Toxoplasma gondii: Identification and characterization of bradyzoite-specific deoxyribose phosphate aldolase-like gene (TgDPA)

Experimental Parasitology 121 (2009) 55–63

Contents lists available at ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

Toxoplasma gondii: Identification and characterization of bradyzoite-specific deoxyribose phosphate aldolase-like gene (TgDPA) Akio Ueno a,1, George Dautu a,1, Biscah Munyaka b, Gabriella Carmen c, Yoshiyasu Kobayashi d, Makoto Igarashi a,* a

National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, 2-13 Inada-cho, Obihiro, Hokkaido 080-8555, Japan Kenya Medical Research Institute (KEMRI), Nairobi, Kenya c Servicio Nacional de Salud y Calidad Animal, San Lorenzo, Paraguay d Department of Pathobiological Science, School of Veterinary Medicine, Obihiro University of Agriculture and Veterinary Medicine, Hokkaido, Japan b

a r t i c l e

i n f o

Article history: Received 28 April 2008 Received in revised form 25 August 2008 Accepted 30 September 2008 Available online 10 October 2008 Keywords: Toxoplasma gondii DNA, deoxyribonucleic acid Bradyzoites In vitro differentiation SAG1, surface antigen-1 BAG1, bradyzoite antigen-1 GRA1 dense granule protein-1 TgDPA, Toxoplasma gondii deoxyribose phosphate aldolase RT-PCR, reverse transcription-polymerase chain reaction IFAT, indirect immuno fluorescent antibody test

a b s t r a c t Toxoplasma gondii undergoes stage conversion from tachyzoites to bradyzoites in intermediate hosts. There have been many reports on bradyzoite-specific genes which are thought to be involved in stage conversion. Here, we described a novel T. gondii deoxyribose phosphate aldolase-like gene (TgDPA) expressing predominantly in bradyzoites. The TgDPA gene encodes 286 amino acids having a predicted molecular weight of 31 kDa. Sequence analysis revealed that TgDPA had a deoxyribose phosphate aldolase (DeoC) domain with about 30% homology with its Escherichia coli counterpart. RT- and quantitative PCR analyses showed that the TgDPA gene was more expressed in bradyzoites and that its expression gradually increased during in vitro tachyzoite-to-bradyzoite stage conversion. A polyclonal antibody against recombinant TgDPA protein was raised in rabbits, and immunofluorescent analysis demonstrated that TgDPA was expressed in bradyzoites in vivo and in vitro. These findings indicate that the TgDPA gene is a new bradyzoite-specific marker and might play a role in bradyzoites. Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction Toxoplasma gondii is an obligate intracellular parasite affecting most warm-blooded animals and one of the most common human and veterinary pathogen world-wide (McLeod and Remington, 1987; Tenter et al., 2000). It is an important opportunistic pathogen of immunocompromised hosts such as HIV-AIDS and transplant patients (Luft and Remington, 1992; Wong and Remington, 1993). Toxoplasmosis is usually transmitted through oocyst-contaminated food or water and tissue cysts in raw or undercooked meat. It is present in about 13% of the human population, with a prevalence ranging from 10% to 90% (Dubey, 1986). The parasite has two forms of replication, namely sexual and asexual. The sexual stage occurs exclusively in feline animals in which oocysts are pro* Corresponding author. Fax: +81 155 49 5643. E-mail address: [email protected] (M. Igarashi). 1 These authors contributed equally to this work. 0014-4894/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2008.09.018

duced. The asexual stage occurs in a wide variety of intermediate hosts such as livestock and humans, which is characterized by two forms (i.e tachyzoite and bradyzoite forms). Tachyzoites are responsible for acute toxoplasmosis and congenital neurological birth defects. As a response to the host immune system attack during the progression of acute illness, the tachyzoites differentiate into encysted bradyzoites, which grow slowly and remain latent within the tissues for many years, representing a threat to immunocompromised patients such as AIDS and transplant patients (Navia et al., 1986; Dubey et al., 1998). During the course of infection in intermediate hosts, a small fraction of the tachyzoites differentiate to form bradyzoites. Replication of these parasites is greatly slowed and they begin to express differentiation-specific markers (Yahiaoui et al., 1999; Ferguson 2004) and establish a cyst wall (Dubey et al., 1998). Therefore, an understanding of the mechanisms governing the interconversion between tachyzoites and bradyzoites might lead to new strategies for preventing tissue cyst formation and/or parasite re-emergence in immunocompromised patients. We have

56

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

therefore taken advantage of the sequence information from the T. gondii expressed sequence tag (EST) database and focused on one bradyzoite-specific gene herein referred to as the T. gondii deoxyribose phosphate aldolase-like gene (TgDPA; EST ID, TgESTzz32g04 and gene ID, 641.m01505). This gene has been previously reported as a DRPA-like gene (Ctoxoqual Contig No. 4436), which is developmentally regulated in tachyzoite-to-bradyzoite differentiation (Manger et al., 1998; Cleary et al., 2002). Since those studies, further investigations have not yet been conducted to elucidate the function of this gene. 2-Deoxyribose 5-phosphate aldolase (DERA) catalyzes the reversible aldol reaction of acetaldehyde and glyceraldehyde 3-phosphate from the sugar phosphate, deoxyribose 5-phosphate, which is the main sugar produced during deoxynucleoside catabolism (Valentin-Hansen et al., 1982; Sgarrella et al., 1997; Heine et al., 2001). It was expected that TgDPA has enzymatic activity and plays an important role in utilization of deoxyribose as a carbon and energy source in the bradyzoite stage. We thought that the elucidation of this bradyzoite-specific gene would allow us to understand the molecular mechanisms of differentiation in T. gondii. In the present study, expression of TgDPA in tachyzoites and encysted bradyzoites was determined by RT- and quantitative PCR analyses. Anti-TgDPA polyclonal antibody was produced in a rabbit by full length GST-fused TgDPA protein, and the polyclonal antibody was used in IFAT to examine the localization of TgDPA in bradyzoites in vivo and in vitro. Expression kinetics of the TgDPA gene in in vitro-induced bradyzoites was also examined. 2. Materials and methods 2.1. Enzymes and chemicals Restriction endonucleases were purchased from Toyobo Co., Ltd. (Osaka, Japan) and Promega (USA). Other DNA-modifying enzymes and RNase-free DNase I were purchased from TaKaRa Shuzo Co., Ltd. (Kyoto, Japan). All reagents used were commercially available and of analytical grade. Collagenase was purchased from Wako Pure Chemical Industries, Ltd., Japan.

Aldrich, UK). The brain homogenates were resuspended in 50 ml of RPMI-1640 medium and finally the cysts were purified from the brain homogenate using 25% (w/v) Gum Arabic (Sigma–Aldrich, UK). Briefly, 2 ml of the Gum Arabic of 1.07 sg (specific gravity) were added to each glass tube and 2 ml of the Gum Arabic of 1.05 sg were dispensed slowly to each tube, followed by the addition of 5 ml of the above brain homogenates. After 10 min of centrifugation at 2100g at 15 °C, the pellets from all the tubes were added together and washed 3 times with 1 phosphate buffered saline (PBS). The purified cysts were then used for total RNA extraction. 2.4. In vitro differentiation of Toxoplasma gondii In vitro differentiation was conducted by alkaline treatment of confluent Vero or HFF cells grown in 12-well plates. Confluent Vero or HFF cells were infected with tachyzoites of PLK or ME49 strains and differentiation was induced by culture in sodium bicarbonatefree RPMI 1640 containing 1% FCS, 50 mM Hepes (pH 8.1) at 37 °C without CO2 (Fux et al. 2007). Cyst wall was stained with FITC-conjugated Dolichos biflorus lectin (DBL) as described previously (Fux et al., 2007). For the time course study, the start day of in vitro differentiation was day 0. Parasite cells were collected every day and used for total RNA extraction after treating with 15 U of collagenase at 37 °C for 30 min to rupture the cyst wall (Omata et al., 1995). 2.5. TgDPA cloning and sequencing analysis TgDPA cDNA containing an entire coding region was RT-PCR amplified from Beverley strain total RNA as a template using primTable 1 Oligonucleotide sequences of primers and probes used in this study. Name

Oligonucleotide sequence (50 –30 )a

RT-PCR analysis DPA forward DPA reverse

CGTATTCGGCTCCTCGTTAG CTTTCGTTTTCACGGACCAT

GRA1 forward GRA1 reverse

ACAGGGCAGGGATTAGGAAT AACGCACGAAGGAAAATGTC

2.2. Animals

GRA2 forward GRA2 reverse

AGAGGCAACAAGAGCCAGAA TTCTTTGGCCACCTTGAAAC

Six to eight-week-old female ICR mice and a 3-month-old male white Japanese rabbit used in our experiments were purchased from Clea, Japan. The mice were used for maintenance of the T. gondii cysts through monthly passage, whereas the rabbit was used for polyclonal anti-TgDPA antibody production. All experiments were conducted according to the guidelines issued by Obihiro University of Agriculture and Veterinary Medicine.

SAG1 forward SAG1 reverse

ACGGGGGATTCTGCTAGTCT CTTCCGCAGACAACTTGACA

BAG1 forward BAG1 reverse

ACAACGGAGCCATCGTTATC GTAGAACGCCGTTGTCCATT

Real-time PCR analysis GRA1 forward GRA1 reverse GRA1 probe

TCACTGCATCTTCCAGTTGCA GAAGACGTGGCTCAAGCAGAA (6-FAM)-TTGCTCCGAATTAAG-(NFQ-MGB)

2.3. Parasites

SAG1 forward SAG1 reverse SAG1 probe

AACGATCAACAAGGAAGCATTTC TCCCCCTGTGCATCCAATA (6-FAM)-CCGAGTCAAAAAGCGTCA-(NFQ-MGB)

BAG1 forward BAG1 reverse BAG1 probe

CTGAATCCTCGACCTTGATCGT GAATCAGTGCGGCAATGGA (6-FAM)-ACACGTAGAACGCCG-(NFQ-MGB)

DPA forward DPA reverse DPA probe

CCCACGCGACTATGTTTACAGTT CGTTTTCACGGACCATGTACTC (6-FAM)-ACTTGATTTCCATAGCGCTT-(NFQ-MGB)

Cloning of the TgDPA gene DPA forward DPA reverse

TTGAATTCATGGCGACAGAGCAATTACT TTCTCGAGTCACGGGTTCGTGTCTGGAGA

Sequencing analysis pGEX 50 pGEX 30

GGGCTGGCAAGCCACGTTTGGTG CCGGGAGCTGCATGTGTCAGAGG

The high virulent Type I strain of RH and the low virulent and cyst-forming Type II strains of Beverley, PLK and ME49 of T. gondii were used. RH strain was used for Western blotting described below as tachyzoite lysate samples. Beverley strain was used for chronic infection in mice and in vivo bradyzoite samples. PLK and ME49 strains were used for in vitro differentiation as described below. Tachyzoites of Beverley, PLK and ME49 strains were maintained in our laboratory through serial passage in Vero or human foreskin fibroblast (HFF) cells grown in modified Eagle’s medium (Sigma– Aldrich, UK) supplemented with 5% foetal calf serum (FCS). Beverley strain cysts were obtained from the brains of orally infected ICR mice. The cysts from brain tissues were extracted as previously described with minor modifications (Makala et al., 2003). In brief, brains were removed from T. gondii-infected mice 1 month after infection and were homogenized in RPMI-1640 medium (Sigma–

a FAM, reporter dye 6-carboxifluorescein; NFQ, non-fluorescent quencher; MGB, minor groove binder.

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

ers described in Table 1. The amplified cDNA was double digested with EcoRI and XhoI and subcloned into the identical restriction sites of pGEX-6P-2 (GE Healthcare UK Ltd.) or pcDNA6/V5-HisA (Invitrogen). Plasmids were transformed into Escherichia coli DH5a competent cells. Individual colonies were grown at 37 °C overnight with rotary shaking in 10 ml of Luria–Bertani (LB) medium with 50 lg/ml of ampicillin. Plasmid DNA was extracted using the plasmid purification kit (QIAGEN). After plasmid preparation, 5 ll (out of 30 ll) of each sample was treated with restriction enzymes, EcoRI and XhoI, to check the presence of insert DNA. Only plasmids containing the expected insert size were used for the subsequent nucleotide sequencing analysis. Cycle sequencing reactions were carried out using a BigDye Terminator Cycle Sequencing kit version 3.1 according to the manufacturer’s protocol (Applied Biosystems, USA), and each sample was analyzed using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, USA). The nucleotide sequence of the plasmid was compared with that of the Toxoplasma genome sequence in GenBank (Accession No. CB072102, CB022389 and CA961169). The sequences were aligned using ClustalW, version 1.8 (Thompson et al., 1994). Hydrophobicity of the deduced amino acid sequence was analyzed by the SOSUI program (http://bp.nuap. nagoya-u.ac.jp/sosui/). 2.6. Generation of recombinant TgDPA protein and purification The resulting plasmid was transfected in E. coli strain BL21 (DE3) pLysS cells and grown in 200 ml LB medium supplemented with 50 lg/ml ampicillin with vigorous shaking at 37 °C up to an optical density of 0.6 measured at 600 nm. Then, the GST-fused protein was induced with isopropyl-b-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM with mild shaking at 25 °C overnight. The cells were centrifuged at 5000g for 20 min and the bacterial pellet was resuspended with 20 ml pre-chilled STE buffer (150 mM NaCl, 50 mM Tris–HCl [pH 9.5] and 1 mM EDTA [pH 8.0]), then stored at -20 °C. After thawing, the cells were disrupted by sonication on ice for 5 min, and 20% (w/v) Triton X-100 in 1 PBS was added to the samples to be a final concentration of 1% (w/v) Triton X-100. Cell debris was removed by centrifugation at 5000g for 20 min, and the resulting supernatant was recovered to a new tube. The supernatant was further centrifuged at 10,000g for 15 min and the soluble and insoluble (inclusion body) fractions were separated. Total proteins in the soluble fraction were affinity purified by glutathione–Sepharose beads according to the manufacturer’s protocols (Pharmacia biotech, Uppsala, Sweden). Beads were washed twice with 1 PBS containing 1% (w/v) Triton X-100 and once with 1 PBS, and then bound proteins were eluted with elution buffer (200 mM NaCl, 20 mM Reduced Glutathione, 100 mM Tris–HCl [pH 9.5] and 5 mM EDTA [pH 8.0]). The eluted fractions were dialysed against 1 PBS and the amount of recombinant protein was evaluated using both SDS– PAGE and the Coomassie protein assay reagent kit using BSA as a calibration standard according to the manufacturer’s protocol (Pierce Biotechnology, Inc., USA). 2.7. RT-PCR The RNAs were extracted from the purified tachyzoites and encysted bradyzoites using a commercial RNeasy minikit (QIAGEN) as per the manufacturer’s instructions. The RT-PCR was performed following the manufacturer’s instruction (One step RNA PCR kit, Takara, Japan) using the primers shown in Table 1. For normalization, GRA1 and GRA2 primers were used (Table 1) (Dautu et al., 2008b). After RT-PCR, the band intensity amplified from tachyzoite and bradyzoite total RNAs by both primer sets was compared. A concentration of tachyzoite total RNA at which the band intensity

57

amplified by GRA1 and GRA2 primers was at a comparable level between tachyzoite and bradyzoite total RNA samples was selected. The reactions were carried out as follows: 1 cycle at 50 °C for 30 min, 94 °C for 2 min then 30 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 60 s, and finally for 1 cycle at 72 °C for 10 min. After the reaction, the temperature was maintained at 4 °C. The amplified products were analyzed by electrophoresis on 2.0% (w/v) agarose gels and visualized by a UV transilluminator after staining with ethidium bromide (Nippon Gene, Tokyo, Japan). 2.8. Quantitative PCR analysis Total RNAs of tachyzoites, in vivo encysted bradyzoites of T. gondii Beverley strain and in vitro-induced bradyzoites of ME49 strain were extracted using a commercial RNeasy minikit (QIAGEN). RNA samples were treated with RNase-free DNase I at 37 °C for 1 h and then, purified again by RNeasy minikit (QIAGEN). RNA was reverse transcribed to cDNA using High Capacity RNA-to-cDNA Kit (PE Applied Biosystems), and the cDNA was used for the TaqMan realtime PCR analysis. Quantitative PCR was carried out in an ABI PRISM 7900HT Sequence Detection System (PE Applied Biosystems) with each forward and reverse primer set and the corresponding TaqMan probe, synthesized by Applied Biosystems. The reactions were set up to a final volume of 20 ll containing 10 ll of 2 TaqMan Gene Expression Master Mix (PE Applied Biosystems), 900 nM of each forward and reverse primer set, 200 nM of each corresponding probe and 1 ll of cDNA sample. The reaction mixture was initially incubated for 2 min at 50 °C, and then followed by a 10-min step at 95 °C to activate the AmpliTaq Gold DNA polymerase. The amplification was performed for 45 cycles using a two-step condition at 95 °C for 15 s and 60 °C for 1 min. Each sample was tested in triplicate. All the data acquisition and data analyses were performed with Sequence Detector Software (SDS version 2.1; PE Applied Biosystems) and CT values were recorded for statistical analysis on Excel spreadsheets. The relative quantification of SAG1, BAG1 and TgDPA gene expression was carried out using T. gondii tachyzoites as the reference. When expression kinetics of the TgDPA gene was examined in in vitro-induced bradyzoites, the day 0 samples were used as the reference. Results were expressed as x-fold induction calculated by the 2DDC t formula described previously (Fux et al., 2007). The GRA1 gene mRNA was used for normalization. 2.9. Generation of polyclonal anti-TgDPA antibodies The polyclonal anti-TgDPA antibodies were produced in white Japanese rabbit. Rabbit immunization was done as previously described (Dautu et al., 2008a). In brief, the rabbit was immunized subcutaneously at three different inoculation sites with 500 lg of recombinant TgDPA protein diluted in an equal volume of Freund’s complete adjuvant. Two weeks later, the rabbit was immunized with the same dose of antigen emulsified with Freund’s incomplete adjuvant. On day 28, the rabbit was immunized with one more dose of antigen with Freund’s incomplete adjuvant. The rabbit was sacrificed 7 days later and blood for serum preparation was collected. The reactivity of the sera collected was tested using Western blot analysis. Furthermore, the rabbit anti-TgDPA polyclonal antibody was affinity purified by Protein G column as per the manufacturer’s instructions (HiTrap Protein G HP, Amersham). 2.10. Expression of TgDPA in 293T mammalian cells The human embryonic kidney-derived 293T cells were transfected with TgDPA cloned into pcDNA6/V5-HisA and pcDNA6/V5-HisA (control plasmid) using the calcium precipitation method as previously described (Sambrook and Russel, 2001). Cells were harvested

58

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

48 h after transfection and lysed with RIPA buffer (50 mM Tris–HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 0.25 mM sodium deoxycholate, 0.1% (w/v) Triton X-100, 1% (w/v) Nonidet P-40). After centrifugation, the cell lysate was used in subsequent experiments. 2.11. Western blot analysis The lysates of transfected 293T cells and T. gondii tachyzoites and bradyzoites were dissolved in SDS–PAGE sample buffer (62.5 mM Tris–HCl [pH 6.8], 2% (w/v) SDS, 140 mM 2-mercaptoethanol, 10% (w/v) glycerol and 0.02% (w/v) bromophenol blue), heated at 96 °C for 5 min and separated on a 10% polyacrylamide gel. All separated proteins were electrically transferred onto nylon membrane (Immobilon-P, Millipore) using a Western blot apparatus (HorizeBlot Type AE-6677, ATTO Bioscience & Biotechnology, Japan). The separated proteins were detected as described previously (Dautu et al., 2007). 2.12. Indirect immunofluorescence antibody test (IFAT) IFAT was done as previously described (Bohne et al., 1998) with a minor modification using paraffin-embedded mouse brain chronically infected with T. gondii Beverley strain at 1 month postinfection. Briefly, slide sections were deparaffinized in xylene, followed by sequential incubation in 99%, 75% and 50% (v/v) ethanol for rehydration. After further rehydration in distilled water, the slides were rinsed in 1 PBS and then incubated in 10 mM citrate buffer (pH 6.0) at 120 °C for 15 min for restoration of antigenicity. Immunofluorescence analysis was performed on a Leica TCS NT Confocal Laser Scanning Microscope (Leica Microsystems, Germany) using the appropriate settings. Single optical sections were recorded with an optimal pinhole of 1.0 (according to Leica instructions) and 16 times averaging. A series of confocal images were collected at a resolution of 512  512 pixels. Green fluorescence and differential interference contrast (DIC) images were recorded by the Leica PowerScan software (Leica Microsystems, Germany). The images were merged using the Paint Shop Pro program (Corel Japan, Ltd.). 3. Results 3.1. Molecular cloning of TgDPA gene and sequence analysis TgDPA had approximately 30% homology with 2-deoxy-5-ribose phosphate aldolases (DERAs) from other species, and the deoxyribose-phosphate aldolase (DeoC) domain was found in its deduced amino acid sequence. No hydrophobic regions were found by the SOSUI program, meaning that TgDPA is a soluble protein (data not shown). The deduced amino acid sequence of the TgDPA gene was compared with that of DERAs from other species (Fig. 1). An additional gene whose amino acid sequence had 37% homology with TgDPA was found in the T. gondii database (Fig. 1), which was designated ‘‘TgDERA” in this study (gene ID, 59.m03526, Accession No. CB028185 and BM189067). Amino acids of active sites (Asp 102, Lys 167 and Lys 201 in E. coli numbering) and phosphate binding pockets (Gly 171, Lys 172, Gly 204 and 205, Val 206, Arg 207, Gly 236, Ser 238 and 239 in E. coli numbering) were previously identified (Heine et al., 2001; DeSantis et al., 2003; Sakuraba et al., 2003), and these amino acids were well conserved between bacteria and Plasmodium falciparum (Fig. 1). All amino acids in the TgDERA active sites and phosphate binding pockets were well conserved except for Arg 206 which was altered to Lys. On the other hand, in amino acids of the active site in TgDPA, only Lys 201 was conserved while Asp 102 and Lys 167 were altered to Glu and Gln, respec-

tively. In the phosphate binding pockets, only Gly 171, 204 and 236 were conserved (Fig. 1). 3.2. Comparison of TgDPA gene expression level between tachyzoites and bradyzoites by quantitative PCR analysis The mRNA expression levels in the tachyzoites and bradyzoites were compared. GRA1 and GRA2 genes were used as internal controls in both tachyzoites and bradyzoites (Dautu et al., 2008b). Electrophoresis analysis of the GRA1 and GRA2 gene RT-PCR products showed that the employed primers amplified specific bands at 215 and 200 bp, respectively (Fig. 2A). SAG1 and BAG1 genes were used as the positive controls. SAG1 gene was previously reported to be specifically expressed in tachyzoites (Burg et al., 1988; Hoff et al., 2001) while the BAG1 gene in bradyzoites (Bohne et al., 1995). Electrophoresis analysis of the SAG1 and BAG1 gene RTPCR products showed that the employed primers amplified strong single specific bands of expected size of 220 bp in the extracted RNA from T. gondii tachyzoites and 180 bp in the extracted RNA from T. gondii encysted bradyzoites, respectively (Fig. 2A). The electrophoretic analysis of the TgDPA gene RT-PCR products showed that the employed primers shown in Table 1 amplified a strong single band of expected size of 242 bp in the extracted RNA from T. gondii-encysted bradyzoites while very low signal intensity was observed in the tachyzoites (Fig. 2). Quantitative PCR was carried out to examine the expression level of this gene in bradyzoites more precisely. When compared with the reference and normalized to the GRA1 mRNA, SAG1 gene was downregulated 268-fold. In contrast, BAG1 and TgDPA genes were upregulated 9.7- and 32-fold, respectively (Fig. 2B). These results showed clearly that the TgDPA gene is specifically expressed in bradyzoites. 3.3. Production of recombinant TgDPA protein and anti-TgDPA antibody The TgDPA cDNA containing an entire coding region was PCR amplified and subcloned into the pGEX-6P-2 vector. The nucleotide sequence of insert DNA in pGEX-6P-2/TgDPA had a point mutation which would be caused by PCR error. This mutation caused amino acid change from Ala to Val (Fig. 1). Since this amino acid alteration was not in consensus sequence and did not affect the production of recombinant protein described below, we used this plasmid in this study. The recombinant GST-fused TgDPA protein was successfully expressed as a soluble form in E. coli BL21 cells and was then referred to as GST-TgDPA. The molecular mass of GST-TgDPA was approximately 57 kDa (Fig. 3A), in which the molecular weight of the GST moiety is 26 kDa (Smith and Johnson, 1988). Our result of the GST-TgDPA expressed in E. coli BL21 cells was therefore in agreement with the predicted molecular weight of 31 kDa. The polyclonal anti-TgDPA was produced in rabbits. Western blot analysis was used to confirm the production of the antibody. A distinct band was detected at 31 kDa in 293T lysate transfected with pcDNA6/TgDPA (Fig. 3B, lane 2). This value was in good accordance with the molecular weight of TgDPA. No bands were detected either in 293T lysate transfected with empty vector or T. gondii RH strain tachyzoite lysate, respectively (Fig. 3B, lanes 1 and 3). Western blot analysis was carried out in T. gondii lysates of tachyzoites (pH 7.0) and in vitro-induced bradyzoites (pH 8.1). SAG1 and GRA1 proteins were detected in tachyzoites of RH strain, tachyzoites and in vitro-induced bradyzoites of ME49 strain (Fig. 3C). A strong band of BAG1 protein was detected in in vitro-induced bradyzoites of ME49 strain while only a weak band was detected in tachyzoites of ME49 strain. In tachyzoites of RH strain, no band corresponding to BAG1 protein was detected (Fig. 3C). TgDPA protein was detected both in tachyzoites and in vitro-induced

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

59

Fig. 1. Comparison of the deduced amino acid sequences of TgDERA (ToxoDB Gene ID, 59.m03526) and TgDPA (ToxoDB Gene ID, 641.m01505) with the deduced amino acid sequences of DERAs of Escherichia coli (Accession No. NP_418798), Klebsiella pneumoniae (Accession No. BAC78520), Plasmodium falciparum (Accession No. AAN35407), Staphylococcus aureus (Accession No. YP_039605), Bacillus subtilis (Accession No. BAA08337) and Aeropyrum pernix (Accession No. NP_148609). Consensus amino acid sequences in DERA are indicated in the lowest line according to other literature. Arrowheads indicate the conserved amino acids in enzymatic active sites. Phosphate binding pockets are indicated by a double underline. The amino acid which changed to Val from Ala is shown by a box with an arrow.

bradyzoites of ME49 strain, in which band intensity was higher in in vitro-induced bradyzoites than in tachyzoites. No band corresponding to TgDPA protein was detected in tachyzoites of RH strain (Fig. 3C). 3.4. IFAT IFAT was carried out to examine the expression of TgDPA protein in encysted bradyzoites of mouse brain tissue and in vitro-induced bradyzoites using the polyclonal anti-TgDPA antibody produced in this study. Polyclonal anti-BAG1 antiserum and monoclonal anti-SAG1 (p30) antibody were used as the positive and negative controls, respectively. IFAT results of encysted bradyzoites of mouse brain tissue were shown in Fig. 4A. Polyclonal anti-BAG1 antiserum gave a strong fluorescence in the entire cyst in mouse

brain, which was immunologically detected as described previously (Dautu et al., 2008b). On the other hand, no fluorescence was observed when monoclonal anti-SAG1 (p30) antibody was used. When polyclonal anti-TgDPA antibody was used, cysts were stained entirely as in the case of polyclonal anti-BAG1 antiserum. In vitro differentiation of tachyzoites to bradyzoites of PLK strain was performed and confirmed by FITC-conjugated Dolichos biflorus lectin (DBL) and BAG1 staining. The cyst wall was stained with FITC-conjugated DBL at day 5 of in vitro differentiation of bradyzoites (Fig. 4B). Not all parasites were differentiated in vitro from tachyzoites to bradyzoites, in which some parasites are SAG-1 positive (Fux et al., 2007). Therefore, samples contain a mixture of tachyzoites and bradyzoites. TgDPA-positive parasites were costained with BAG1-positive ones while TgDPA-negative parasites were BAG1-negative (Fig. 4B). On the other hand, TgDPA-positive

60

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

A

T

A

B

B

MW (kDa)

DPA GRA1

97 66

GRA2

45

M

1

MW (kDa)

M

1

2

3

98 64 50

SAG1 30

BAG1

B 100

20

14

10

Fold induction

36

22

C

1

31 kDa

10 100

1000

30 kDa SAG1

BAG1

DPA

Fig. 2. (A) RT-PCR analysis of genes expressed in tachyzoites and encysted bradyzoites of T. gondii Beverley strain. GRA1 and GRA2 genes were used as controls of tachyzoites and bradyzoites. SAG1 gene was used as the positive control of tachyzoite-specific gene while the BAG1 gene was used as the bradyzoite-specific positive control gene. Figures of RT-PCR of GRA1, GRA2, SAG1 and BAG1 were cited from Dautu et al., (2008b). (B) Transcription rates were analyzed by real-time PCR and calculated as fold induction when compared with control tachyzoites of T. gondii Beverley strain. Total RNA was isolated from purified tachyzoites in vitro or encysted bradyzoites in vivo of 1-month post infection in ICR mice. SAG1 gene was used as the tachyzoite-specific gene while the BAG1 gene was used as the bradyzoite-specific one. Each bar represents the mean value with standard deviation.

parasites were SAG1-negative while TgDPA-negative parasites were SAG1-positive. These results indicated that TgDPA was not expressed in tachyzoites but in bradyzoites (Fig. 4B). 3.5. Expression kinetics of TgDPA gene Expression kinetics of SAG1, BAG1 and TgDPA genes were examined in in vitro-induced bradyzoites during 5 days by quantitative PCR analysis. The relative amount of gene expression was calculated by comparison with the day 0 samples. SAG1 gene expression level was the highest at day 0, and then the expression decreased gradually (Fig. 5). The rate of increase of BAG1 gene expression was the highest between days 2 (1.25) and 3 (7.90), in which the fold change difference was 6.32-fold. The TgDPA gene expression was not detected or under the detection level at day 0. The rate of increase of TgDPA gene was the highest between days 2 (1.94) and 3 (9.26), in which the fold change difference was 4.77-fold. 4. Discussion The cyst formation mechanism in T. gondii has not yet been well determined. Once T. gondii infects humans and forms cysts in a chronic phase, reactivation of encysted bradyzoites into actively replicating and cytolytic tachyzoites causes symptomatic disease in immunocompromised individuals caused by HIV-AIDS and or-

30 kDa

23 kDa Fig. 3. (A) SDS–PAGE analysis of purified GST-TgDPA. Lane M, molecular marker; lane 1, GST-TgDPA. (B) Western blot analysis showing that polyclonal anti-TgDPA antibody could specifically detect TgDPA protein expressed in 293T cells. Lane M, molecular marker; lane 1, 293T cell lysates; lane 2, 293T cell lysates transfected with pcDNA6/TgDPA; lane 3, cell lysates of T. gondii RH tachyzoites. (C) Western blot analysis could detect TgDPA protein in lysates of tachyzoites and in vitroinduced bradyzoites of ME49 strain. Band intensity was higher in in vitro-induced bradyzoites than in tachyzoites. Lane M, molecular marker; lane T, cell lysates of tachyzoites; lane B, cell lysates of in vitro-induced bradyzoites.

gan transplantation (Tenter et al., 2000). Therefore, it is important to deepen the knowledge of cyst formation and maintenance of its structure from a clinical viewpoint. Several bradyzoite-specific antigens (BAG1/5, CST1, SAG2C/2D, SAG4A, SRS9, p21 and ANK1) (Parmley et al. 1995; Zhang et al., 2001; Lekutis et al., 2000; Cleary et al., 2002; Kim and Boothroyd 2005; Odberg-Ferragut et al., 1996; Friesen et al., 2008) and stage-specific enzymes (ENO1, LDH2, PIS1 and PMA1) (Dzierszinski et al., 1999, 2001; Yang and Parmley 1995; Séron et al., 2000; Holpert et al., 2001) have been reported. However, the whole picture of cyst formation and maintenance of its structure still remains to be elucidated. To reveal the molecular mechanisms in cyst formation and maintenance of its structure, we focused on the genes expressed specifically in the bradyzoite stage. We identified two T. gondii deoxyribose phosphate aldolase-like genes, namely TgDPA and TgDERA genes. The TgDPA gene has been reported previously as a DRPA-like gene which is developmentally regulated in tachyzoite-to-bradyzoite differentiation and one of the bradyzoite-specific genes (Manger

61

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

A SAG1

BAG1

DPA

DIC

Alexa fluor 488

Merged

B

DPA

SAG1

DIC

Merged

DPA

BAG1

DIC

Merged

DBL

DIC

Merged

Fig. 4. (A) Confocal microscopy analysis of localization of TgDPA in section of Beverley cysts formed in mouse brain tissue. Single optical sections were shown. Left panel: differential interference contrast (DIC) images provided to show Beverley cyst outlines. Central panel: fluorescence signal of Beverley cysts labelled with a monoclonal antiSAG1 antibody (negative control, the upper line), polyclonal anti-BAG1 antiserum (positive control, the middle line) and anti-TgDPA antibodies (the lower line). Secondary antibodies are conjugated to Alexa fluor 488 (green). Right panel: fluorescence signal merged with the corresponding DIC images. (B) Confocal microscopy analysis was conducted in in vitro-induced PLK bradyzoites for 5 days. In vitro-induced PLK bradyzoites were labelled with the same antiserum and antibodies as shown in (A). For detection of SAG1 and BAG1, Alexa fluor 594-conjugated anti-mouse IgG antibody (Red) was used as the secondary antibody. In the lowest panels, in vitro-induced cysts stained with FITC-conjugated DBL were shown. Scale bars are 5 lm.

et al., 1998; Cleary et al., 2002). However, further investigations have not yet been conducted on this gene. We successfully cloned the TgDPA gene by RT-PCR. According to a database search, TgDPA was found to have a DeoC domain and approximately 30% homology with other DERAs. These results allowed us to infer that TgDPA has an enzyme activity as DERA. The enzyme activity of TgDPA was examined according to previous

reports using 2-deoxyribose 5-phosphate (dR5P), which has been reported to be a substrate of bacterial DERAs (Valentin-Hansen et al., 1982; Ogawa et al. 2003; Sakuraba et al. 2003). Although enzyme activity was observed in GST-fused E. coli DERA, no enzyme activity was found in GST-TgDPA (data not shown). In DERAs, amino acids of active sites (Asp 102, Lys 167 and Lys 201 in E. coli numbering) and phosphate binding pockets (Gly 171, Lys 172, Gly 204

62

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63

Fold induction

100 Day 0

Day 1

Day 2

Day 3

Day 4

Day 5

39.02

32.89

12.42

14.20 7.90

9.26

10

1.94

1.25 1.19

1

1

1

1.12 1

0.81 0.75 0.62 0.37 0.17

0

SAG1

BAG1

DPA

Fig. 5. Real-time PCR analysis of transcription rates of SAG1, BAG1 and TgDPA genes during 5 days of in vitro differentiation of T. gondii ME49 strain. Transcription rate of SAG1, BAG1 and TgDPA genes was normalized by that of GRA1 gene mRNA. The values represent the fold change based on Ct comparison with day 0. Each bar represents the mean value with standard deviation.

and 205, Val 206, Arg 207, Gly 236, Ser 238 and 239 in E. coli numbering) are well conserved between bacteria (Heine et al. 2001; Horinouchi et al. 2003; Sakuraba et al. 2003) and the human malaria parasite (Gardner et al. 2002). However, amino acids of active sites in TgDPA were not conserved. These findings indicated that TgDPA might have a role without an enzymatic activity in encysted bradyzoites. It has been reported that the T. gondii aldolase has a dual role in cells, participating in glycolysis as a soluble enzyme and binding to the actin cytoskeleton, in an enzymatically inactive state (Walsh et al., 1977). Rhoptry protein 2 (ROP2) has been reported to have kinase domains in its amino acid sequence (El Hajj et al., 2006). This protein has been described as being inserted as a transmembrane protein into the parasitophorus vacuole membrane and to be exposed to the host-cell cytosol (Beckers et al., 1994). ROP2 has been shown in vitro to interact with the mitochondrial import machinery and postulated to mediate the tight association of host mitochondria to the parasitophorus vacuole membrane (Sinai and Joiner 2001). El Hajj et al. (2006) concluded that ROP2, which has lost its kinase feature, may have originated from an ancestral kinase and diverged to acquire other functions such the host organelle association. Even though the function of TgDPA is still unknown, it is likely that TgDPA has another role as in the case of T. gondii aldolase, or as in the case of ROP2, TgDPA might be diverged to have a role especially in bradyzoites. In TgDERA, the amino acids of the active site and phosphate binding pockets were well conserved except for Arg 207, which had been changed to Lys. However, no enzymatic activity was found when GST-TgDERA was used. TgDERA might use another substrate except for dR5P and have a function as DERA-like enzyme. The enzymatic activity of TgDERA is the topic of a future study. We examined the expression level of the TgDPA gene by RT- and quantitative PCR using total RNA extracted from encysted bradyzoites in mouse brain and revealed that this gene was specifically expressed in bradyzoites. The purification of encysted bradyzoites was always associated with contaminants derived from the mouse brain tissue debris hence it was difficult to quantify the mRNA expression levels precisely. In order to overcome this problem, we used T. gondii GRA1 and GRA2 genes as internal controls for normalization. These proteins are equally detected both in tachyzoites and bradyzoites by immunochemistry (Ferguson 2004). Dautu et al. (2008b) also reported that the expression level of GRA1 and GRA2 genes were equally expressed between tachyzo-

ites and bradyzoites. In addition, Cleary et al. (2002) showed by northern blot analysis that the GRA2 gene was constitutively expressed both in tachyzoites and bradyzoites at a comparable level. These reports indicated that the GRA1 and GRA2 genes are useful for normalization between tachyzoites and bradyzoites in RTand quantitative PCR analyses. The expression level of SAG1 gene is higher in T. gondii tachyzoites (Burg et al., 1988; Hoff et al., 2001) while that of the BAG1 gene is higher in bradyzoites (Bohne et al. 1995). Thus, the SAG1 gene was used as a positive control for the tachyzoite-specific gene while the BAG1 gene was used as the bradyzoite-specific positive control. RT- and quantitative PCR data were in good accordance with these previous findings (Fig. 2), indicating that our RT- and quantitative PCR systems were able to distinguish bradyzoite-specific genes from tachyzoite-specific ones. Using our systems, we revealed that the TgDPA gene was highly expressed in bradyzoites. These findings indicated that the TgDPA gene is a bradyzoite-specific gene. We could successfully express the TgDPA protein as a soluble form (Fig. 3A) and obtained polyclonal antibody against TgDPA using GST-TgDPA as an antigen. Western blot analysis suggested that the polyclonal anti-TgDPA antibody was able to detect TgDPA specifically produced in mammalian cells (Fig. 3B) and in in vitroinduced bradyzoites (Fig. 3C). IFAT was carried out to examine the expression of TgDPA in encysted bradyzoites using the polyclonal anti-TgDPA antibody (Fig. 4). An entire cyst was stained by the polyclonal anti-TgDPA antibody. This finding indicated that TgDPA exists in the parasites of encysted bradyzoites. This is the first report on the distribution of TgDPA in encysted bradyzoites. By IFAT using in vitro-induced bradyzoites after 5 days of stress, TgDPA-positive parasites were detected in BAG1-positive and SAG1-negative parasites (Fig. 4B). This indicates that TgDPA was produced when the differentiation to bradyzoites had started. Our observations are supported by the results obtained by RTPCR analysis using in vitro-induced bradyzoites, in which TgDPA gene expression gradually increased from day 2 along the time course over 5 days (Fig. 5). In conclusion, we confirmed by RT- and quantitative PCR that the TgDPA gene was highly expressed in encysted bradyzoites and that the expression level of this gene gradually increased after pH stress. Furthermore, we reported for the first time that TgDPA exists in the whole part of encysted bradyzoites and in vitro-induced bradyzoites through IFAT. The TgDPA gene can be used as a novel bradyzoite-specific marker, and research on this gene may help to reveal the mechanisms of tachyzoite-to-bradyzoite conversion and the involvement in chronic infection in intermediate hosts. Acknowledgments We sincerely thank Dr. David Sibley at Washington University School of Medicine, St. Louis, MO, USA, for the use of his laboratory during our training course and Dr. Blima Fux and Dr. Asis Khan (Washington University School of Medicine) for the instruction of in vitro bradyzoite differentiation technique. We sincerely thank Dr. Kami Kim in Albert Einstein College of Medicine, NY, USA, for generously providing T. gondii ME49 strain. This work was made possible by a Grant-in-Aid for Scientific Research to National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine. References Beckers, C.J., Dubremetz, J.F., Mercereau-Puijalon, O., Joiner, K.A., 1994. The Toxoplasma gondii rhoptry protein ROP2 is inserted into the parasitophorous vacuole membrane, surrounding the intracellular parasite, and is exposed to the host cell cytoplasm. The Journal of Cell Biology 127, 947–961. Bohne, W., Gross, U., Ferguson, D.J., Heesemann, J., 1995. Cloning and characterization of a bradyzoite-specifically expressed gene (hsp30/bag1) of

A. Ueno et al. / Experimental Parasitology 121 (2009) 55–63 Toxoplasma gondii, related to genes encoding small heat-shock proteins of plants. Molecular Microbiology 16, 1221–1230. Bohne, W., Hunter, C.A., White, M.W., Ferguson, D.J., Gross, U., Roos, D.S., 1998. Targeted disruption of the bradyzoite-specific gene BAG1 does not prevent tissue cyst formation in Toxoplasma gondii. Molecular and Biochemical Parasitology 92, 291–301. Burg, J.L., Perelman, D., Kasper, L.H., Ware, P.L., Boothroyd, J.C., 1988. Molecular analysis of the gene encoding the major surface antigen of Toxoplasma gondii. The Journal of Immunology 141, 3584–3591. Cleary, M.D., Singh, U., Blader, I.J., Brewer, J.L., Boothroyd, J.C., 2002. Toxoplasma gondii asexual development: identification of developmentally regulated genes and distinct patterns of gene expression. Eukaryotic Cell 1, 329–340. Dautu, G., Ueno, A., Miranda, A., Mwanyumba, S., Munyaka, B., Carmen, G., Kariya, T., Omata, Y., Saito, A., Xuan, X., Igarashi, M., 2008a. Toxoplasma gondii: Detection of MIC10 antigen in sera of experimentally infected mice. Experimental Parasitology 118, 362–371. Dautu, G., Ueno, A., Munyaka, B., Carmen, G., Makino, S., Kobayashi, Y., Igarashi, M., 2008b. Molecular and biochemical characterization of Toxoplasma gondii bhydroxyacyl-acyl carrier protein dehydratase (FABZ). Parasitology Research 102, 1301–1309. DeSantis, G., Liu, J., Clark, D.P., Heine, A., Wilson, I.A., Wong, C.-H., 2003. Structurebased mutagenesis approaches toward expanding the substrate specificity of D2-deoxyribose-5-phosphate aldolase. Bioorganic and Medical Chemistry 11, 43–52. Dubey, J.P., 1986. Toxoplasmosis. Journal of the American Veterinary Medical Association 189, 166–170. Dubey, J.P., Lindsay, D.S., Speer, C.A., 1998. Structure of Toxoplasma gondii tachyzoites, bradyzoites, and sporozoites and biology and development of tissue cysts. Clinical Microbiology Reviews 11, 267–299. Dzierszinski, F., Popescu, O., Toursel, C., Slomianny, C., Yahiaoui, B., Tomavo, S., 1999. The protozoan parasite Toxoplasma gondii expresses two functional plantlike glycolytic enzymes. Implications for evolutionary origin of apicomplexans. The Journal of Biological Chemistry 274, 24888–24895. Dzierszinski, F., Mortuaire, M., Dendouga, N., Popescu, O., Tomavo, S., 2001. Differential expression of two plant-like enolases with distinct enzymatic and antigenic properties during stage conversion of the protozoan parasite Toxoplasma gondii. Journal of Molecular Biology 309, 1017–1027. El Hajj, H., Demey, E., Poncet, J., Lebrun, M., Wu, B., Galéotti, N., Fourmaux, M.N., Mercereau-Puijalon, O., Vial, H., Labesse, G., Dubremetz, J.F., 2006. The ROP2 family of Toxoplasma gondii rhoptry proteins: proteomic and genomic characterization and molecular modeling. Proteomics 6, 5773–5784. Ferguson, D.J.P., 2004. Use of molecular and ultrastructural markers to evaluate stage conversion of Toxoplasma gondii in both the intermediate and definitive host. International Journal for Parasitology 34, 347–360. Friesen, J., Fleige, T., Gross, U., Bohne, W., 2008. Identification of novel bradyzoitespecific Toxoplasma gondii genes with domains for protein–protein interactions by suppression subtractive hybridization. Molecular and Biochemical Parasitology 157, 228–232. Fux, B., Nawas, J., Khan, A., Gill, D.B., Su, C., Sibley, L.D., 2007. Toxoplasma gondii strains defective in oral transmission are also defective in developmental stage differentiation. Infection and Immunity 75, 2580–2590. Gardner, M.J., Hall, N., Fung, E., White, O., Berriman, M., Hyman, R.W., Carlton, J.M., Pain, A., Nelson, K.E., Bowman, S., Paulsen, I.T., James, K., Eisen, J.A., Rutherford, K., Salzberg, S.L., Craig, A., Kyes, S., Chan, M.S., Nene, V., Shallom, S.J., Suh, B., Peterson, J., Angiuoli, S., Pertea, M., Allen, J., Selengut, J., Haft, D., Mather, M.W., Vaidya, A.B., Martin, D.M., Fairlamb, A.H., Fraunholz, M.J., Roos, D.S., Ralph, S.A., McFadden, G.I., Cummings, L.M., Subramanian, G.M., Mungall, C., Venter, J.C., Carucci, D.J., Hoffman, S.L., Newbold, C., Davis, R.W., Fraser, C.M., Barrell, B., 2002. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, 498–511. Heine, A., DeSantis, G., Luz, J.G., Mitchell, M., Wong, C.-H., Wilson, I.A., 2001. Observation of covalent intermediates in an enzyme mechanism at atomic resolution. Science 294, 369–374. Hoff, E.F., Cook, S.H., Sherman, G.D., Harper, J.M., Ferguson, D.J., Dubremetz, J.F., Carruthers, V.B., 2001. Toxoplasma gondii: molecular cloning and characterization of a novel 18-kDa secretory antigen, TgMIC10. Experimental Parasitology 97, 77–88. Holpert, M., Luder, C.G.K., Gross, U., Bohne, W., 2001. Bradyzoite-specific expression of a P-type ATPase in Toxoplasma gondii. Molecular and Biochemical Parasitology 112, 293–296. Horinouchi, N., Ogawa, J., Sakai, T., Kawano, T., Matsumoto, S., Sasaki, M., Mikami, Y., Shimizu, S., 2003. Construction of deoxyriboaldolase-overexpressing Escherichia coli and its application to 2-deoxyribose 5-phosphate synthesis from glucose and acetaldehyde for 20 -deoxyribonucleoside production. Applied and Environmental Microbiology 69, 3791–3797. Kim, S.-K., Boothroyd, J.C., 2005. Stage-specific expression of surface antigens by Toxoplasma gondii as a mechanism to facilitate parasite persistence. The Journal of Immunology 174, 8038–8048.

63

Lekutis, C., Ferguson, D.J.P., Boothroyd, J.C., 2000. Toxoplasma gondii: identification of a developmentally regulated family of genes related to SAG2. Experimental Parasitology 96, 89–96. Luft, B.J., Remington, J.S., 1992. Toxoplasmic encephalitis in AIDS. Clinical Infectious Diseases 15, 211–222. Makala, L.H., Reyes, J.C., Nishikawa, Y., Tsushima, Y., Xuan, X., Huang, X., Nagasawa, H., 2003. A comparison of the phenotype of dendritic cells derived from discrete Peyer’s patch macrophages of non-infected and Toxoplasma gondii infected mice. The Journal of Veterinary Medical Science 65, 591–597. Manger, I.D., Hehl, A., Parmley, S., Sibley, L.D., Marra, M., Hillier, L., Waterston, R., Boothroyd, J.C., 1998. Expressed sequence tag analysis of the bradyzoite stage of Toxoplasma gondii: identification of developmentally regulated genes. Infection and Immunity 66, 1632–1637. McLeod, R., Remington, J.S., 1987. Toxoplasmosis. In: Braunwald, E.B. et al. (Eds.), Harrison’s Principles of Internal Medicine. 11th ed. McGraw-Hill, New York. Navia, B.A., Petito, C.K., Gold, J.W., Cho, E.S., Jordan, B.D., Price, R.W., 1986. Cerebral toxoplasmosis complicating the acquired immune deficiency syndrome: clinical and neuropathological findings in 27 patients. Annals of Neurology 19, 224– 238. Odberg-Ferragut, C., Soête, M., Engels, A., Samyn, B., Loyens, A., Van Beeumen, J., Camus, D., Dubremetz, J.F., 1996. Molecular cloning of the Toxoplasma gondii sag4 gene encoding an 18 kDa bradyzoite specific surface protein. Molecular and Biochemical Parasitology 82, 237–244. Ogawa, J., Saito, K., Sakai, T., Horinouchi, N., Kawano, T., Matsumoto, S., Sasaki, M., Mikami, Y., Shimizu, S., 2003. Microbial production of 2-deoxyribose 5phosphate from acetaldehyde and triosephosphate for the synthesis of 20 deoxyribonucleosides. Bioscience, Biotechnology, and Biochemistry 67, 933– 936. Omata, Y., Inoue, N., Yonematsu, K., Claveria, F.G., Igarashi, I., Saito, A., Suzuki, N., 1995. Detection of collagen-cross reactive antigenic components in Toxoplasma gondii. Journal of Protozoological Research 5, 33–39. Parmley, S.F., Weiss, L.M., Yang, S., 1995. Cloning of a bradyzoite-specific gene of Toxoplasma gondii encoding a cytoplasmic antigen. Molecular and Biochemical Parasitology 73, 253–257. Sakuraba, H., Tsuge, H., Shimoya, I., Kawakami, R., Goda, S., Kawarabayasi, Y., Katunuma, N., Ago, H., Miyano, M., Ohshima, T., 2003. The first crystal structure of archaeal aldolase. Unique tetrameric structure of 2-deoxy-D-ribose-5phosphate aldolase from the hyperthermophilic archaea Aeropyrum pernix. Journal of Biological Chemistry 278, 10799–10806. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Séron, K., Dzierszinski, F., Tomavo, S., 2000. Molecular cloning, functional complementation in Saccharomyces cerevisiae and enzymatic properties of phosphatidylinositol synthase from the protozoan parasite Toxoplasma gondii. European Journal of Biochemistry 267, 6571–6579. Sgarrella, F., Poddie, F.P., Meloni, M.A., Sciola, L., Pippia, P., Tozzi, M.G., 1997. Channelling of deoxyribose moiety of exogenous DNA into carbohydrate metabolism: role of deoxyriboaldolase. Comparative Biochemistry and Physiology. Part B: Biochemistry and Molecular Biology 117, 253–257. Sinai, A.P., Joiner, K., 2001. The Toxoplasma gondii protein ROP2 mediates host organelle association with the parasitophorous vacuole membrane. The Journal of Cell Biology 154, 95–108. Smith, D.B., Johnson, K.S., 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67, 31–40. Tenter, A.M., Heckeroth, A.R., Weiss, L.M., 2000. Toxoplasma gondii: from animals to humans. International Journal for Parasitology 30, 1217–1258. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Valentin-Hansen, P., Boëtius, F., Hammer-Jespersen, K., Svendsen, I., 1982. The primary structure of Escherichia coli K12 2-deoxyribose 5-phosphate aldolase. Nucleotide sequence of the deoC gene and the amino acid sequence of the enzyme. European Journal of Biochemistry 125, 561–566. Walsh, T.P., Clarke, F.M., Masters, C.J., 1977. Modification of the kinetic parameters of aldolase on binding to the actin-containing filaments of skeletal muscle. Biochemical Journal 165, 165–167. Wong, S.Y., Remington, J.S., 1993. Biology of Toxoplasma gondii. AIDS 7, 299–316. Yahiaoui, B., Dzierszinski, F., Bernigaud, A., Slomianny, C., Camus, D., Tomavo, S., 1999. Isolation and characterization of a subtractive library enriched for developmentally regulated transcripts expressed during encystations of Toxoplasma gondii. Molecular and Biochemical Parasitology 99, 223–235. Yang, S., Parmley, S.F., 1995. A bradyzoite stage-specifically expressed gene of Toxoplasma gondii encodes a polypeptide homologous to lactate dehydrogenase. Molecular and Biochemical Parasitology 73, 291–304. Zhang, Y.W., Halonen, S.K., Ma, Y.F., Wittner, M., Weiss, L.M., 2001. Initial characterization of CST1, a Toxoplasma gondii cyst wall glycoprotein. Infection and Immunity 69, 501–507.