Toxic effects of diclofenac on life history parameters and the expression of detoxification-related genes in Daphnia magna

Aquatic Toxicology 183 (2017) 104–113

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Toxic effects of diclofenac on life history parameters and the expression of detoxification-related genes in Daphnia magna Yang Liu a , Lan Wang a , Benben Pan a , Chao Wang a , Shuang Bao a , Xiangping Nie a,b,∗ a b

Department of Ecology/Institute of Hydrobiology, Jinan University, Guangzhou 510632, China Key Laboratory of Eutrophication and Red Tide Prevention of Guangdong Higher Education Institutes, Jinan University, Guangzhou 510632, China

a r t i c l e

i n f o

Article history: Received 7 October 2016 Received in revised form 20 December 2016 Accepted 23 December 2016 Available online 26 December 2016 Keywords: Diclofenac Daphnia magna Gene expression Detoxification Chronic toxicity

a b s t r a c t Diclofenac (DCF), as a widely used drug, has been detected in various environmental media such as municipal wastewater effluent. However, there is little information on the effects of DCF on freshwater invertebrates potentially exposing to its residues in surface water. In the present study, we investigated the toxic effects of DCF on the physiological parameters (e.g., survival, growth rate, and reproduction) of a crustacean, Daphnia magna, via a 21-d chronic toxicity test, and we also evaluated the effects of DCF on the expression of the genes related to the detoxification metabolism, growth, development and reproduction (e.g., HR96, P-gp, CYP360A8, CYP314, GST, EcR and Vtg) in acute exposure (up to 96 h) with RT-PCR. Significant toxic effects of DCF to D. magna were observed at 50 ␮g L−1 , the expression of these selected genes was inhibited with 24 h of exposure, and induced after 48 h to some extents. The expression of Vtg was induced at high concentrations of DCF (500 ␮g L−1 and 5000 ␮g L−1 ) after 24 h and 48 h of exposure, but also significantly induced at low concentration (50 ␮g L−1 ) after 96 h of exposure. Doseand time-dependent relationships were observed for gene expression of the seven selected genes. In the 21-d chronic toxicity test, the days to the first brood and the days to the first egg production were both significantly delayed at 50 ␮g L−1 . However, there were no significant differences observed among the molting frequency, number of eggs produced in the first brood, total number of eggs per individual, total number of broods per individual, body length and intrinsic growth rate. Our results suggested that the reproduction parameters are more sensitive endpoints than the survival and growth for evaluating the toxicity of DCF to aquatic invertebrates. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Presence of pharmaceuticals and personal care products (PPCPs) in the aquatic environment is considered to be one of the biggest environmental concerns in recent years (Jones et al., 2001) attributed to their potential harmful effects to both aquatic organisms and humans via direct and/or indirect exposure (Stackelberg et al., 2004). Many studies found that these contaminants in surface and groundwater have shown a remarkable increase worldwide (Montforts et al., 2007; Spindler et al., 2007). Although extensive studies have been done on the toxic effects of PPCPs on aquatic

Abbreviations: PPCPs, pharmaceuticals and personal care products; NSAID, anti inflammatory drug; DCF, diclofenac; GST, glutathione S-transferase; P-gp, P-glycoprotein; MFO, mixed-function oxidase; Vtg, vitellogenin; EcR, ecdysone receptor; ROS, reactive oxygen species. ∗ Corresponding author at: Department of Ecology, Jinan University, 601 West Huangpu Street, Guangzhou 510632, China. E-mail address: [email protected] (X. Nie). http://dx.doi.org/10.1016/j.aquatox.2016.12.020 0166-445X/© 2016 Elsevier B.V. All rights reserved.

organisms, the relationship between toxic mechanisms and ecophysiological responses to PPCPs still remains a great challenge in ecotoxicology (Roos et al., 2012). Diclofenac (DCF) is a classic non-steroidal, anti-inflammatory drug (NSAID) which is widely used in humans and animals. Therefore they were found in different aquatic media. Ternes et al. (1999) reported its presence at concentrations above 1.0 ␮g L−1 in wastewater treatment plant effluent and lower concentrations in surface water (Ternes et al., 1999). Other studies have reported DCF concentrations ranging from 10 to 2200 ng L−1 in effluent from wastewater treatment plants in many European countries (Letzel et al., 2009; Stülten et al., 2008). In China, it was reported that the median concentration of DCF was 7.0 ng L−1 (the Yellow River), 14.5 ng L−1 (Hai River), 13.4 ng L−1 (Liao River) and 17.6 ng L−1 (the Pearl River), respectively (Wang et al., 2010; Zhao et al., 2010). Studies indicated that DCF has the moderate toxic effects on algae, zooplankton and fish. Oaks et al. (2004) demonstrated that DCF was the main cause of decrease of vultures population in Pakistan (Oaks et al., 2004).

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

Daphnia magna, a freshwater crustacean, has been widely used in toxicity evaluation of chemicals because of its high sensitivity to a wide range of chemicals, a short life cycle, and ease of manipulation in laboratory. In addition, it is ubiquitously distributed among diverse freshwater lakes and ponds, and plays a key role in transfer of energy and nutrients to upper food webs, so it is also an important ecological sentinel species (Baird and Barata, 1998; Soetaert et al., 2006). It was reported that 48-h LC50 of DCF for a freshwater crustaceans, Daphnia magna, was 67 mg L−1 (Quinn et al., 2011). Studies have shown that 25 mg L−1 of DCF could inhibit the breeding of D. magna under a long-term exposure (Lee et al., 2011; Milan et al., 2013; Schuetz et al., 1996). These studies showed that DCF exposure may have detrimental effects on the growth and reproduction of D. magna. However, many questions still remain unresolved, such as the underlying toxic mechanisms of DCF to D. magna. Many environmental pollutants can change the expression of the detoxification- and antioxidant-related genes (Huggett et al., 1992), such as P450, glutathione S-transferase (GST), P-glycoprotein (P-gp), etc. and subsequently cause physiological changes of the exposed organisms. HR96, a putative toxicant receptor in the NR1J group of nuclear receptors in invertebrates, is a homologous gene of NR1I (VDR/CAR/PXR) group of nuclear receptors in mammals (Bertrand et al., 2004), which can regulate the expression of phase I, II and III detoxification genes (Hernandez et al., 2009; Qatanani and Moore, 2005; Swales and Negishi, 2004). Karimullina et al. observed repression of HR96 expression induced by chemicals such as triclosan, rostanol and fluoxetine (Karimullina et al., 2012). P450-dependent mixed-function oxidase (MFO) and antioxidant enzyme system play a pivotal role in the detoxification process of xenobiotics. It is reported that CYP3A, an important member in P450 family, is involved in various oxidative metabolism of drugs in vivo (Yamano et al., 1990). Therefore, the changes in CYP 3A subfamily are often used as a biomarker of exposure to xenobiotics. CYP360A8, homologous to CYP3A subfamily in invertebrate, is expected to respond to the exposure of DCF. CYP314 is involved in the biosynthesis of ecdysone, a crucial hormone related to the molt of crustaceans. Ecdysone combined with EcR can regulate targeted genes involved in development and reproduction of invertebrates (Rewitz and Gilbert, 2008; Rewitz et al., 2007). P-glycoprotein (Pgp) is mainly involved in the transport of extra- and endogenous substances across cellular membrane and plays an important role in the process of detoxification of exogenous substances. Antioxidant such as GST, SOD and CAT serve as scavengers to protect cells against ROS (reactive oxygen species) insult. There was reported antioxidant enzyme responses including CAT, SOD, GST and oxidative tissue damage to UV radiation and varying oxygen concentrations in Daphnia spp. (Borgeraas and Hessen, 2000; Borgeraas and Hessen, 2002a,b; Vega and Pizarro, 2000). Vitellogenin (Vtg), a precursor of yolk protein, is a major lipoprotein in many oviparous animals. Because the production of vitellogenin is controlled by some estrogen hormones so it is often used as a biomarker for exposure to estrogenic compounds (Jones et al., 2000; Matozzo et al., 2008). Thus, the physiological responses of organisms (e.g., survival, growth rate, and reproduction) may be closely related to the changes in gene expression at molecular level. It is possible that the changes of expression of these detoxification-related genes may provide an early warning before any irreversible damages in physiology occur. In the present study, D. magna was employed as our experimental organism and we evaluated the toxic effects of DCF on the expression of the seven genes (i.e. HR96, P-gp, CYP360A8, CYP314, GST, EcR and Vtg) of D. magna via an acute toxic test (96 h). Meanwhile, we investigated the physiological changes (e.g., survival, growth rate and reproduction) of D. magna through a 21-d chronic toxicity test. The objective of this study is aimed to provide insights into the relationship between changes of growth and reproduc-

105

tion in D. magna and its responses of detoxification-related genes under the DCF exposure. The results of this study should improve our understanding of the underlying mechanisms of DCF toxicity on aquatic invertebrates and provide a scientific basis for development of early diagnosis and bio-indicators for PPCPs such as DCF. 2. Materials and methods 2.1. Chemicals and reagents Diclofenac sodium (purity ≥96%, Beijing), and rifampicin (RIF, Beijing) was obtained from J&K Scientific Ltd. Trizol Reagent (Invitrogen, USA) was obtained from Ruishu, Guangzhou, China. All other reagents were analytical grade and obtained from commercial sources. 2.2. Daphnia magna Our culture of D. magna was originally obtained from Division of Life Science, Hong Kong University of Science and Technology (Kowloon, Hong Kong, China) and maintained under a constant 18h light/6-h dark cycle and a temperature of 23 ± 1 ◦ C at the Institute of Hydrobiology of Jinan University (Guangzhou, China) for over 6 years. They were cultured with M4 medium (OECD, 2004) and fed with Scenedesmus obliquus daily (0.5 × 10−6 cells mL−1 ) and the medium was renewed twice a week. 2.3. Sample collection and chemical exposure system Healthy and reproductive D. magna were selected to produce neonates (<24 h) for experiments, about 6 h before the toxicity experiments. We chose third or fourth brood neonates (<24 h) because they can be reproduced exclusively by parthenogenesis under this condition. In the acute toxicity test, exposure was carried out in a 250 mL glass beaker containing 200 mL of DCF solution. Test concentrations were prepared by dissolving diclofenac sodium salt in culture media with 10-fold serial dilution (control, 5, 50, 500 and 5000 ␮g L−1 ) for 24 h, 48 h and 96 h. One hundred and eighty individuals of D. magna were used per each concentration and each test was performed in triplicate. The range of test concentrations in this study was based on the preliminary experiment and the environmentally relevant concentration of DCF reported previously (Letzel et al., 2009; Stülten et al., 2008). In the chronic toxicity test, D. magna was exposed to five different concentrations of DCF: control, 5 ␮g L−1 , 50 ␮g L−1 , 500 ␮g L−1 and 5000 ␮g L−1 for 21 days. Exposure was carried out in a 50 mL glass beaker containing 20 mL of diclofenac solution, one neonate was placed in each beaker, and eight replicates were set up for each concentration. D. magna were fed daily (0.5 × 106 cells mL−1 of S. obliquus) and the test solution was refreshed daily. 2.4. Total RNA isolation and reverse transcription for quantitative real-time In each treatment, sixty DCF-treated neonates were transferred into a 2 mL centrifuge tube, rinsed with distilled water and kept on ice immediately. Total RNA was isolated from neonates with Trizol reagent (Invitrogen, USA), following the instructions of the manufacturer. After isolation, the concentrations and purity of the total RNA in the samples were measured using a Scientific NanoDrop2000 (NanoDrop Technologies Wilmington, USA). We then diluted the RNA samples with RNase free H2 O to maintain consistent concentrations. Reverse transcription was performed by using

106

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

Table 1 Primer sequences of the genes used for the RT-PCR in Daphnia magna. Genes

Forward primer (5 –3 )

Reverse primer (5 –3 )

Amplicon size (bp)

Origin

CYP314 CYP360A8 GST P-gp EcR HR96 Vtg ˇ-actin

ACTATGTATGGACTTCCCTGGTG TCGGCGAGATTTCACAGT GGGAGTCTTTTACCACCGTTTC CCACTTGCGTTCAACTTCTTC AGTCCGTCAGACGAGCATTC GTCTGGGAAAGTTTGTGGAGTCT CACTGCCTTCCCAAGAACAT GCCCTCTTCCAGCCCTCATTCT

TTATCGCGGGTGTCAACG GCACATTCGGTTATCAAGAC TCGCCAGCAGCATACTTGTT TTCGCCGATTGATGTTCC GGACGGTCCATTAATGTCAAG GAACCTGCGTGAACAGCATCTA ATCAAGAGGACGGACGAAGA TGGGGCAAGGGCGGTGATTT

194 150 150 158 87 169 66 189

GenBank: KC172920.1 Wang et al. (2016) Wang et al. (2016) GenBank: AB257771.1 Hannas et al. (2011) (In the present study) Hannas et al. (2011) Houde et al. (2013)

PrimeScriptTM RT reagent Kit (Takara, Japan) according to the manufacturer’s protocol. 2.5. Cloning of HR96 partial cDNAs in Daphnia magna For the gene sequences which are not available for D. magna, we designed the PCR primers to ascertain the partial sequences of targeted genes. The HR96 primers were designed with Primer 5.0 according to the conserved regions of the following D. pulex of HR96 sequences identified from GenBank: JQ026113.1. Total RNA was collected from D. magna induced by rifampicin and then was reverse transcribed into cDNAs. The partial cDNAs were amplified by PCR (Applied Biosystems, USA) in a solution of TaKaRa TaqTM (Takara, Japan), 18.25 ␮L of RNase-free water, 2.5 ␮L of 10× Buffer, 2 ␮L of dNTP Mixture (2.5 mM), 0.25 ␮L of Taq (2.5 U/␮L), 0.5 ␮L of 20 ␮M each primer, and 1 ␮L of first strand cDNA at a final volume of 25 ␮L under the following conditions: initial denaturation at 94 ◦ C for 4 min, 33 cycles of denaturation at 94 ◦ C for 40 s, primer annealing at 55 ◦ C for 40 s, an elongation at 72 ◦ C for 40 s, and 1 cycle of 72 ◦ C for 10 min. PCR products were analyzed on 2% agarose gels. The isolated gels were purified with a Gel Extraction Kit (Omega, USA), ligated with PMD 18-T Vector (Takara, Japan), and transformed into DH5␣ competent cells (Cwbiotech, China). Sequencing was performed by Sangon (Shanghai, China) and the identification of HR96 was confirmed using the NCBI Blastx program (http://blast.ncbi.nlm.nih. gov). 2.6. Quantitative real-time PCR In this study, a quantitative real-time polymerase chain reaction (RT-PCR) was used to analyze the responses of gene expression of D. magna exposed to DCF. The qPCR primers were designed according to the known sequences listed in Table 1, where the ␤-actin gene was used as an internal standard, and the other seven genes were used to analyze the response of expression in D. magna after exposure to DCF. As shown in Table 1, only the HR96 gene used for qPCR was cloned in our laboratory based on the reported D. pulex genome in formation in GenBank: JQ026113.1, CYP314 gene (GenBank: AB257771.1) and P-gp gene (GenBank: KC172920.1) was designed based on the NCBI sequence. The primer for CYP360A8 and GST was referred to our previous study (Wang et al., 2016). EcR and Vtg gene was designed according to a previous study (Hannas et al., 2011). The qPCR experiments were carried out by using SYBR Premix Ex TaqTM (Takara, Japan) with a Bio-Rad CFX96 Manager (Bio-Rad, USA) to amplify these genes. The cycling conditions were as follows: 95 ◦ C for 30 s, 40 cycles of 95 ◦ C for 5 s, 60 ◦ C for 30 s. At the end of each test, a melting curve analysis was done (plate read every 0.5 ◦ C from 55 to 95 ◦ C) to determine the formation of the specific products. Each 25 ␮L volume of reaction mixture contained 12.5 ␮L SYBR Premix Mix Taq (2×), 1 ␮L for each primer (10 ␮M), 2 ␮L cDNA, and was completed to a final volume of 25 ␮L with ultrapure ddH2 O. Gel electrophoresis and melting curve analyses were

performed to confirm correct amplicon size and the absence of nonspecific bands. The gene expression results were calculated by the 2−CT method (Livak and Schmittgen, 2001). Each reaction was conducted in triplicate to confirm the reproducibility of the results. 2.7. Chronic toxicity test Based on the preliminary experiments and the reported environmentally relevant concentrations of DCF, five concentrations (0, 5, 50, 500 and 5000 ␮g L−1 ) were selected for a 21-d chronic toxicity test. One neonate was placed in 20 mL of medium in a 50 mL beaker and was continuously exposed to DCF, and eight replicates were set up for each treatment. D. magna were fed daily (0.5 × 10−6 cells mL−1 of S. obliquus) and the test solution was refreshed daily. The survival, growth, development and reproduction of D. magna was monitored daily and the following parameters were recorded: number of molting per individual, days to the first brood, days to the first egg production, number of eggs in first brood, total number of molting per individual, total egg production per individual and mortality rate of produced offspring. At the end of the experiment, we measured the body length (from the top of its head to the base of its tail spine) of each female under the microscope with a micrometer, we also divided total number of offspring by mortality, and obtain the death rates of produced offspring, and calculated intrinsic rate (r) with the Euler-Lotka Eq. (1) (Stenner, 2008).



Ix Mx e−rx = 1

(1)

Ix : the proportion of individuals surviving to age × (days), Mx : the age-specific fecundity (number of neonates produced per surviving female between age x and x + 1). R: intrinsic rate. 2.8. Statistical analysis Statistical analysis was performed with SPSS Statistics 19.0 software. One-way analysis of variance (ANOVA) and LSD post hoc tests was used to evaluate the significance of differences between the exposure groups and control. Experimental data was reported as mean ± standard deviation, and the 95% confidence limits were calculated using the trimmed Spearman-Karber method. 3. Results 3.1. Nucleotide sequence and phylogenetic analysis of HR96 in Daphnia magna Because no information is available for HR96 gene in D. magna, so we firstly cloned the HR96 in D. magna in the present experiment. We obtained a full length of 643 bp of HR96 cDNA with an open reading frame (ORF) of 639 bp encoding for 213 amino acids (Fig. 1) with a predicted molecular weight of 23045. A phylogenic tree of the HR96 in D. magna was deduced according to the amino acid sequences of HR96 by using the MEGA 6.06

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

107

Fig. 1. Opening reading frame and deduced amino acid sequence of HR96 in Daphnia magna.

96 100

Habropoda laboriosa Melipona quadrifasciata

100

Dufourea novaeangliae Lasius niger

98 100

Trachymyrmex septentrionalis Zootermopsis nevadensis

100

Papilio xuthus Spodoptera frugiperda Anopheles darlingi

70

Lucilia cuprina

100 100

Drosophila melanogaster Stegodyphus mimosarum Tigriopus japonicus

88

▲Daphnia magna

76 100

Daphnia pulex

0.1 Fig. 2. Phylogenic tree of HR96 in Daphnia magna. (The GenBank accession numbers of the sequences used in the study are as follows: Habropoda laboriosa (KOC71036.1); Melipona quadrifasciata (KOX72721.1); Dufourea novaeangliae (KZC05898.1); Lasius niger (KMQ97091.1); Trachymyrmex septentrionalis (KYN45331.1); Zootermopsis nevadensis (KDR10212.1); Papilio xuthus (KPI93646.1); Spodoptera frugiperda (AFX60115.1); Anopheles darlingi (ETN65194.1); Lucilia cuprina (KNC27967.1); Drosophila melanogaster (NP 524493.1); Stegodyphus mimosarum (KFM75069.1); Tigriopus japonicus (AID52831.1); Daphnia pulex (AEX93434.1)).

108

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

Fig. 3. Effects of different concentrations of DCF on the HR96 and CYP360A8 in Daphnia magna after 24 h, 48 h and 96 h exposure. (Data represented means ± SD, n = 3). Significance of differences to the control is indicated by asterisks * (* means P < 0.05, ** means P < 0.01).

software in order to assess the phylogenetic relationships between species (Fig. 2). Results showed that HR96 of D. magna was more closely related to other crustaceans HR96 genes as compared to other species, such as insects and arachnids. These results are in agreement with the taxonomic position of the gene. 3.2. Effects of DCF on the gene expression of Daphnia magna after short-term exposure The expression profiles of seven selected genes of D. magna are shown in Fig. 3-5. HR96 was significantly inhibited (except for 500 ␮g L−1 ) after 24 h of DCF exposure, but gradually induced with the prolonged exposure after 48 h (except for 50 ␮g L−1 ). There was a gradually increasing expression trend with the concentration of DCF, displaying a dose-response relationship at 24 h and 48 h (Fig. 3); CYP360A8 showed a significant inhibition at low concentration (5 ␮g L−1 ) and induction at high concentrations (500 and 5000 ␮g L−1 ) after 24 h of DCF exposure. With the exposure time, significant induction was observed at 48 h for the expression of CYP360A8 in all concentrations, and then returned to the baseline but it was slightly inhibited at 96 h (Fig. 3). P-gp was significantly induced at 48 h (except for 5 ␮g L−1 ) but decreased to the baseline, even the lowest expression after 96 h exposure (Fig. 4); For GST, it was inhibited at low concentration (5 ␮g L−1 , 50 ␮g L−1 ) but induced at high concentration (5000 ␮g L−1 ) at 24 h, but an opposite

performance was observed at 48 h and 96 h in which GST displayed significantly induction at low concentration (5 ␮g L−1 , 50 ␮g L−1 ) (Fig. 4). As for CYP314, it was obviously inhibited following exposure for 24 h (except for 500 ␮g L−1 ). With the prolonged exposure time, CYP314 displayed a performance of being induced at low concentrations (5 ␮g L−1 and 50 ␮g L−1 , except for 5 ␮g L−1 at 48 h) but inhibited at high concentrations (500 ␮g L−1 and 5000 ␮g L−1 ) at 48 h and 96 h (Fig. 5). EcR was significantly inhibited at 24 h and 96 h (except for 500 ␮g L−1 ) but also significantly induced to a remarkable level at 48 h (except for 5 ␮g L−1 ). In terms of Vtg, it was induced at high concentrations of DCF (500 ␮g L−1 and 5000 ␮g L−1 ) after 24 h and 48 h exposure, but at 96 h it was induced only at low concentration (50 ␮g L−1 ) (Fig. 5). 3.3. Growth and reproduction performance of Daphnia magna exposed to diclofenac for 21-days The results of DCF chronic toxicity test are shown in Table 2. There was no observed lethality for D. magna at all concentrations during the entire period of 21 days. The day to the first brood and the day to the first egg production were significantly delayed at 50 ␮g L−1 . For example, the day to the first brood at 50 ␮g L−1 (8.1 ± 2.75 days) was significantly longer than the control (6.1 ± 0.83 days), and the day to the first egg production at 50 ␮g L−1 (10.5 ± 2.33 days) was also significantly longer than the

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

109

Fig. 4. Effects of different concentrations of DCF on the P-gp and GST in Daphnia magna after 24 h, 48 h and 96 h exposure. (Data represented means ± SD, n = 3). Significance of differences to the control is indicated by asterisks * (* means P < 0.05, ** means P < 0.01).

control (8.1 ± 0.83 days). However, there were no significant differences observed among the molting frequency, number of eggs in the first production, total egg production per female, total number of broods per female, death rate of offspring, body length and intrinsic growth rate. It was found that a negative correlation with DCF concentrations was observed with the molting frequency, death rate of offspring and intrinsic growth rate. 4. Discussion 4.1. Effect of diclofenac on the expression of detoxification-related genes of Daphnia magna As we know, when organisms were exposed to toxic chemicals, the metabolic activity in organisms can adjust to overcome the stress derived from exposure to toxicants, especially the defense system related to detoxification which was expected to respond to toxic chemicals (Ankley and Villeneuve, 2006). In the present study, seven selected genes related to the detoxification system, development and reproduction (i.e. HR96, P-gp, CYP360A8, CYP314, GST, EcR and Vtg) were employed to investigate the toxic effects of DCF and provide new insights into the molecular mechanisms of DCF on the growth and reproduction of D. magna. HR96, a putative toxicant receptor in the NR1J group of nuclear receptors in invertebrates, is homologous gene of NR1I

(PXR/CAR/VDR) group of nuclear receptors (NRs) in vertebrates (Bertrand et al., 2004). PXR and CAR are adopted nuclear receptors activated by a variety of ligands, including endogenous substance such as bile acids, steroids, and many xenobiotics (Kretschmer and Baldwin, 2005), and in turn regulate the expression of phase I, II and III detoxification enzymes in vertebrates (Hernandez et al., 2009; Qatanani and Moore, 2005; Swales and Negishi, 2004). In the present study, the expression of HR96 was significantly inhibited after 24 h of exposure and then gradually increased with the increasing concentration of DCF, displaying a dose-response relationship. Similar obervation was reported in previous studies in which triclosan can repress HR96 activation (Karimullina et al., 2012). To our knowledge, HR96 is a promiscuous receptor and responses to the exposure of many structurally and functionally diverse chemicals. In mammals, PXR can adjust the transcription of P450s, and CYP3A, as an important member in P450 superfamily, is involved in oxidative metabolism of various drugs in vivo (Yamano et al., 1990). CYP 360A8, a homologue gene to CYP3A in vertebrates, was shown to have a significant induction after 48 h of exposure, which is similar to the expression of HR96 at 48 h (except for 500 ␮g L−1 ), then the expression dropped to the baseline level at 96 h (Fig. 3). The expression of CYP314 was inhibited following exposure for 24 h similar to the expression of HR96 at 24 h (Fig. 5). This suggested that HR96 takes part in the transcription regulation

110

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

Table 2 The performance of growth,development and reproduction of Daphnia magna during a 21-days diclofenac exposure. DCF (␮g L−1 )

Molting frequency

Days to the first brood (d)

Days to the first egg production (d)

Eggs amount in Total egg the first production production (n) number per individual (n)

Total number of broods per individual (n)

Death rates (offspring)

Body length

Intrinsic growth rate

0 5 50 500 5000

11.1 ± 0.93 11.0 ± 0.76 11.3 ± 0.71 10.7 ± 0.95 10.8 ± 0.71

6.1 ± 0.83 6.0 ± 0.76 8.1 ± 2.75* 5.7 ± 0.76 6.3 ± 1.66

8.1 ± 0.83 9.1 ± 2.75 10.5 ± 2.33* 8.9 ± 1.35 9.0 ± 1.69

5.1 ± 1.36 4.6 ± 2.39 4.5 ± 2.00 4.1 ± 2.54 3.5 ± 2.39

26.6 ± 8.68 28.4 ± 12.08 27.4 ± 14.37 33.6 ± 7.18 27.6 ± 11.49

13.9% ± 0.18 19.8% ± 0.19 11.3% ± 0.08 10.6% ± 0.07 10.6% ± 0.09

3.7 ± 0.21 3.8 ± 0.14 3.4 ± 0.45 3.8 ± 0.16 3.6 ± 0.26

0.26 ± 0.03 0.23 ± 0.07 0.21 ± 0.06 0.23 ± 0.03 0.22 ± 0.04

4.5 ± 0.53 4.8 ± 1.16 4.4 ± 0.92 5.2 ± 0.38 4.5 ± 1.60

Note: Values are mean ± SD; n = 8; significant results, in comparison with the control, were indicated by asterisks. *P < 0.05.

Fig. 5. Effects of different concentrations of DCF on the CYP314, EcR and Vtg in Daphnia magna after 24 h, 48 h and 96 h exposure. (Data represented means ± SD, n = 3). Significance of differences to the control is indicated by asterisks * (* means P < 0.05, ** means P < 0.01).

of CYP314 and CYP360A8, indicating CYP360A8 gene and HR96 gene may play an important role in catalyzing detoxification of DCF. P-gp is an important member of the ABC family related to MXR/MDR, depending on the ATP energy to transport extragenous substrate across the plasma membrane. In aquatic organisms Pgp is localized in eggs, embryos, larvae and gills and represent an environment-tissue barrier (Campos et al., 2014; Faria et al., 2011; Shipp and Hamdoun, 2012; Smital et al., 2004). Studies demonstrated that DCF caused mitochondrial membrane damage and changed the membrane permeability in vertebrate liver cells (Boelsterli, 2003). Similar to vertebrate, the expression of P-gp may be expected to respond to DCF exposure in D. magna. The

results showed that P-gp gene expression was inhibited slightly or no obvious change was observed following 24 h of exposure. However, with the extension of exposure time, it was generally significantly induced at 48 h (except for 5 ␮g L−1 ). At this point, the up-regulation of P-gp was in line with CYP360 response. In the study of the expression of CYP3A4 and P-gp in the human cancer cell lines LS180, it was found that the influencing inducers of CYP3A4 like rifampicin and phenobarbital could effectively regulate the expression of P-gp (Schuetz et al., 1996). It was reported that CYP450s and ABCs proteins could be concerted with each other to deal with multiple xenobiotics exposure (Goldstone et al., 2006). In the present study it was also confirmed that DCF induced the CYP3A homo-

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

logue, CYP360 expression, could also adjust the expression of P-gp. But after a long exposure (96 h), P-gp gene expression decreased to the lowest level, the same as CYP360 response at 96 h. A tentative inference on this result is that a high expression of CYP360 and P-gp gene accelerated the DCF detoxification and pumping the drug out of the cell, when DCF concentration was no longer maintained at high levels, the P-gp expression then dropped. Glutathione S-transferase (GST) is a class of phase II enzymes, providing important protective mechanisms against ROS. In the present study, time-dependent relationship of GST expression exposed to DCF was observed. For short exposure (24 h) of DCF, the expression of GST was inhibited at low concentrations (5 ␮g L−1 and 50 ␮g L−1 ), but was significantly induced at 48 h and 96 h (Fig. 4). The results suggested short-term DCF stress can suppress GST transcription, but stimulate it under long-term DCF stress. It indicated that GST plays a vital role in ROS removal. The low expression of short-term exposure is probably related to the disturbance caused by DCF. The homeostasis of organisms was disturbed transiently when pollutants just entered into the cells, and the response of defense-related enzymatic activity has not been high enough to trigger the gene expression. It was reported that the induction of GST activity seems to be related to CYP activity, since treatment with SKF535A, a CYP inhibitor, blocked the DR1-dependent GST induction (Yu et al., 2015). Our data showed that a similar trend between GST and CYP was observed at low concentration for 24 h and 48 h (Figs. 3 and 4). However, the relationship between changes of gene and enzymatic activity responses is very complex. It was reported that the expression of some genes including GST is regulated by transcription factors in a transcriptional or post transcriptional manner (Kim and Lee, 2007), and there is discrepancy between genes and its products (Milan et al., 2013; Regoli and Giuliani, 2014), therefore, further study on the relationship between enzymatic activity and gene expression is required. 4.2. Toxicity of diclofenac on growth, development and reproduction of Daphnia magna Vitellogenin (Vtg) is the precursor of the common egg-yolk protein, vitellin, which provides an energy supply for the embryo development in oviparous animals. The production of vitellogenin is controlled by estrogen hormones, so it is often used as a biomarker for estrogenic compound exposure (Jones et al., 2000; Matozzo et al., 2008). Researchers found Vtg did not show any differences in D. magna after exposure to glyphosate or methidathion (Le et al., 2011; Le et al., 2010). In contrast to these studies, the present study showed that the expression of Vtg was induced at high concentrations (500 ␮g L−1 and 5000 ␮g L−1 ) of DCF after 24 h and 48 h of exposure, and at low concentration (50 ␮g L−1 ) at 96 h. These results suggested that DCF acts as an endocrine disruptor in D. magna. The use of vitellogenin mRNA expression has also been suggested as a rapid biomarker of reproductive effects in toxicant assessments with cladocerans (Soetaert et al., 2006). In the 21-d chronic toxicity experiment, the day to the first brood and the day to the first egg production both delayed at 50 ␮g L−1 compared to the control (Table 2), indicating that DCF has effects on the reproduction of D. magna. However, this result was in contrary to long-standing assumptions that high expression of Vtg may cause positive effects on the reproduction capability of D. magna. Le et al. (2011) found Vtg gene expression had no significant difference during the 24-h short-term exposure of verapamil and tramadol, but significantly reduced during the 21-d long exposure. These results revealed that the estrogenic inhibition to D. magna caused by the pharmaceuticals was stronger in the chronic exposure than in the acute exposure (Le et al., 2011). Therefore, we supposed that there may be a down-regulation of Vtg gene in 21-d long-term DCF exposure. However, further study on gene expression is required.

111

CYP314 involved in the biosynthesis of ecdysone, which combined with EcR (ecdysone receptor) can regulate developmentrelated target genes, and control molt processes (Rewitz and Gilbert, 2008; Rewitz et al., 2007). Our results showed that the expression of CYP314 was induced at low concentrations (5 ␮g L−1 and 50 ␮g L−1 ) at 48 h and 96 h (except for 5 ␮g L−1 at 48 h). EcR was also significantly induced to a remarkable level at 48 h (except for 5 ␮g L−1 ) (Fig. 5). However, in contrary to the high expression of HR96, CYP314 and EcR, there were no significant differences in the molting frequency during 21-d chronic experiment (Table 2), in which only a downward trend was observed with the increase of DCF concentrations. In arthropods, ecdysteroids regulate development, reproduction, and especially the periodic shedding of the exoskeleton (ecdysis) in combination of EcR (Brown et al., 2009; Riddiford et al., 2003; Subramoniam, 2000). EcR forms a heterodimer with another nuclear receptor, the retinoid X receptor (RXR), this functional EcR:RXR heterodimer is sometimes referred to as the “ecdysteroid receptor” (Kim et al., 2005; Yao et al., 1993). Binding of ecdysteroids activates the EcR-RXR dimer and regulates transcription of target genes through ecdysteroid responsive elements on the DNA (Thomas et al., 1993; Yao et al., 1993). Thereby, the process of molting may not only be involved in the expression of EcR, CYP 314 but also related to RXR. In addition, HR96 and other NRs also may be involved in ecdysone response pathway (Karimullina et al., 2012; Hwang et al., 2016), as displayed in the present experiment, HR96 was also significantly induced at 48 h and 96 h under DCF exposure. Therefore, it is possible that DCF could act as an endocrine disruptor via altering ecdysone response pathway (EcR and HR96 are affected) and/or affecting the ecdysone synthesis (Cyp314 is altered). As we know, the gene expression profile is always dynamics and changes are transient, related to both exposure duration and concentration, therefore more investigation is required to explain the contradiction between gene up-regulation (i.e. CYP314 and EcR) and undifferentiated molting frequency performances. Some studies showed that the development and reproduction are more sensitive indicators than the survival in D. magna (Buhl et al., 1993; Le et al., 2011; Villarroel et al., 2003), this was also observed in this present study. This research indicated that DCF had adverse impacts on the development and reproduction of D. magna in the 21-d exposure (Table 2). The significant changes in the development and reproduction parameters (i.e., days to the first brood and days to the first egg production observed at 50 ␮g L−1 of DCF) suggested that the development and reproduction parameters were more sensitive endpoints than the survival and growth for evaluating the toxicity of DCF to aquatic invertebrates.

5. Conclusion In this study, we evaluated the toxic effects of DCF on D. magna through investigating the physiological changes (e.g., survival, growth rate, development and reproduction) and analyzing the expression of the seven selected genes (i.e. HR96, P-gp, CYP360A8, CYP314, GST, EcR and Vtg). Varying toxic effects of DCF to D. magna were observed. These gene expressions in D. magna provided better insights into the molecular toxic mechanisms of DCF. Doseand time-dependent relationships between the gene expression of the seven selected gene after DCF exposure were observed. In chronic experiment, the data suggested that the development and reproduction parameter are both more sensitive endpoints than the survival and growth for evaluating the toxicity of DCF. The intrinsic relationship may exist between the expression of HR96, CYP314, EcR and Vtg genes and the molting frequency, reproduction performance of D. magna under DCF exposure. Further study is needed

112

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113

to investigate the relationship between the genes response and physiological changes. Acknowledgments This work was supported by the National Natural Science Foundation of China (NSFC 41576110). Special thanks to Dr. Martin Tsui at the University of North Carolina at Greensboro for reviewing the manuscript draft. References Ankley, G.T., Villeneuve, D.L., 2006. The fathead minnow in aquatic toxicology: past, present and future. Aquat. Toxicol. 78, 91–102. Baird, D.J., Barata, C., 1998. Genetic variation in the response of Daphnia to toxic substances: implications for risk assessment. In: Forbes, V.E. (Ed.), Genetics in Ecotoxicology. Taylor and Francis, New York, pp. 207–221. Bertrand, S., Brunet, F.G., Escriva, H., Parmentier, G., Laudet, V., Robinson-Rechavi, M., 2004. Evolutionary genomics of nuclear receptors: from twenty-five ancestral genes to derived endocrine systems. Mol. Biol. Evol. 21, 1923–1937. Boelsterli, U.A., 2003. Diclofenac-induced liver injury: a paradigm of idiosyncratic drug toxicity. Toxicol. Appl. Pharmacol. 192, 307–322. Borgeraas, J., Hessen, D.O., 2000. UV-B induced mortality and antioxidant enzyme activities in Daphnia magna at different oxygen concentrations and temperatures. J. Plankton Res. 22, 1167–1183. Borgeraas, J., Hessen, D.O., 2002a. Diurnal patterns of antioxidant activity in alpine and arctic Daphnia under in situ UV-radiation. Arch. Hydrobiol. 156, 83–95. Borgeraas, J., Hessen, D.O., 2002b. Variations of antioxidant enzymes in Daphnia species and populations as related to ambient UV exposure. Hydrobiologia 477, 15–30. Brown, M.R., Sieglaff, D.H., Rees, H.H., 2009. Gonadal ecdysteroidogenesis in arthropoda: occurrence and regulation. Annu. Rev. Entomol. 54, 105–125. Buhl, K.J., Hamilton, S.J., Schmulbach, J.C., 1993. Chronic toxicity of the bromoxynil ® formulation Buctril to Daphnia magna exposed continuously and intermittently. Arch. Environ. Contam. Toxicol. 25, 152–159. ˜ B., Barata, C., Luckenbach, Campos, B., Altenburger, R., Gómez, C., Lacorte, S., Pina, T., 2014. First evidence for toxic defense based on the multixenobiotic resistance (MXR) mechanism in Daphnia magna. Aquat. Toxicol. 148, 139–151. ˜ B., Barata, C., 2011. Characterization of Faria, M., Navarro, A., Luckenbach, T., Pina, the multixenobiotic resistance (MXR) mechanism in embryos and larvae of the zebra mussel (Dreissena polymorpha) and studies on its role in tolerance to single and mixture combinations of toxicants. Aquat. Toxicol. 101, 78–87. Goldstone, J.V., Hamdoun, A., Cole, B.J., Howard-Ashby, M., Nebert, D.W., Scally, M., Dean, M., Epel, D., Hahn, M.E., Stegeman, J.J., 2006. The chemical defensome: environmental sensing and response genes in the Strongy locentrotus purpuratus genome. Dev. Biol. 300, 366–384. Hannas, B.R., Wang, Y.H., Thomson, S., Kwon, G., Li, H., LeBlanc, G.A., 2011. Regulation and dysregulation of vitellogenin mRNA accumulation in daphnids (Daphnia magna). Aquat. Toxicol. 101, 351–357. Hernandez, J., Mota, L., Baldwin, W., 2009. Activation of CAR and PXR by dietary, environmental and occupational chemicals alters drug metabolism, intermediary metabolism, and cell proliferation. Curr. Pharmacogenomics Person. Med. 7, 81–105. Houde, M., Carter, B., Douville, M., 2013. Sublethal effects of the flame retardant intermediate hexachlorocyclopentadiene (HCCPD) on the gene transcription and protein activity of Daphnia magna. Aquat. Toxicol. 140–141, 213–219. Huggett, R.J., Kimerle, R.A., Mehrle, P.M., 1992. Biomarkers: Biochemical, Physiological and Histological Makers of Anthropogenic Stress. Lew, Chelsea. Hwang, D.S., Han, J.H., Won, E.J., Kim, D.H., Jeong, C.B., Hwang, U.K., Zhou, B.S., Choe, J.H., Lee, J.S., 2016. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus. Aquat. Toxicol. 177, 285–294. Jones, P.D., De Coen, W.M., Tremblay, L., Giesy, J.P., 2000. Vitellogenin as a biomarker for environmental estrogens. Water Sci. Technol. 42, 1–14. Jones, O.A.H., Voulvoulis, N., Lester, J.N., 2001. Human pharmaceuticals in the aquatic environment a review. Environ. Technol. 22, 1383–1394. Karimullina, E., Li, Y., Ginjupalli, G.K., Baldwin, W.S., 2012. Daphnia HR96 is a promiscuous xenobiotic and endobiotic nuclear receptor. Aquat. Toxicol. 116–117, 69–78. Kim, S.G., Lee, S.J., 2007. PI3K RSK, and mTOR signal networks for the GST gene regulation. Toxicol. Sci. 96, 206–213. Kim, H.-W., Chang, E.S., Mykles, D.L., 2005. Three calpains and ecdysone receptor in the land crab Gecarcinus lateralis: sequences, expression and effects of elevated ecdysteroid induced by eyestalk ablation. J. Exp. Biol. 208, 3177–3197. Kretschmer, X.C., Baldwin, W.S., 2005. CAR and PXR: Xenosensors of endocrine disrupters? Chem. Biol. Interact. 155, 111–128. Le, T.-H., Lim, E.-S., Lee, S.K., Choi, Y.-W., Kim, Y.-H., Min, J., 2010. Effects of glyphosate and methidathion on the expression of the Dhb, Vtg, Arnt, CYP4 and CYP314 in Daphnia magna. Chemosphere 79, 67–71. Le, T.-H., Lim, E.-S., Lee, S.-K., Park, J.-S., Kim, Y.-H., Min, J., 2011. Toxicity evaluation of verapamil and tramadol based on toxicity assay and expression patterns of

Dhb, Vtg, Arnt, CYP4, and CYP314 in Daphnia magna. Environ. Toxicol. 26, 515–523. Lee, J., Ji, K., Lim Kho, Y., Kim, P., Choi, K., 2011. Chronic exposure to diclofenac on two freshwater cladocerans and Japanese medaka. Ecotoxicol. Environ. Saf. 74, 1216–1225. Letzel, M., Metzner, G., Letzel, T., 2009. Exposure assessment of the pharmaceutical diclofenac based on long-term measurements of the aquatic input. Environ. Int. 35, 363–368. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2C T method. Methods 25, 402–408. Matozzo, V., Gagné, F., Marin, M.G., Ricciardi, F., Blaise, C., 2008. Vitellogenin as a biomarker of exposure to estrogenic compounds in aquatic invertebrates: a review. Environ. Int. 34, 531–545. Milan, M., Pauletto, M., Patarnello, T., Bargelloni, L., Marin, M.G., Matozzo, V., 2013. Gene transcription and biomarker responses in the clam Ruditapes philippinarum after exposure to ibuprofen. Aquat. Toxicol. 126, 17–29. Montforts, M.H.M.M., Brandt, I., Hutchinson, T.H., 2007. Summary of workshop on environmental assessment of human medicines: development and use of aquatic toxicity data. Drug Inf. J. 41, 203–209. OECD, 2004. OECD Guideline for Testing of Chemicals 202-Daphnia Sp., Acute Immobilisation Test Organization for the Economic Cooperation and Development. OECD, Paris. Oaks, J.L., Gilbert, M., Virani, M.Z., Watson, R.T., Meteyer, C.U., Rideout, B.A., Shivaprasad, H.L., Ahmed, S., Iqbal Chaudhry, M.J., Arshad, M., Mahmood, S., Ali, A., Ahmed Khan, A., 2004. Diclofenac residues as the cause of vulture population decline in Pakistan. Nature 427, 630–633. Qatanani, M., Moore, D.D., 2005. CAR, the continuously advancing receptor, in drug metabolism and disease. Curr. Drug Metab. 6, 329–339. Quinn, B., Schmidt, W., O’Rourke, K., Hernan, R., 2011. Effects of the pharmaceuticals gemfibrozil and diclofenac on biomarker expression in the zebra mussel (Dreissena polymorpha) and their comparison with standardised toxicity tests. Chemosphere 84, 657–663. Regoli, F., Giuliani, M.E., 2014. Oxidative pathways of chemical toxicity and oxidative stress biomarkers in marine organisms. Mar. Environ. Res. 93, 106–117. Rewitz, K.F., Gilbert, L.I., 2008. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: evolutionary implications. BMC Evol. Biol. 8, 60. Rewitz, K.F., O’Connor, M.B., Gilbert, L.I., 2007. Molecular evolution of the insect Halloween family of cytochrome P450s: phylogeny, gene organization and functional conservation. Insect Biochem. Mol. Biol. 37, 741–753. Riddiford, L.M., Hiruma, K., Zhou, X., Nelson, C.A., 2003. Insights into the molecular basis of the hormonal control of molting and metamorphosis from Manduca sexta and Drosophila melanogaster. Insect Biochem. Mol. Biol. 33, 1327–1338. Roos, V., Gunnarsson, L., Fick, J., Larsson, D.G.J., Rudén, C., 2012. Prioritising pharmaceuticals for environmental risk assessment: towards adequate and feasible first-tier selection. Sci. Total Environ. 421 (421–422), 102–110. Schuetz, E.G., Beck, W.T., Schuetz, J.D., 1996. Modulators and substrates of P-glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol. Pharmacol. 49, 311–318. Shipp, L.E., Hamdoun, A., 2012. ATP-binding cassette (ABC) transporter expression and localization in sea urchin development. Dev. Dyn. 241, 1111–1124. Smital, T., Luckenbach, T., Sauerborn, R., Hamdoun, A.M., Vega, R.L., Epel, D., 2004. Emerging contaminants—pesticides, PPCPs, microbial degradation products and natural substances as inhibitors of multixenobiotic defense in aquatic organisms. Mutat. Res. 552, 101–117. Soetaert, A., Moens, L.N., Van der Ven, K., Van Leemput, K., Naudts, B., Blust, R., De Coen, W.M., 2006. Molecular impact of propiconazole on Daphnia magna using a reproduction-related cDNA array. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 142, 66–76. Spindler, P., Montforts, M., Olejniczak, K., Koschorreck, J., Vidal, J.-M., Johansson, A.-K., Stemplewski, H., Virtanen, V., Rönnefahrt, I., Kristensen, S., Laan, J.-W., 2007. Environmental assessment for human medicines in the European Union. Drug Inf. J. 41, 149–154. Stülten, D., Zühlke, S., Lamshöft, M., Spiteller, M., 2008. Occurrence of diclofenac and selected metabolites in sewage effluents. Sci. Total Environ. 405, 310–316. Stackelberg, P.E., Furlong, E.T., Meyer, M.T., Zaugg, S.D., Henderson, A.K., Reissman, D.B., 2004. Persistence of pharmaceutical compounds and other organic wastewater contaminants in a conventional drinking-water-treatment plant. Sci. Total Environ. 329, 99–113. Stenner, R.D., 2008. in: Kees Van Leeuwen, Theo Vermeire (Eds.): Risk assessment of chemicals–an introduction. Environ Sci Pollut Res. 15,450–451. Subramoniam, T., 2000. Crustacean ecdysteriods in reproduction and embryogenesis. Comp. Biochem. Physiol. 125, 135–156. Swales, K., Negishi, M., 2004. CAR, driving into the future. Mol. Endocrinol. 18, 1589–1598. Ternes, T.A., Stumpf, M., Mueller, J., Haberer, K., Wilken, R.D., Servos, M., 1999. Behavior and occurrence of estrogens in municipal sewage treatment plants – I. Investigations in Germany, Canada and Brazil. Sci. Total Environ. 225, 81–90. Thomas, H.E., Stunnenberg, H.G., Stewart, A.F., 1993. Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362, 471–475. Vega, M.P., Pizarro, R.A., 2000. Oxidative stress and defence mechanisms of the freshwater cladoceran Daphnia longispina exposed to UV radiation. J. Photochem. Photobiol. B 54, 121–125.

Y. Liu et al. / Aquatic Toxicology 183 (2017) 104–113 Villarroel, M.J., Sancho, E., Ferrando, M.D., Andreu, E., 2003. Acute, chronic and sublethal effects of the herbicide propanil on Daphnia magna. Chemosphere 53, 857–864. Wang, L., Ying, G.G., Zhao, J.L., Yang, X.B., Chen, F., Tao, R., Liu, S., Zhou, L.-J., 2010. Occurrence and risk assessment of acidic pharmaceuticals in the Yellow River: Hai River and Liao River of north China. Sci. Total Environ. 408, 3139–3147. Wang, L., Peng, Y., Nie, X., Pan, B., Ku, P., Bao, S., 2016. Gene response of CYP360A, CYP314, and GST and whole-organism changes in Daphnia magna exposed to ibuprofen. Comp. Biochem. Physiol. Part C: Toxicol. Pharmacol. 179, 49–56. Yamano, S., Tatsuno, J., Gonzalez, F.J., 1990. The CYP2A3 gene product catalyzes coumarin 7-hydroxylation in human liver microsomes. Biochemistry 29, 1322–1329.

113

Yao, T.P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D., McKeown, M., Cherbas, P., Evans, R.M., 1993. Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366, 476–479. Yu, T.H., Dafre, A.L., Umbuzeiro, G.D.A., Franciscon, E., 2015. CYP-dependent induction of glutathione S-transferase in Daphnia similis exposed to a disperse azo dye. Ecotoxicology 24, 232–237. Zhao, J.L., Ying, G.G., Liu, Y.S., Chen, F., Yang, J.F., Wang, L., Yang, X.B., Stauber, J.L., Warne, M.S.J., 2010. Occurrence and a screening-level risk assessment of human pharmaceuticals in the Pearl River system, South China. Environ. Toxicol. Chem. 29, 1377–1384.