Toxic effects of microcystin-LR on the reproductive system of male Rana nigromaculata in vitro

Aquatic Toxicology 126 (2013) 283–290

Contents lists available at SciVerse ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Toxic effects of microcystin-LR on the reproductive system of male Rana nigromaculata in vitro Hangjun Zhang, Chenchen Cai, Yingzhu Wu, Binhui Ye, Li Han, Xiaolu Shou, Mengdi Wang, Jia Wang, Xiuying Jia ∗ Department of Environmental Sciences, Hangzhou Normal University, Xuelin Road 16#, Xiasha Gaojiao Dongqu, Hangzhou, Zhejiang Province, 310036, China

a r t i c l e

i n f o

Article history: Received 2 February 2012 Received in revised form 17 September 2012 Accepted 22 September 2012 Keywords: MCLR Frog Reproductive toxicity Testis

a b s t r a c t This study aims to demonstrate that microcystin-LR (MC-LR) has toxic effects on the reproductive system of male Rana nigromaculata in vitro. R. nigromaculata were treated with 0, 0.1, 1, 10, and 100 nmol/L of MC-LR for 6 h. Results show that exposure to 1 nmol/L to 100 nmol/L of MC-LR decreased sperm motility and number of sperm cells and increased the sperm abnormality rate, whose values were significantly different from those of the control (P < 0.01). Moreover, the same dosage of MC-LR increased reactive oxygen species production and malondialdehyde content. At the same time, antioxidant enzyme (catalase and glutathione S-transferase) activity and glutathione reduced content rapidly increased, whereas antioxidant enzyme superoxide dismutase activity significantly decreased. These results imply that the defense system of the testes quickly responds to oxidative stress. Ultrastructural observation shows distention of the mitochondria, endoplasmic reticulum, and Golgi apparatus and changes in the mitochondrial matrix color, cristae number, and morphology. Moreover, using real-time PCR, increased relative expressions of P450 aromatase and SF-1 genes were observed. The results demonstrate for the first time that MC-LR could induce toxicity in the male reproductive system of R. nigromaculata. The findings in this research will provide more insights into the relationships between aquatic microcystins and amphibians. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The attenuation of global amphibian populations has become a serious problem worldwide. The decline in the number of amphibian species has been widely reported (Joseph et al., 2001; Stuart et al., 2004; Palen and Schindlerb, 2010) since Wake (1991) first discussed the issue in Science. Over the past 50 years, global amphibian populations have quickly declined and some species have become extinct (Zhou et al., 2004). Studies show that the populations of 2468 amphibian species (43.2%) have decreased, whereas only 28 species (0.5%) have increased. Moreover, the populations of 1552 species (27.2%) have remained constant, whereas the population trends of 1661 species (29.1%) have remained unknown (Stuart et al., 2004). The decline in amphibian populations has a major impact on other biological organisms because amphibians are an important part of the ecosystem (Wu and Li, 2004). Hayes et al. (2010a) reported that environmental pollutants are one of the primary factors that decrease amphibian populations because of their potential to cause immunosuppression.

∗ Corresponding author. Tel.: +86 571 28865327; fax: +86 571 28865327. E-mail address: [email protected] (X. Jia). 0166-445X/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquatox.2012.09.017

Amphibians often encounter mixed chemicals in wetlands within or near agricultural lands (Boone and Stacy, 2003), and their highly permeable skins make them more sensitive to environmental toxins (Alford and Richards, 1999). Paraquat inhibits testosterone and 17b-estradiol production in amphibian gonads (Luana et al., 2009). Herbicide atrazine is one of the most used pesticides worldwide (Battaglin et al., 2009), and it can travel over 1000 km as precipitate and pollute pristine amphibian habitats (Hayes et al., 2010b). The present study demonstrates that male amphibians exposed to atrazine develop problems in their reproductive systems and that these male amphibians are completely feminized when they reach adulthood (Hayes et al., 2010b). Currently, algal bloom is a prominent water environment problem. The ecological risk lies in microcystins (MCs), which are metabolites released by algal blooms. MCs are a class of biologically active single cyclic heptapeptides mainly produced by the freshwater algae Microcystis aeruginosa (Jiang et al., 2011). MCs have 70 different isomers (de Figueiredo et al., 2004). MCs can strongly inhibit the activity of protein phosphatases, such as PP1 and PP2A (Li et al., 2011). Prolonged exposure of fish and mammals to MCs at low doses may also cause many adverse effects (Milutinovic et al., 2002). MC-LR induces lymphocyte apoptosis and impairs fish immune functions (Zhang et al., 2006) and has adverse effects on mammals (Ding et al., 2006; Dong et al., 2008).

284

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

Li et al. (2008) reported that MC-LR could cause chronic toxicity to the reproductive systems of male rats. MC-LR can also damage the testes and epididymis through Leydig cell apoptosis, erratic secretions of testosterone, luteinizings and follicle-stimulating hormones, and impaired sperm production. Finally, MC-LR can induce oxidative stress and ultrastructural changes in prepubertal rabbit testes (Liu et al., 2010). The embryos and larvae of Xenopus laevis have been used to quantify MC-LR and MC-RR uptake (Fischer and Dietrich, 2000). Despite the large body of work on MC-LR hepatotoxicity, information on its potential to induce reproductive toxicity on male amphibians is limited. The time between late spring and early summer is an important period for frogs and other amphibians to spawn. If MCs can induce reproductive toxicity in male amphibians, it is bound to cause a significant impact on amphibian population decline. This study investigates the influence of MCs on frogs (Rana nigromaculata) in vitro. We studied the reproductive toxicity in frogs exposed to low doses of MCs to clarify the dose–response relationship and to determine whether MC-LR can induce oxidative damage in the reproductive toxicity of male amphibians at the molecular level. This study aims to clarify the relationship between the widespread pollution induced by MCs in aquatic ecosystems and the decline in amphibian species population.

minced into pieces using an ophthalmic scissor to suspend the sperm in liquid. The sperm counts were determined using a hemocytometer. Twenty microliters of the sperm suspension was observed on a slide for 2 min. For the sperm motility study, 20 ␮L of the sperm suspension was placed on the hemocytometer slide and observed under a light microscope (400×), and the different activity levels of the sperm number were recorded. The ability of the sperm was identified using four criteria (Jia et al., 2009). Rapid linear motion indicated good activity (a); lively movement with uncertain direction indicated normal activity (b); slow movement or in situ rotation indicated bad activity (c); and absence of motion indicated sperm death (d). The percentage of sperm motility () was calculated using the formula  = (a + b + c)/(a + b + c + d) (Jia et al., 2009). For the sperm deformity study, 800 ␮L of the sperm suspension was filtered through four layers of lens paper to clean the tissue fragments. Then, the filtrate was centrifuged at 400 × g for 5 min. The supernatant was removed, and the remaining liquid with precipitate was slightly agitated. Methanol was added to the filtrate for 5–10 min, and 1% of EosinY was added for staining. Ten microliters of the stained liquid was placed on a hemocytometer slide to observe the sperm morphology under a light microscope (400×). The percentage of abnormal sperms was recorded.

2. Materials and methods

2.4. MDA content measurement

2.1. Chemicals

MDA is the degradation product of lipid peroxidation, which could contract with thiobarbituric acid (TBA) to form a red product with the maximum absorption peak at 532 nm. Thus, MDA content was determined using TBA and commercial detection kits in a spectrophotometer at 532 nm. The MDA content was expressed as nanomoles per milligram of protein. The protein content was determined using the Bradford method.

MC-LR and Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Alex (USA) and Saigon, respectively. Malondialdehyde (MDA), superoxide dismutase (SOD), glutathione reduced (GSH), glutathione S-transferase (GST), and catalase (CAT) assay kits were purchased from Nanjing Jiancheng Bioengineering, Inc. (Nanjing, Jiangsu, China). 2.2. Animals and treatment

2.5. Reactive oxygen species (ROS) content measurement

Healthy adult male R. nigromaculata were collected from the Hangzhou suburbs. The frogs were kept in an aquarium with water and food for 24 h prior to all experiments. A total of 240 frogs were randomly divided into 6 groups (zero time control, control, 0.1, 1, 10, and 100 nmol/L MC-LR exposure group) with 40 frogs in each group. The frogs were sacrificed by pithing. Then, the testes were quickly removed from the frogs and cleared of any adhering tissues before their weights were recorded. All testes were placed in pairs into a 1.5 mL centrifuge tube containing 1 mL of DMEM (10 mM of PBS, 100 U/mL of penicillin G, and 0.1 mg/mL of streptomycin). The tubes were kept in sterile conditions at 4 ◦ C for 90 min. The testes were randomly distributed in incubation wells (two testes/well) containing 1.95 mL of DMEM (10 mM of PBS, 100 U/mL of penicillin G, and 0.1 mg/mL of streptomycin) in 24-well sterile plates. Fifty microliters of MC-LR dissolved with PBS was added to the experimental groups to reach the final concentrations of 0.1, 1, 10, and 100 nmol/L, whereas 50 ␮L of PBS was added to the control group. The culture plates were placed in 5% CO2 atmosphere at 27 ◦ C for 6 h. The testes were removed from the incubation wells after 6 h, washed thrice with PBS, and placed in a 1.5 mL centrifuge tube. The tubes were then stored at −80 ◦ C with liquid nitrogen until the assay process.

The ROS level was detected according to a previous method with slight modifications (Curtin et al., 2002). About 0.65% of cold saline solution was added to the exposed testes in 1.5 mL centrifuge tubes at a weight ratio of 1:19. The mixture was homogenized on ice and centrifuged at 45 × g at 4 ◦ C for 5 min, and then the supernatant fluid was collected. Thereafter, 0.5 mL of the supernatant fluid was centrifuged at 4476 × g at 4 ◦ C for 15 min. Up to 0.65% cold saline solution was added to the mitochondrial precipitate at a weight ratio of 1:19 for re-suspension. Approximately 190 ␮L of the suspended fluid was mixed with 10 ␮L of DCFH-DA (1 mmol−1 prepared in DMSO) at 37 ◦ C for 30 min and placed in an ELISA Reader (Thermo Multiskan MK3). The excitation light was set at 485 nm, and the fluorescence intensity values were measured at 538 nm.

2.3. Sperm analysis PBS was added to the exposed testes in the 1.5 mL centrifuge tubes at a ratio corresponding to their weight. The mixture was

2.6. Analyses of SOD, GSH, GST, and CAT SOD activity was determined using xanthine oxidase cytochrome c. Xanthine oxidase produces O2− , which oxidizes hydroxylamine to nitrite. In this study, the solution turned purple upon the addition of dye. The measurement was done using a spectrophotometer at 550 nm according to instructions provided by the manufacturer of the commercial detection kits. The glutathione reduced (GSH) content was determined via the colorimetric method using dithio-dinitro benzoic acid. GSH reacts with DTNB to produce a yellow compound, which can be measured using a microplate reader at 405 nm. The measurement was done according to the instructions provided by the commercial detection kits.

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

285

Table 1 Real-time PCR primers and conditions. Gene

Genbank accession

Primer sequence (5 → 3 )

Size (bp)

Annealing (◦ C)

Rana Nigromaculata P450 aromatase

AB178482.2

ATGGAGTCCTAACCGCTGAGAATGT CCTTTGGATGTTGTGCGATCAGAGT

120

62

Rana Nigromaculata SF-1

AB491760.1

CAGCACTTCTCAACCAGACATTCC CCTTGCCTTGATCTGAGGTTCATC

83

62

Rana Nigromaculata GAPDH

AB284116.1

AAGGGAGGTGCCAAGCGTGTGAT GCAGTTTGTGGTACAGGAGGCATTG

129

62

Glutathione S-transferase (GST) can catalyze GSH conjugation with 1-chloro-2, 4-dinitrobenzene. GST activity was determined by detecting the concentration of responsive GSH. The measurement was performed using a spectrophotometer at 412 nm according to the instructions provided by the manufacturer of the commercial detection kits. Catalase (CAT) activity was measured using spectrophotometry by measuring the colored product of the reaction between ammonium molybdate and hydrogen peroxide. The remaining H2 O2 reacts with ammonium molybdate to produce a yellow complex compound, which can be measured using a spectrophotometer at 405 nm. The measurement was performed according to the instructions provided by the manufacturer of the commercial detection kits. 2.7. Transmission electron microscopy on morphology One testis sample for each group was fixed overnight in 2.5% glutaraldehyde at 4 ◦ C. The testis samples were then washed thrice for 15 min using 0.1 M of phosphate buffer (pH level of 7.4). The testes were post-fixed in 1.5% osmic acid for 1 h and again washed with 0.1 M of phosphate buffer. Thereafter, the samples were dehydrated using 50–100% graded alcohol, embedded in pure acetone, sliced into thin sections, and stained with uranyl acetate and lead citrate. Finally, the samples were examined under a transmission electron microscope (H-7650, Hitachi, Japan). 2.8. Measurement of P450 aromatase and steroid hormone synthesis factor (SF-1) Total RNA was isolated using a total RNA extraction kit and was detected using an ultraviolet spectrophotometer. The reverse transcription experiment was done via PCR gene amplification (BioRad). The differences in gene expression levels were detected using real-time PCR (iQTM 5 multiple real-time quantitative PCR instrument, Bio-Rad). Primer Premier 6.0 and Beacon designer software were first used to design the fluorescent primers (Table 1) before gene synthesis was performed. The amplification reaction mixtures consisted of 10.5 ␮L of dH2 O, 12.5 ␮L of SYBR Premix Ex TaqTM (2×), 0.5 ␮L of PCR-F (10 ␮M), 0.5 ␮L of PCR-R (10 ␮M), and 1.0 ␮L of

the template cDNA. The two-step amplification protocol was done for 10 min at 95 ◦ C. The fluorescence values were determined for 45 cycles at 95 ◦ C for 10 s and at 62 ◦ C for 25 s. The melting curve analysis was done at a temperature range of 55–95 ◦ C. The expression levels of genes were calculated using the comparative Ct (Ct) method, where the relative expression is calculated as 2−Ct , and where Ct represents the threshold cycle. Glyceraldehyde-3phosphate dehydrogenase (GAPDH) was used to normalize mRNA levels within each sample. Three parallel measurements were conducted for each group. 2.9. Statistical analysis The statistical differences of the experimental data were determined using one-way ANOVA followed by two-sided Dunnett’s t-test. Statistical tests were conducted using SPSS11.0, and the statistical significance values were defined as P < 0.05 and P < 0.01. All data were expressed as mean ± standard deviation (S.D.). 3. Results 3.1. Sperm analysis The number of sperm cells decreased when MC-LR was increased. The number of sperm cells in the group treated with 1 nmol/L of MC-LR decreased significantly compared with that in the control group (P < 0.05). However, the group treated with 10–100 nmol/L of MC-LR exhibited a reduced number of sperm cells compared with the control group (P < 0.01, Table 2). The results show that when the testes were exposed to 1–100 nmol/L of MCLR for 6 h, the sperm motility became lower than that in the control group in a dose-dependent manner (P < 0.01, Table 2). Meanwhile, the sperm abnormality rate increased to a value significantly different from that in the control group (P < 0.01, Table 2). 3.2. MDA and ROS analyses The MDA levels in frog testes are shown in Fig. 1. When the testes were treated with 0.1 and 1 nmol/L of MC-LR, the MDA contents significantly increased (P < 0.05). A significant increase in

Table 2 Number of sperm cells, sperm motility, and sperm deformity of the testes induced by MC-LR compared with those of control testes. Groups

MCLR concentration (nmol/L)

Number of sperm cells (×106 /mL)

Sperm motility (%)

Sperm deformity (%)

1 2 3 4 5 6

Zero time control Control 0.1 1 10 100

3.45 ± 0.40 3.30 ± 0.35 2.86 ± 0.31 2.78 ± 0.21a 2.16 ± 0.39b 1.91 ± 0.36b

0.87 ± 0.025 0.86 ± 0.024 0.75 ± 0.11a 0.56 ± 0.057b 0.33 ± 0.11b 0.24 ± 0.088b

0.38 ± 0.063 0.39 ± 0.077 0.55 ± 0.099b 0.70 ± 0.044b 0.77 ± 0.059b 0.85 ± 0.079b

Effects of MC-LR on number of sperm cells, sperm motility, and sperm deformity compared with those of control testes. The testes were exposed to different MC-LR concentrations for 6 h. The data are shown as mean ± S.D. a Significantly different response from that of the control (P < 0.05). b Significantly different response from that of the control (P < 0.01).

286

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

Fig. 1. Effect of MC-LR on lipid peroxidation in cultured testes after 6 h. The testes were exposed to different MC-LR concentrations for 6 h. Bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

Fig. 3. Effect of MC-LR on SOD compared with those of the control. The testes were exposed to different MC-LR concentrations for 6 h. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

the MDA content was also observed after the testes were exposed to 10–100 nmol/L of MC-LR (P < 0.01). This result implies that low concentrations of MC-LR can lead to the lipid peroxidation of the testis of R. nigromaculata. When MC-LR dose was increased, the ROS contents significantly increased to a value different from that of the control (P < 0.01, Fig. 2).

3.3. Analyses of SOD, GSH, GST, and CAT Fig. 3 shows that SOD activity significantly decreased when the testes were exposed to 1–100 nmol/L of MC-LR (P < 0.01). CAT levels significantly increased after the testes were exposed to 1–100 nmol/L of MC-LR (Fig. 4, P < 0.01). GSH content increased to a value significantly higher than that of the control group (P < 0.01) after the testes were treated with MC-LR (Fig. 5). A significant increase in GST activity was also observed with higher MC-LR concentrations (Fig. 6, P < 0.05). This result implies that the defense systems of the testes of R. nigromaculata quickly responded to oxidative stress.

Fig. 2. Effect of MC-LR on ROS compared with those of the control. The testes were exposed to different MC-LR concentrations for 6 h. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

Fig. 4. Effect of MC-LR on CAT compared with those of the control. The testes were exposed to different MC-LR concentrations for 6 h. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (**P < 0.01).

Fig. 5. Effect of MC-LR on GSH compared with those of the control. The testes were exposed to different MC-LR concentrations for 6 h. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

Fig. 6. Effect of MC-LR on GST compared with the control. The testes were exposed to different MC-LR concentrations for 6 h. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

287

mitochondria, endoplasmic reticulum (ER), and Golgi apparatus are all normal in the spermatogenic sertoli cells (Fig. 7(A) and (B)). The testis displayed a multivesicular body upon treatment with 0.1 nmol/L of MC-LR (Fig. 7(C)). After the testis was exposed to 1 nmol/L of MC-LR for 6 h, the ER of the cells dilated and the Golgi apparatus and mitochondria swelled (Fig. 7(D)). Moreover, the results indicate the dilation of the ER and intercellular space and the swelling of the mitochondria after the testis were exposed to 10 nmol/L of MC-LR (Fig. 7(E)). However, when the testis was exposed to 100 nmol/L of MC-LR, the mitochondria still showed signs of swelling but with a deformed nucleolus and an edge that appeared to have undergone pycnosis (Fig. 7(F)). Fig. 8 shows the effects of MC-LR on the organelles of spermatogenic sertoli cells in frog testis after being exposed to different MC-LR concentrations for 6 h. In the zero time control and control groups, the mitochondria in spermatogenic sertoli cells appeared normal (Fig. 8(A) and (B)). After the testes were exposed to 0.1, 1, and 10 nmol/L of MC-LR for 6 h, the mitochondria were still swollen and their cristae numbers increased (Fig. 8(C) and (E)). The results also show that the mitochondria were still swollen and their cristae expanded when the testes were treated with 100 nmol/L of MC-LR. By contrast, the ER underwent degranulation and dilation.

3.4. Ultrastructural observations of spermatogenic sertoli cells 3.5. Analyses of P450 aromatase and SF-1 Fig. 7 shows that the testes injected with MC-LR demonstrated ultrastructural changes in a dose-dependent manner 6 h after injection. The zero time control and control groups show that the

The relative expression levels of the P450 aromatase and SF-1 genes increased after the testes were treated with MC-LR

Fig. 7. Effects of MC-LR on the spermatogenic sertoli cells in frog testis after being exposed to different MC-LR concentrations for 6 h. (A) Spermatogenic sertoli cells of zero time control testis (12,000×). (B) Spermatogenic sertoli cells of control testis (12,000×). (C) Multivesicular body (short black arrow) after being exposed to 0.1 nmol/L of MC-LR for 6 h (12,000×). (D) Dilation of the endoplasmic reticulum (black arrow), Golgi apparatus (double black arrow), and swollen mitochondria (black arrow) after being exposed to 1 nmol/L of MC-LR for 6 h (12,000×). (E) Dilation of the endoplasmic reticulum (black arrow), swollen mitochondria (black arrow), and intercellular space (short black arrow) after being exposed to 10 nmol/L of MC-LR for 6 h (12,000×). (F) Swollen mitochondria (black arrow), deformed nucleolus, and the edge that underwent pycnosis (short white arrow) after being exposed to 100 nmol/L of MC-LR for 6 h (12,000×).

288

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

Fig. 8. Effects of MC-LR on the spermatogenic sertoli cells in frog testis after being exposed to different MC-LR concentrations for 6 h. (A) Mitochondria in the spermatogenic sertoli cells of the zero time control samples (60,000×). (B) Mitochondria in the spermatogenic sertoli cells of the control samples (60,000×). (C), (D), and (E) Swollen mitochondria and increased cristae numbers (black arrow) after being exposed to 0.1, 1, and 10 nmol/L of MC-LR for 6 h (60,000×). (F) Swollen mitochondria and expanded cristae (black arrow), as well as endoplasmic reticulum degranulation and dilation (white arrow) after being exposed to 100 nmol/L of MC-LR for 6 h (60,000×).

(Figs. 9 and 10). Their expression levels were significantly higher than those of the control group (P < 0.01). Moreover, the results show that the activities of steroid hormone synthesis enzymes and aromatase were induced by MC-LR and reflected in the increased P450 and SF-1 expression levels.

Fig. 9. Effect of MC-LR on P450 aromatase gene expression in cultured testes after 6 h. The P450 expression levels were determined using quantitative real-time PCR. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

4. Discussion MCs pose a health risk to livestock, wildlife, and humans (Ernst et al., 2005; Sieroslawska et al., 2007; Campos and Vasconcelos, 2010), and are highly stable in fresh waters (Hyenstrand et al.,

Fig. 10. Effect of MC-LR on SF-1 gene expression in cultured testes after 6 h. The testes were exposed to different MC-LR concentrations for 6 h. The SF-1 expression levels were measured thrice using quantitative RT-PCR. The bars represent mean ± S.D. The asterisks denote responses that are significantly different from those of the control (*P < 0.05, **P < 0.01).

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

2003). MCs can be released from toxic cyanobacterial cells when cyanobacterial blooms collapse, and this phenomenon usually occurs at the end of summer and at the beginning of fall (van Apeldoorn et al., 2007). During dry seasons, toxic cyanobacterial blooms occur almost all year around in tropical or subtropical areas of China, Brazil, and Australia (Chorus and Bartram, 1999). Frogs mate in spring time. However, under temperate climate condition, frozen cells of toxic Microcystis blooms may also release MCs from the ice cover of lakes after spring time thawing (Li et al., 2004; Brunberg and Blomqvist, 2003). Several studies have indicated that MCs can accumulate in the gonad, the second target organ of MCs (Chen and Xie, 2005; Chen et al., 2005). Thus, MCs may have potential ecological impact on amphibians. In this study, the effects of MCs on the reproductive system of male frogs in vitro are demonstrated. Fischer and Dietrich (2000) quantified the MC-LR and MC-RR uptake in the embryo larvae of X. laevis. However, their findings indicate that amphibians in their early life stages (up to five days of development) are less likely to be affected by cyanobacterial blooms that produce MC-LR and MC-RR. In the present study, the reproductive toxicity of MC-LR in male R. nigromaculata was observed after the animals were exposed to 0.1, 1, 10, and 100 nmol/L of MC-LR. MC-LR was anticipated to impair male fertility. This hypothesis can be supported by the fact that a significant decrease in sperm motility and number of sperm cells and an increase in sperm abnormality percentage were observed 6 h after exposure. In this research, the typical ultrastructural changes (such as swelling of mitochondria, ER, and Golgi apparatus) in spermatogenic sertoli cells were consistent with the symptoms associated with cell necrosis. Li et al. (2005) administered hepatocyte damage in vitro in fish and observed ultrastructural changes leading to apoptosis and necrosis after exposure to 200 and 500 mg kg−1 of MC-LR, respectively. This result is consistent with the findings in another study (Li et al., 2001). Therefore, these results suggest that high MC concentrations induce cell damage, which leads to necrosis. Moreover, MCs are potent and specific inhibitors of PP1 and PP2A (Li et al., 2001), which cause the widening of intercellular junctions and disruption of microtubules, cytokeratin intermediate filaments, and microfilaments (Wickstrom et al., 1995; Khan et al., 1996). Cortizo et al. (2000) reported that junction widening induces mitochondrial damage, which impairs ATP synthesis and thus limits actin polymerization. In male reproductive toxicology, the testis weight and volume, sperm morphology, sperm quantity, exercise capacity, hormone levels, and activities of related antioxidant enzymes are important in measuring male reproductive function (Gerald et al., 1998). DNA damage and oxidative stress are the main mechanisms of male reproductive molecular toxicity (Ding et al., 2006; Li et al., 2008). Moreover, testis sertoli cells are usually the target cells in similar male toxicology investigations (Boekelheide et al., 2000; Saradha et al., 2009). In the present study, we investigated MC-LR-induced toxicity on the reproductive systems of male R. nigromaculata, focusing on the oxidative damage in spermatogenic sertoli cells. Cultured testes treated with MC-LR for 6 h showed excessive ROS production and used various antioxidant enzymes as defense mechanisms. As shown in Figs. 1, 3 and 4, the significantly increased activities of CAT and the decreased activities of SOD were concomitant with MDA increase. Increased CAT activities after MC-LR exposure were also observed in the hepatocytes of common carp (Li et al., 2003) and rabbit testes (Liu et al., 2010). These results indicate that MCs can actively induce the antioxidant enzyme systems. Besides CAT activities, results in Figs. 5 and 6 show that the activities of GST and GSH also increased during the experiments. Generally, GSH has an important function in the protection of cellular constituents against ROS (Liu et al., 2010). The increase of

289

GST by ROS may also represent an adaptive response to detoxify peroxide-containing metabolites generated during oxidative stress (Kaur et al., 2006). Intracellular GSH has a critical role in cellular defense against MC-LR (Zˇ egura et al., 2006). However, an increase in GST activity is critical for the detoxification of MC-LR (Gehringer et al., 2004). Our results also prove the importance of MC detoxification by GST via GSH in frogs. SF-1 is a key factor in sex steroid hormone synthesis when an amphibian has gonadal differentiation. Loretta et al. (2002) investigated SF-1 changes during protein-level development, which supports the steroidogenic requirements in developing gonadal tissues in the American bullfrog (Rana catesbeiana). Numerous studies have shown that the activities of P450 aromatase gene are important in gonadal differentiation in amphibians. P450 aromatase protein is synthesized in follicle cells and has an importation role in the ovary-determining pathway of Rana rugosa (Kato et al., 2004). Gunderson et al. (2011) found that some endocrine disruptive agents such as 17␣-ethynylestradiol can enhance the expression of P450 aromatase mRNA in the brain of bullfrogs (R. catesbeiana). Recently, microcystin-LR was found to possess estrogenic potential (Oziol and Bouaïcha, 2010). Thus, MC-LR may have an endocrine disruptive function on frogs. Fan et al. (2007) reported that atrazine can induce human aromatase gene expression via promoter II (ArPII) in an SF-1-dependent manner. Our data show that the activity of P450 aromatase and the amount of SF-1 gene products increased in a dose-dependent manner, indicating that P450 aromatase and SF-1 are two important molecules in the testes induced by MC-LR which may be correlated. Previous studies provided less information on the in vitro induction of the reproductive toxicity in the testes of frogs. Luana et al. (2009) incubated the ovarian tissues and testis of water frogs (Rana esculenta) in vitro in different concentrations of the two herbicides to measure the 17b-estradiol and testosterone levels. Results show that paraquat induced reproductive toxicity in amphibians, whereas glyphosate showed no effect on gonadal steroidogenesis. Although the testes were treated with melatonin and estradiol in vivo and in vitro, melatonin induced an inhibitory effect on the basal cells, whereas estradiol stimulated the mitotic activity of primary spermatogonia (d’Istria et al., 2003). The present study demonstrates that direct exposure of frog testes to different MC-LR concentrations in culture leads to reproductive toxicity. In conclusion, this study demonstrates that MC-LR can induce reproductive toxicity in male R. nigromaculata. The result reveals the molecular mechanism involved in induced oxidative damage and its effects on the male reproductive system. Nevertheless, further studies are still needed to study the ecotoxicological problems caused by cyanobacterial toxins on amphibians.

Acknowledgments This work was supported by the Natural Science Foundation of Zhejiang Province (Y5110144 and Y5090190) and the Program for Excellent Young Teachers in Hangzhou Normal University (JTAS 2011-01-012).

References Alford, R.A., Richards, S.J., 1999. Global amphibian declines: a problem in applied ecology. Annual Review of Ecology and Systematics 30, 133–165. Battaglin, W.A., Rice, K.C., Focazio, M.J., 2009. The occurrence of glyphosate, atrazine, and other pesticides in vernal pools and adjacent streams in Washington, DC, Maryland, Iowa, and Wyoming, 2005–2006. Environmental Monitoring and Assessment 155, 281–307. Boekelheide, K., Fleming, S.L., Johnson, K.J.J., Sutchin, R.P., Heidi, A.S., 2000. Role of sertoli cells in injury associated testicular germ cell apoptosis. Proceedings of the Society for Experimental Biology and Medicine 225, 105–115.

290

H. Zhang et al. / Aquatic Toxicology 126 (2013) 283–290

Boone, M.D., Stacy, M.J., 2003. Interactions of an insecticide, herbicide, and natural stressors in amphibian community mesocosms. Ecological Applications 13, 829–841. Brunberg, A.K., Blomqvist, P., 2003. Recruitment of microcystis (Cyanophyceae) from lake sediments: the importance of littoral inocula. Journal of Phycology 39, 58–63. Campos, A., Vasconcelos, V., 2010. Molecular mechanisms of microcystin toxicity in animal cells. International Journal of Molecular Sciences 11, 268–287. Chen, J., Xie, P., 2005. Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in two freshwater shrimps, Palaemon modestus and Macrobrachium nipponensis, from a large shallow, eutrophic lake of the subtropical China. Toxicon 45, 615–625. Chen, J., Xie, P., Guo, L.G., Zheng, L., Ni, L.Y., 2005. Tissue distributions and seasonal dynamics of the hepatotoxic microcystins-LR and -RR in a freshwater snail (Bellamya aeruginosa) from a large shallow, eutrophic lake of the subtropical China. Environmental Pollution 134, 423–430. Chorus, I., Bartram, J., 1999. Toxic cyanobacteria in water, a guide to their public health consequences, monitoring and management, published by WHO. Spon Press, London. Cortizo, A.M., Bruzzone, L., Molinuevo, S., Etcheverry, S.B., 2000. A possible role of oxidative stress in the vanadium-induced cytotoxicity in the MC3T3E1 osteoblast and UMR 106 osteosaroma cell lines. Toxicology 147, 89–99. Curtin, J.F., Donovan, M., Cotter, T.F., 2002. Regulation and measurement of oxidative stress in apoptosis. Journal of Immunological Methods 265, 49–72. de Figueiredo, D.R., Azeiteiro, U.M., Esteves, S.M., Goncalves, F.J., Pereira, M.J., 2004. Microcystin-producing blooms-a serious global public health issue. Ecotoxicology and Environment Safety 59, 151–163. Ding, X.S., Li, X.Y., Duan, H.Y., Chuan, I.K., Lee, J.A., 2006. Toxic effects of microcystis cell extracts on the reproductive system of male mice. Toxicon 48, 973–979. d’Istria, M., Pmiero, C., Serino, I., Izzo, G., Minucci, S., 2003. Inhibition of the basal and oestradiol-stimulated mitotic activity of primary spermatogonia by melatonin in the testis of the frog, Rana esculenta, in vivo and in vitro. Reproduction 126, 83–90. Dong, L., Zhang, H.Z., Duan, L.J., Cheng, X.M., Cui, L.X., 2008. Genotoxicity of testicle cell of mice induced by microcystin-LR. Life Science Journal 5, 43–45. Ernst, B., Dietz, L., Hoeger, S.J., Dietrich, D.R., 2005. Recovery of MC-LR in fish liver tissue. Environmental Toxicology 20, 449–458. Fan, W.Q., Yanase, T., Morinaga, H., Gondo, S., Okabe, T., Nomura, M., Hayes, T.B., Tkayanagi, R., Nawata, H., 2007. Herbicide atrazine activates SF-1 by direct affinity and concomitant co-activators recruitments to induce aromatase expression via promoter II. Biochemical and Biophysical Research Communications 355, 1012–1018. Fischer, W.J., Dietrich, D.R., 2000. Toxicity of the cyanobacterial cyclic heptapeptide toxins microcystin-LR and -RR in early life-stages of the African clawed frog (Xenopus laevis). Aquatic Toxicology 49, 189–198. Gehringer, M.M., Shephard, E.G., Downing, T.G., Wiegand, C., Neilan, B.A., 2004. An investigation into the detoxification of microcystin-LR by the glutathione pathway in Balb/c mice. International Journal of Biochemistry and Cell Biology 36, 931–941. Gerald, A., Ellen, M., Ralph, S., 1998. Overview of a workshop on screening methods for detecting potential (anti-) estrogenic/androgenic chemicals in wildlife. Environmental Toxicology and Chemistry 17, 68–87. Gunderson, M.P., Veldhoen, N., Skirrow, R.C., Macnab, M.K., Ding, W., van Aggelen, G., Helbing, C.C., 2011. Effect of low dose exposure to the herbicide atrazine and its metabolite on cytochrome P450 aromatase and steroidogenic factor-1 mRNA levels in the brain of premetamorphic bullfrog tadpoles (Rana catesbeiana). Aquatic Toxicology 102, 31–38. Hayes, T.B., Falso, P., Gallipeau, S., Stice, M., 2010a. The cause of global amphibian declines: a developmental endocrinologist’s perspective. Journal of Experimental Biology 213, 921–933. Hayes, T.B., Khourya, V., Narayana, A., 2010b. Atrazine induces complete feminization and chemical castration in male african clawed frogs (Xenopus laevis). Ecology 107, 4612–4617. Hyenstrand, P., Rohrlack, T., Beattie, K.A., Metcalf, J.S., Codd, G.A., Christoffersen, K., 2003. Laboratory studies of dissolved radiolabelled microcystin-LR in lake water. Water Research 37, 3299–3306. Jia, X.Y., Wang, M.Z., Shi, C.L., Liu, X.X., 2009. Effects of lead exposure on sperm toxicity and levels of sexual hormone in sera of male Rana nigromaculata. Acta Scientiae Circumstantiae 5, 1072–1076. Jiang, J.P., Song, R., Ren, J.H., Wang, X.R., Yang, L.Y., 2011. Advances in pollution of cyanobacterial blooms-producing microcystins and their ecotoxicological effects on aquatic organisms. Progress in Inorganic Chemistry 23, 247–253. Joseph, M., Kiesecker, Andrew R., Blaustein Lisa, Belden, K., 2001. Complex causes of amphibian population declines. Nature 401, 681–683.

Kato, T., Matsui, K., Takase, M., Kobayashi, M., Nakamura, M., 2004. Expression of P450 aromatase protein in developing and in sex-reversed gonads of the XX/XY type of the frog Rana rugosa. General and Comparative Endocrinology 137, pp 237–236. Kaur, P., Kaur, G., Bansal, M.P., 2006. Tertiary-butyl hydroperoxide induced oxidative stress and male reproductive activity in mice: role of transcription factor NF-kB and testicular antioxidant enzymes. Reproductive Toxicology 22, 479–484. Khan, S.A., Wickstrom, M.L., Haschek-Hock, W.M., Schaeffer, D.J., Ghosh, S., Beasley, B.R., 1996. Microcystin-LR-induced alterations in the cytoskeleton of cultured hepatocytes, kidney cells, and fibroblasts. Natural Toxins 4, 217–220. Li, K.Y., Song, L.R., Wan, N., 2004. Studies on recruitment and growth characteristic of microcystis in sediment. Acta Hydrobiologica Sinica 28, 113–117. Li, L., Xie, P., Chen, J., 2005. In vivo studies on toxin accumulation in liver and ultrastructural changes of hepatocytes of the phytoplanktivorous bighead carp i.p.-injected with extracted microcystins. Toxicon 46, 533–545. Li, T., Huang, P., Liang, J., Fu, W.Y., Guo, Z.J., 2011. Microcystin-LR (MCLR) induces a compensation of PP2A activity mediated by ␣4 protein in HEK293 cells. International Journal of Biological Sciences 7, 740–752. Li, X.Y., Liu, Y.D., Song, L.R., 2001. Cytological alterations in isolated hepatocytes from common carp (Cyprinus carpio L.) exposed to microcystin-LR. Environmental Toxicology 16, 517–522. Li, X.Y., Liu, Y.D., Song, L.R., Liu, J.T., 2003. Responses of antioxidant systems in the hepatocytes of common carp (Cyprinus carpio L.) to the toxicity of microcystinLR. Toxicon 42, 85–89. Li, Y., Sheng, J., Sha, J.H., Han, X.D., 2008. The toxic effects of microcystin-LR on the reproductive system of male rats in vivo and in vitro. Reproductive Toxicology 26, 239–245. Liu, Y., Xie, P., Qiu, T., Li, H.Y., Li, G.Y., Hao, L., Xiong, Q., 2010. Microcystin extracts induce ultrastructural damage and biochemical disturbance in male rabbit testis. Environmental Toxicology 25, 9–17. Loretta, P.M., Stefanie, L.O., Cheryl, A.D., Catherine, R.P., 2002. Sexually dimorphic expression of steroidogenic factor 1 (SF-1) in developing gonads of the American bullfrog, Rana catesbeiana. General and Comparative Endocrinology 127, 40–47. Luana, Q., Ennio, M., Oretta, M., Massimo, B., 2009. Effects of paraquat and glyphosate on steroidogenesis in gonads of the frog Rana esculenta in vitro. Pesticide Biochemistry and Physiology 93, 91–95. Milutinovic, A., Sedmak, B., Horvat-Znidarsic, I., Suput, D., 2002. Renal injuries induced by chronic intoxication with microcystins. Cellular and Molecular Biology Letters 7, 139–141. Oziol, L., Bouaïcha, N., 2010. First evidence of estrogenic potential of the cyanobacterial heptotoxins the nodularin-R and the microcystin-LR in cultured mammalian cells. Journal of Hazardous Materials 174, 610–615. Palen, W.J., Schindlerb, D.E., 2010. Water clarity, maternal behavior, and physiology combine to eliminate UV radiation risk to amphibians in a montane landscape. Proceedings of the National Academy of Sciences of the United States of America 107, 9701–9706. Saradha, B., Vaithinathan, S., Mathur, P.P., 2009. Lindane induces testicular apoptosis in adult Wistar rats through the involvement of Fas–FasL and mitochondriadependent pathways. Toxicology 255, 131–139. Sieroslawska, A., Rymuszka, A., Bownik, A., Skowroiiski, T., 2007. The influence of microcystin-LR on fish phagocytic cells. Human and Experimental Toxicology 26, 603–607. Stuart, S.N., Chanson, J.S., Cox, N.A., Young, B.E., Rodrigues, A.S.L., Fischman, D.L., Waller, R.W., 2004. Status and trends of amphibian declines and extinctions worldwide. Science 306, 1783–1786. van Apeldoorn, M.E., Van Egmond, H.P., Speijers, G.J., Bakker, G.J., 2007. Toxins of cyanobacteria. Molecular Nutrition and Food Research 51, 7–60. Wake, D.B., 1991. Declining amphibian populations. Science 253, 860. Wickstrom, M.L., Khan, S.A., Haschek, W.M., Wyman, J.F., Eriksson, J.E., Schaefer, D.J., Beasley, V.R., 1995. Alterations in microtubules, intermediate filaments, and microfilaments induced by microcystin-LR in cultured cells. Toxicologic Pathology 23, 325–337. Wu, Z.J., Li, Y.M., 2004. Causes and conservation strategies of amphibian population declination. Chinese Journal of Ecology 23, 140–146. Zˇ egura, B., Lah, T.T., Filipiˇc, M., 2006. Alteration of intracellular GSH levels and its role in microcystin-LR-induced DNA damage in human hepatoma HepG2 cells. Mutation Research: Genetic Toxicology 611, 25–33. Zhang, J.Y., Zhang, H.Y., Chen, Y.X., 2006. Sensitive apoptosis induced by microcystins in the crucian carp (Carassius auratus) lymphocytes in vitro. Toxicology in Vitro 20, 560–566. Zhou, Z., Xie, F., Jiang, J., Zheng, Z.H., 2004. Research advances of amphibian declines. Chinese Journal of Applied and Environmental Biology 10, 128–132.