, M., Fischer, P.U., Henderson, R.H., Kazura, J.W., Lammie, P.J., Njenga, S.M., Ottesen, E.A., Ramaiah, K.D., Richards, F.O., Weil, G.J., Williams, S.A., 2008. Determinants of success in national programs to eliminate lymphatic filariasis: a perspective identifying essential elements and research needs. The American Journal of Tropical Medicine and Hygiene 79, 480–484.

568

P. Pechgit et al. / Experimental Parasitology 127 (2011) 559–568

Lizotte, M.R., Supali, T., Partono, F., Williams, S.A., 1994. A polymerase chain reaction assay for the detection of Brugia malayi in blood. The American Journal of Tropical Medicine and Hygiene 51, 314–321. More, S.J., Copeman, D.B., 1990. A highly specific and sensitive monoclonal antibody based ELISA for the detection of circulating antigenemia in bancroftian filariasis. Tropical Medicine and Parasitology 41, 403–406. Nuchprayoon, S., Junpee, A., Poovorawan, Y., 2007. Random amplified polymorphic DNA (RAPD) for differentiation between Thai and Myanmar strains of Wuchereria bancrofti. Filaria Journal 6, 6. doi:10.1186/1475288366. Ottesen, E.A., Hooper, P.J., Bradley, M., Biswas, G., 2008. The global programme to eliminate lymphatic filariasis: health impact after 8 years. PLoS Neglected Tropical Diseases 2, e317. doi:10.1371/journal.pntd.0000317. Panjkovich, A., Melo, F., 2005. Comparison of different melting temperature calculation methods for short DNA sequences. Bioinformatics 21, 711–722. Plichart, C., Legrand, A.M., 2005. Detection and characterization of Wolbachia infections in Wuchereria bancrofti (Spirurida: Onchocercidae) var. pacifica and Aedes (Stegomyia) polynesiensis (Diptera: Culicidae). The American Journal of Tropical Medicine and Hygiene 73, 354–355. Pradeep Kumar, N., Patra, K.P., Hoti, S.L., Das, P.K., 2002. Genetic variability of the human filarial parasite, Wuchereria bancrofti in South India. Acta Tropica 82, 67– 76. Roux, K.H., 1994. Using mismatched primer-template pairs in touchdown PCR. Biotechniques 16, 812–814. Schwab, A.E., Boakye, D.A., Kyelem, D., Prichard, R.K., 2005. Detection of benzimidazole resistance-associated mutations in the filarial nematode Wuchereria bancrofti and evidence for selection by albendazole and

ivermectin combination treatment. The American Journal of Tropical Medicine and Hygiene 73, 234–238. Singh, B., 1997. Molecular methods for diagnosis and epidemiological studies of parasitic infections. International Journal for Parasitology 27, 1135–1145. Snounou, G., Viriyakosol, S., Zhu, X.P., Jarra, W., Pinheiro, L., do Rosario, V.E., Thaithong, T., Brown, K.N., 1993. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Molecular and Biochemical Parasitology 61, 315–320. Taylor, M.J., Hoerauf, A., 1999. Wolbachia bacteria of filarial nematodes. Parasitology Today 15, 437–442. Weil, G.J., Lammie, P.J., Weiss, N., 1997. The ICT filariasis test: a rapid format antigen test for diagnosis of bancroftian filariasis. Parasitology Today 13, 401–404. WHO, 2001. Regional strategic plan for elimination of lymphatic filariasis (2000– 2004). World Health Organization, New Delhi, India, pp. 1–36. Mimeographed document SEA-FIL-28. WHO, 2008. Global programme to eliminate lymphatic filariasis. Weekly Epidemiological Record 83, 333–341. WHO, 2009. Report: the role of polymerase chain reaction technique for assessing lymphatic filariasis transmission. World Health Organization, Geneva, pp. 1–55. Mimeographed document WHO/HTM/NTD/PCT/2009.1. Yongyuth, P., Koyadun, S., Jaturabundit, N., Sampuch, A., Bhumiratana, A., 2006. Efficacy of a single-dose treatment with 300 mg diethylcarbamazine and a combination of 400 mg albendazole in reduction of Wuchereria bancrofti antigenemia and concomitant geohelminths in Myanmar migrants in Southern Thailand. Journal of the Medical Association of Thailand 89, 1237– 1248.