- Email: [email protected]
Toxoplasma gondii: Over-expression of lactate dehydrogenase enhances differentiation under alkaline conditions
Experimental Parasitology 122 (2009) 155–161
Contents lists available at ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Toxoplasma gondii: Over-expression of lactate dehydrogenase enhances differentiation under alkaline conditions Urszula Liwak, Sirinart Ananvoranich * Department of Chemistry and Biochemistry, University of Windsor, 401 Sunset Avenue, Windsor, Ont., Canada N9B 3P4
a r t i c l e
i n f o
Article history: Received 14 November 2008 Received in revised form 22 January 2009 Accepted 23 January 2009 Available online 6 February 2009 Keywords: Toxoplasma gondii Lactate dehydrogenase Differentiation Enzymatic activity
a b s t r a c t Toxoplasma gondii, an intracellular parasite, has two distinctive growth stages, namely rapidly growing tachyzoites and slowly growing bradyzoites. Here we report a unique physiological function of the last committed glycolytic enzyme of T. gondii, lactate dehydrogenase (TgLDH), which is present in two isoforms and expressed in a stage-specific manner. TgLDH1 is present in tachyzoites while TgLDH2 is found in bradyzoites. Using clonal transgenic parasites over-expressing either TgLDH1 or TgLDH2, we showed that the enzymatic activity, growth, and virulence of tachyzoites were unaffected by the presence of the recombinant protein. Interestingly, under alkaline conditions the presence of the recombinant TgLDH proteins increased the differentiation, as detected by the formation of cyst structures in vitro, while green fluorescent protein did not. The differentiation enhancement of the recombinant TgLDH1 and TgLDH2 strongly suggests that TgLDH1 and TgLDH2 have an important physiological function, in addition to being glycolytic enzymes and differentiation markers. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction Toxoplasma gondii is an intracellular protozoan parasite of the Apicomplexa phylum that infects a variety of mammals and birds, including approximately one-third of the human population. Acute infection of T. gondii is often asymptomatic and the parasites may exist as rapidly dividing tachyzoites. In response to the host immunity, the tachyzoites differentiate into the slow-replicating bradyzoites. Having distinct physiological features, the bradyzoites encyst and remain in the infected host tissues throughout the life of the host (Ferguson et al., 2002; Lindsay et al., 1991). The bradyzoite-to-tachyzoite stage conversion was suggested to be the cause of recurrent infection (Reiter-Owona et al., 2000). In vitro when the infected monolayers are subjected to stress conditions, such as alkaline media (Boothroyd et al., 1997; Soete et al., 1993), the tachyzoite-to-bradyzoite stage conversion can be observed mimicking the parasite’s response to the host immunity. Hence, such conditions allow the study of differentiation and facilitate the search for possible drug targets and the development of preventive strategies and therapeutic agents for toxoplasmosis (Dando et al., 2001; Kavanagh et al., 2004). Although tachyzoites and bradyzoites have equally functional glycolytic pathways (Denton et al., 1996), a unique set of glycolytic enzymes are responsible for the energy production of each differentiation stage (Fleige et al., 2007; Tomavo, 2001). With the excep* Corresponding author. Fax: +1 519 973 7098. E-mail address: [email protected] (S. Ananvoranich). 0014-4894/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2009.01.016
tion of hexokinase and glucose-6-phosphate isomerase, each glycolytic enzyme is coded by at least two independent genes whose mRNAs are differentially regulated (Fleige et al., 2007). We are particularly interested in two isoforms of Toxoplasma lactate dehydrogenase (TgLDH1 and TgLDH2, EC 1.1.1.27), the last committed enzyme of the glycolytic pathway. The expression of genes encoding TgLDH1 and TgLDH2 are differentially regulated and commonly used as markers of the differentiation stage: TgLDH1 is the marker of the tachyzoite stage, while TgLDH2 is that of the bradyzoite stage (Yang and Parmley, 1997). Both TgLDH1 and TgLDH2 catalyze the inter-conversion of pyruvate to lactate. Structural and biochemical analyses showed that the active sites of TgLDH1 and TgLDH2 carry a pentapeptide insertion and have a preference for the co-enzyme APAD as well as NAD (Kavanagh et al., 2004). Having structural differences from human LDH isoenzymes, TgLDH1 and TgLDH2 are considered ideal targets for the development of anti-parasitic agents with a board spectrum to combat both acute and recurrent toxoplasmosis (Dando et al., 2001; Kavanagh et al., 2004). Binding to this pentapeptide insertion, small molecules/ligands would interfere with the activity of TgLDH1 and TgLDH2. More importantly, the inhibition of TgLDH2 might confer a highly potent anti-parasitic effect because the encysted and slow-replicating bradyzoites lack a functional TCA cycle and respiratory chain (Denton et al., 1996), and would consequently depend greatly on the activity of TgLDH2 for energy production under anaerobic respiration. Moreover, the previous study on TgLDH1 and TgLDH2 showed that the physiological level of TgLDH1 and TgLDH2 expression is required for the parasites to
156
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
maintain their normal growth and to allow for differentiation (AlAnouti et al., 2004). This evidence thus indicates that the activity of TgLDH1 and TgLDH2 together with the temporal regulation of TgLDH1 and TgLDH2 expression could be used as potential drug targets. This study further investigated whether the TgLDH protein, with or without its enzymatic activity, would enhance the differentiation and delay growth. The hypothesis was validated by addressing whether the increase of TgLDH expression would give rise to a higher number of cysts and parasites per cyst. Transgenic parasites that over-express either TgLDH1 or TgLDH2 were created. Although the over-expression of TgLDH1 or TgLDH2 did not change the overall TgLDH enzymatic activity, increase the growth of tachyzoites, or yield a more virulent parasite strain, a significant in vitro differentiation to bradyzoites was detected after increased TgLDH1 or TgLDH2 expression. 2. Materials and methods 2.1. Plasmid designs and constructs The coding sequences of TgLDH1 and TgLDH2 (GenBank Accession Nos. U35118 and U23207) were amplified from pMAL_LDH1 and pMAL_LDH2 (plasmids obtained from Dr. S. Parmley, Palo Alto Medical Foundation) using specific primers, 50 LDHxNsiI: GATTTC AGAATTCGG ATCC and 30 LDHxPacI: CCCTTAATTAAGTGCCAAGC TTAAGATC and used to generate the PCR products with NsiI cutting site on their 50 -terminus and PacI cutting site on their 30 -terminus. The PCR products were subsequently cloned into the Toxoplasmaexpression plasmid, pTUB8Myc_His_X-HX (gift from Dr. D. Soldati, University of Geneva) so that the expression of TgLDH1 or TgLDH2 was under the control of a modified tubulin (TUB) promoter and the recombinant protein was led by MYC- and His-epitope tags on their N-terminus to give predicted molecular weights of 39.2 and 39.9 kDa, respectively. The constructs were confirmed by nucleotide sequencing reactions. 2.2. Parasite and host cultures Human foreskin fibroblasts (HFF) and a laboratory strain, RHDHX, which is a type I strain of T. gondii were obtained from Dr. D. Roos, University of Pennsylvania. HFF were grown in DMEM (Invitrogen) supplemented with 10% cosmic calf serum (Hyclone), and antibiotic–antimycotic (Invitrogen) and used for T. gondii infection. The infected HFF monolayers were maintained using MEM (Invitrogen) supplemented with 1% dialyzed calf serum (Hyclone) and antibiotic–antimycotic. The parasite, RHDHX, was chosen because of its rapid growth and well characterization allowing for the generation of transgenic parasites using hypoxanthine–xanthine–guanine phosphoribosyltransferase (HXGPRT) as a selectable marker (Donald et al., 1996). Using a previously described method (Roos et al., 1994), transgenic parasites were generated by electroporation of RHDHX with plasmids containing HXGPRT and selected and maintained in the culture media containing 25 lg/ml mycophenolic acid and 50 lg/ml xanthine. Freshly released parasites were subcultured every few days until further needed. To monitor the tachyzoite growth, the parasites were infected onto HFF monolayers grown on coverslips and kept under 37 °C and 5% CO2 for 24 and 48 h which is defined as the tachyzoite growth conditions (AlAnouti et al., 2004). Tachyzoite-to-bradyzoite stage conversion was induced by keeping the infected monolayers under atmospheric CO2 and in RMPI-1640 (Sigma–Aldrich) supplemented with 50 mM Hepes, pH 8.2, 5% dialyzed serum, and antibiotic–antimycotic for 5 days (Soete et al., 1993; Tomavo, 2001) to ensure and maintain the differentiation. After 5 days, the alkaline stress was removed and parasites were grown under tachyzoite conditions for 48 h to
measure whether the encysted parasites retained their ability to convert back to tachyzoites. 2.3. Growth assays The growth assays were performed as previously described (AlAnouti et al., 2004) Infected monolayers grown on coverslips were fixed with 3% paraformaldehyde, and their nuclei were stained using 100 lM Hoechst (Sigma–Aldrich) to enable to the visualization of intracellular parasites and host cells, respectively. We conducted a growth assay using clonal parasites from early and late passages, where the former were from less than three passages and the latter from six passages, to ensure that the results were consistent. Following infection under tachyzoite conditions, the number of parasites in the vacuoles was monitored from the early (Fig. 2B) and late passages (Supplementary data, S1). FITC conjugated Dolichos biflorus agglutinin (Sigma–Aldrich, 1:300 dilution), which specifically interacts with the glycoprotein of the cyst wall, was used for the visualization of the locations of cyst structures. We counted, in triplicate, the parasites from an average of 100 vacuoles or cysts per coverslip to determine the number of parasites per vacuole or cyst. 2.4. Immunofluorescence assays and Western blot analyses For other immunofluorescence assays, the paraformaldehyde fixed monolayers were permeabilized with 0.25% Triton X-100 in PBS, and non-specific sites were blocked using 5% bovine serum albumin (BSA, Sigma–Aldrich). The protein of interest (antigen) was revealed after subsequent incubations and washes with PBS with; (i) the primary antibodies, the mouse anti-MYC (9E10, 1:500), the rabbit anti-TgLDH1 or anti-TgLDH2 antibodies (obtained from Dr. S. Parmley, 1:1000) and (ii) the secondary antibodies, rhodamine conjugated goat anti-mouse (Rockland Immunochemicals, 1:800) or rhodamine conjugated goat anti-rabbit (Rockland Immunochemicals, 1:800) were used. To reveal the cyst wall structure and nuclei, FITC conjugated D. biflorus agglutinin (Sigma–Aldrich, 1:300) and 100 lM Hoechst were used. All images were taken with a Q-imaging CCD camera on a Leica DMIRB microscope using the Northern Eclipse software (Al-Anouti et al., 2004). Western blot analyses were performed using the lysates prepared from freshly lysed parasites, including parental RHDHX and transgenic parasites over-expressing either LDH1 or LDH2, in PBS containing 10 lM PMSF (Al-Anouti et al., 2004). The samples were resolved on a 12% SDS–PAGE and transferred to a nitrocellulose membrane (Pall Corporation). Following the incubation in primary antibody specific to TgLDH1 (1:2000), TgLDH2 (1:2000), MYC (9E10, 1:1000), or TUB (12G10, 1:1000), the blots were incubated in the appropriate secondary antibodies; either horseradish peroxidase conjugated goat anti-rabbit (1:20,000) for TgLDH1 and TgLDH2, or horseradish peroxidase conjugated goat anti-mouse (1:10,000) for MYC and TUB. Chemiluminescent detection was performed using the chemiluminescent HRP substrate kit (Millipore). Densitometric measurements were determined using the ImageJ program developed at the National Institutes of Health. To further confirm that the cyst structure was a direct consequence of the differentiation, Western blot analysis was performed using the antiBAG1 antibody (Bohne et al., 1995) to validate the presence of bradyzoite-specific antigen 1 (BAG1). BAG1 is a bradyzoite-specific antigen and used as a marker for differentiation. 2.5. Lactate dehydrogenase enzyme activity Enzymatic assays were performed as previously described (AlAnouti et al., 2004; Dando et al., 2001; Kavanagh et al., 2004).
157
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
Briefly, freshly released tachyzoites were harvested and lysed in 100 mM Tris, pH 7.4 and 0.5 mM phenylmethylsulfonylfluoride protease inhibitor. Protein concentrations were determined using the Bio-Rad protein assays. Reactions were carried out at 25 °C in a reaction buffer containing 100 mM Tris, pH 7.4, 0.1 mg/ml NADH (Sigma–Aldrich), and 5 lg of cell-free lysates. Reactions were initiated by the addition of 1.6 mM pyruvate (Sigma–Aldrich) and monitored at 340 nm for the change in absorbance of NADH ( = 6220 M1 cm1). The assays were performed in triplicate, and average values were presented with their standard deviations.
3. Results and discussion 3.1. Transgenic parasites over-expressing recombinant TgLDHs To investigate the effect of the over-expression of TgLDH1 and TgLDH2 on the parasite multiplication, we transformed a type I strain of T. gondii, RHDHX, with constructed transforming plasmids. Several clonal parasites, which over-expressed either the TgLDH1 protein or the TgLDH2 protein, were selected for the study and named RML1-A and RML1-B and RML2-A to RML2-D, respectively, where R indicates the RHDHX parental strain, M indicates the Myc tag, and L1 and L2 indicates over-expressed LDH1 and LDH2, respectively. The levels of recombinant TgLDH1 and TgLDH2 expression in the tachyzoite stage were monitored by Western blot analysis (Fig. 1A). The tachyzoites of the parental parasite (RHDHX) strain expressed detectable levels of TgLDH1, but not TgLDH2. This result is in agreement with previous observations documented by Yang and Parmley (1995, 1997). The endogenous TgLDH1 (approximately 35 kDa) was detected in all samples prepared from the selected clones and RHDHX strain. The recombinant TgLDH1 protein was detected by the anti-MYC and anti-TgLDH1 antibodies only in the clonal parasite RML1-A and RML1-B strains. These recombinant TgLDH1 bands were resolved as approximately 39 kDa, whose larger size corresponds to the MYC-tag and additive peptide. Four clonal RML2 (A–D) strains expressed relatively high levels of the TgLDH2 protein (approximately 40 kDa, Fig. 1A) as detected by the anti-TgLDH2 and anti-MYC antibodies. To normalize the expression of the recombinant proteins of the transgenic clonal parasites, the expression levels of recombinant proteins were quantified against those of tubulin (Fig. 1B). Between the clonal TgLDH1 strains, RML1-A exhibited a higher level of recombinant TgLDH1 than RML1-B. Among the clonal TgLDH2 strains, RML2-C exhibited the lowest amount of recombinant TgLDH2 and RML2A and RML2-D had the highest levels. It was noted that there was no direct relationship between the level of recombinant protein expression and the endogenous level of TgLDH1 expression. The varied levels of recombinant TgLDH1 and TgLDH2 expression in the clonal strains might be the result of the integration frequency and location where the random gene integration took place, which is quite common in T. gondii (Donald et al., 1996; Striepen et al., 1998). To determine if the varied levels of over-expression altered the overall activity of TgLDH, enzymatic assays were performed (Table 1). The TgLDH activity of the parental tachyzoites, RHDHX, was 1473 ± 4 nmol min1 mg1. The over-expression of TgLDH1 in the RML1-A and RML1-B strains displayed similar activity as parental, 1428 ± 107 and 1933 ± 241 nmol min1 mg1, respectively. The RML2-A, RML2-B, RML2-C, and RML2-D strains with over-expressed TgLDH2, with activities of 1260 ± 287, 1072 ± 210, 1009 ± 185, and 1167 ± 132 nmol min1 mg1, also resembled the activity of parental. Due to the distinctive over-expression, we expected a change in the overall TgLDH enzymatic activity. We detected neither an increase nor decrease in TgLDH activity. It has
Fig. 1. Expression of the recombinant proteins in the selected clones. (A) Western blot analyses of recombinant Toxoplasma gondii lactate dehydrogenase (TgLDH1 and TgLDH2) expression. Anti-MYC, -TgLDH1, -TgLDH2, and -TUB antibodies were used in the revealing of the corresponding proteins as indicated on the left. Estimated sizes of the detected bands are indicated on the right. The light bands found in the a-LDH2 panel were the residual signals resulting from successive a-Myc and aLDH2 antibody incubations. The blot was first revealed using a-Myc antibody and then stripped, prior to a-LDH2 incubation. (B) Comparative levels of the recombinant TgLDH protein among the clonal strains was obtained following densitometric measurements of the band intensities and normalized against those of TUB.
Table 1 The enzymatic activity of Toxoplasma gondii lactate dehydrogenase. The enzymatic activity of LDH was calculated for all the transgenic parasites and compared to parental in nmol min1 mg1. Strains
Activities (nmol min1 mg1)
RHDHX RML1-A RML1-B RML2-A RML2-B RML2-C RML2-D
1473 ± 4 1428 ± 107 1933 ± 241 1260 ± 287 1072 ± 210 1009 ± 185 1167 ± 132
been suggested that the active TgLDH enzyme is formed upon the assembly of a homotetrameric complex (Dando et al., 2001). If the recombinant proteins were non-functional, due to mis-folding or mutation, the proteins would have interfered with the assembly of wild-type LDH complexes and would have decreased the overall TgLDH activity. It is also likely that the mis-folded proteins would have been degraded and given rise to truncated and unstable forms of the recombinant proteins. If this was the case, we would have detected multiple bands with varying molecular weights. However, the Western blot analyses showed single bands (Fig. 1A) when either the anti-MYC or anti-TgLDH antibody was used. On the other hand, if the recombinant proteins were functional and able to form ternary complexes, we should have de-
158
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
tected an increase in the overall enzymatic activity. Another possible explanation is that the recombinant proteins were sequestered upon over-expression, similar to the formation of inclusion bodies in bacteria (Kiefhaber et al., 1991; Mukhopadhyay, 1997). The recombinant proteins would have been protected from degradation and the formation of active ternary complexes, while remaining in the cytosol.
Prior to a phenotypical analysis, to ensure that the recombinant TgLDH1 and TgLDH2 proteins were expressed uniformly in each clone, we performed immunofluorescence assays. We detected the recombinant TgLDH1 and TgLDH2 proteins localized in the cytosol which is in agreement with previous studies shown by Ferguson et al. (2002). The level of recombinant protein expression in the RML1-B strain, which was uniformly expressed and similar to all the other clones, was detected by the anti-MYC primary anti-
Fig. 2. Tachyzoites’ growth analyses. (A) Immunofluorescence detection of MYC-tagged Toxoplasma gondii lactate dehydrogenase 1 (TgLDH1) in the tachyzoites of RML1-B. Nuclei of the HFF host and the tachyzoites were stained with Hoechst, as indicated by an arrowhead and an arrow, respectively. The recombinant TgLDH1 was localized in the cytosol. The bar represents 15 lm. (B) Comparative growth analysis of an early passage was displayed as the fraction (%) of vacuoles (y-axis) containing various numbers of the tachyzoites (x-axis) counted from the parental and clonal parasites at 24 or 48 h post-infection.
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
body and the rhodamine conjugated anti-mouse secondary antibody (Fig. 2A, a-MYC-Rho). Since there was no apparent correlation between the levels of over-expression, localization and the overall TgLDH activity, for convenience, clonal RML1-B, RML2-A, and RML2-D strains were selected for further analysis. Subsequently we determined if overexpression of TgLDH had an effect on the growth of tachyzoites. It has previously been reported that serial passages of transgenic T. gondii cultures may cause a reduction in the expression of recombinant proteins (Van et al., 2007); therefore, we conducted a growth assay using clonal parasites from early and late passages, where the former were from less than three passages and the latter from six passages, to ensure that the results were consistent. Following infection under tachyzoite conditions, the numbers of parasites in the vacuoles were monitored from the early (Fig. 2B) and
159
late passages (Supplementary data, S1). At 24 h post-infection, 50% of vacuoles formed by all strains, including RML1-B, RML2-A, RML2-D, and RHDHX, contained 8 parasites. The early and late passages exhibited the same trend. At 48 h post-infection, all strains showed a similar growth pattern of having about 50% of vacuoles with more than 32 parasites. These results suggest that the overexpression of recombinant TgLDH1 or TgLDH2 proteins had no effect on the growth of tachyzoites, as compared to parental strain, under tested conditions. 3.2. The over-expression of TgLDH1 or TgLDH2 enhances the parasite’s ability to differentiate The conversion between the rapidly dividing tachyzoites and the slowly growing bradyzoites is an important event in the para-
Fig. 3. Differentiation and growth analyses of Toxoplasma gondii under alkaline stress. (A) Immunofluorescence images show the differentiation and cyst structure. Nuclei were stained with Hoechst. The arrowhead indicates the nuclei of the HFF host cell, while the arrow those of the bradyzoites of the RML2-A strain. The recombinant MYCtagged TgLDH2 was revealed by anti-MYC antibody (see Section 2). The cyst structure was revealed using the FITC conjugated Dolichos biflorus staining. The bar represents 8 lm. (B) Quantitative analyses of cyst formation were conducted in the differentiated RML1-B, RML2-D, RML2-A, and RHDHX. The fraction (%) of vacuoles that formed cysts (y-axis) was calculated from at least 100 vacuoles and from three independent assays. (C) The growth of the parasites under alkaline conditions was analyzed. The fraction of the vacuoles (y-axis) was plotted against different number of parasites (x-axis).
160
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
site life cycle. The expression of TgLDH1 and TgLDH2 has been used as a marker for the presence of the rapidly dividing tachyzoites and the slowly growing bradyzoites, respectively (Weiss and Kim, 2000; Yang and Parmley, 1997). It was thus important to investigate whether the alteration of the TgLDH1 or TgLDH2 expression affected the ability of the parasite to convert between these growth stages. Following infection, the monolayers were cultured under alkaline conditions. The anti-MYC antibody (Fig. 3A, a-MYC-Rho) was used to evaluate the level of the recombinant proteins in the clonal parasites, and the FITC conjugated Dolichos-lectin, specifically interacting with the glycoprotein of the cyst wall, was used to monitor the cyst wall formation. We observed that the parental RHDHX strain could differentiate; 14% of vacuoles formed cyst structures under conditions tested. Since the type I strain was previously shown to exhibit a limited ability to differentiate and form cysts (Soete et al., 1993), it was necessary to ensure that the parental strain used in this study was not contaminated with any type II strains of T. gondii while being maintained in our laboratory. We thus genotyped this parasite strain using previously reported oligonucleotide primers specific to the SAG2 and GRA6 genes of the type I and type II strains of T. gondii (Khan et al., 2005). Only products specific to type I were detected, confirming that the parental RHDHX strain used here had no contamination (data not shown). To further confirm that the cyst structure was a direct consequence of the differentiation, we conducted Western blot analyses to validate the presence of bradyzoite-specific antigen 1 (BAG1) using the anti-BAG1 antibody (Bohne et al., 1995). BAG1 is a bradyzoite-specific antigen and used as a marker for differentiation. The protein corresponding to BAG1 (approximately 30 kDa) was detected only in the lysate prepared from the samples with cyst structures (data not shown). The cyst wall formation is thus indicative of the ability of RHDHX to differentiate at a detectable level under tested conditions. Notably, all clonal strains, including RML1-B, RML2-A, and RML2-D, showed an enhanced ability to differentiate and form cyst structures (Fig. 3A and B). From all transgenic parasite clones counted, over half of the vacuoles exhibited distinctive cyst structures. To ensure that the differentiation and cyst formation was not an artifact derived from the expression of a recombinant protein, we over-expressed an unrelated protein, MYC-tagged GFP, and monitored the differentiation. We observed that the GFP over-expression resulted in 14% of cyst formation similar to parental strain, suggesting that the differentiation was not enhanced by an unrelated protein. It thus confirmed that the increase in differentiation is directly correlated to TgLDH overexpression. To further determine whether over-expression of TgLDH was the direct cause of differentiation, we monitored the spontaneous formation of cysts under tachyzoite conditions. We did not detect any cyst structures in all clonal parasites or RHDHX, suggesting that TgLDH may play a role in maintaining cysts under alkaline conditions rather than causing differentiation to occur. It was further determined that the over-expression of LDH did not alter the parasite’s ability to convert back into tachyzoites after the alkaline stress was removed. It was observed that both parental and transgenic clones could successfully convert into tachyzoites after 48 h where RHDHX formed 7.2 ± 0.2% cysts from 18.3 ± 4.2% cysts, and transgenic clones formed 8.5 ± 0.3% cysts from 49.6 ± 3.8% cysts. Thus, although LDH over-expression may play a role in enhancing the differentiation process, it does not cause the parasites to remain in cyst structures after the stress is removed. To evaluate the parasite growth under alkaline conditions, we counted the number of parasites in each vacuole. The parental RHDHX strain retained a sufficient ability to multiply under alkaline conditions and formed 2, 4, 8, and 16 parasites per vacuole at 5 days post-infection. The distribution of these vacuoles was almost equal (20–30%). In the clonal RML1-B and RML2-D strains, the majority (50–60%) of the vacuoles contained two parasites
(Fig. 3C), suggesting that the alkaline conditions halted parasite multiplication at an early division stage. On the other hand, the RML2-A strain exhibited a unique growth pattern blending the characteristic of (i) the parental parasites in having even distribution of the number of vacuoles containing either 2, 4, and 8 parasites per vacuole, but not 16 parasites per vacuole and (ii) other clonal parasites in having 50–60% differentiated vacuoles. Overall, all clonal parasites expressing the recombinant TgLDH protein can easily differentiate and slowly multiply in comparison to the parental parasite under alkaline conditions. This finding suggests that the TgLDH protein, despite its enzymatic activity, enhanced the differentiation and delayed growth. This data is in agreement with the previous findings that the normal physiological level of TgLDH protein is necessary for the growth of the parasite. The decrease of TgLDH expression gave rise to a lower number of cysts and lower number of parasites per cyst (Al-Anouti et al., 2004); whereas the increase of TgLDH expression increased the differentiation and amount of detectable cyst structures. In conclusion, our study is the first to suggest an important physiological function of TgLDH, in addition to being a glycolytic enzyme. To further determine the domains responsible for the function, one would perform deletion studies in which the substrate, co-enzyme-binding domains or truncated proteins can be assayed for their effects on the differentiation efficiency. Acknowledgments This work was supported by the Natural Sciences and Engineering Research Council of Canada (S.A., Grant No. 222969) and Canadian Foundation for AIDS Research (S.A., Grant No. 18026). The 9E10 and 12G10 monoclonal antibodies developed by J. Michael Bishop, Joseph Frankel, and E. Marlo Nelsen, respectively, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. We also thank Michael Holmes for proof-reading, Drs. Louis Weiss (Albert Einstein College of Medicine), Stephen Parmley (Palo Alto Medical Foundation), Dominique Soldati (University of Geneva), and David Roos (University of Pennsylvania) for the reagents used in the study. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.exppara.2009.01.016. References Al-Anouti, F., Tomavo, S., Parmley, S., Ananvoranich, S., 2004. The expression of lactate dehydrogenase is important for the cell cycle of Toxoplasma gondii. Journal of Biological Chemistry 279, 52300–52311. Bohne, W., Gross, U., Ferguson, D.J., Heesemann, J., 1995. Cloning and characterization of a bradyzoite-specifically expressed gene (hsp30/bag1) of Toxoplasma gondii, related to genes encoding small heat-shock proteins of plants. Molecular Microbiology 16, 1221–1230. Boothroyd, J.C., Black, M., Bonnefoy, S., Hehl, A., Knoll, L.J., Manger, I.D., OrtegaBarria, E., Tomavo, S., 1997. Genetic and biochemical analysis of development in Toxoplasma gondii. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 352, 1347–1354. Dando, C., Schroeder, E.R., Hunsaker, L.A., Deck, L.M., Royer, R.E., Zhou, X., Parmley, S.F., Vander Jagt, D.L., 2001. The kinetic properties and sensitivities to inhibitors of lactate dehydrogenases (LDH1 and LDH2) from Toxoplasma gondii: comparisons with pLDH from Plasmodium falciparum. Molecular and Biochemical Parasitology 118, 23–32. Denton, H., Roberts, C.W., Alexander, J., Thong, K.W., Coombs, G.H., 1996. Enzymes of energy metabolism in the bradyzoites and tachyzoites of Toxoplasma gondii. FEMS Microbiology Letters 137, 103–108. Donald, R.G., Carter, D., Ullman, B., Roos, D.S., 1996. Insertional tagging, cloning, and expression of the Toxoplasma gondii hypoxanthine–xanthine–guanine phosphoribosyltransferase gene. Use as a selectable marker for stable transformation. Journal of Biological Chemistry 271, 14010–14019.
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161 Ferguson, D.J., Parmley, S.F., Tomavo, S., 2002. Evidence for nuclear localisation of two stage-specific isoenzymes of enolase in Toxoplasma gondii correlates with active parasite replication. International Journal for Parasitology 32, 1399– 1410. Fleige, T., Fischer, K., Ferguson, D.J., Gross, U., Bohne, W., 2007. Carbohydrate metabolism in the Toxoplasma gondii apicoplast: localization of three glycolytic isoenzymes, the single pyruvate dehydrogenase complex, and a plastid phosphate translocator. Eukaryotic Cell 6, 984–996. Kavanagh, K.L., Elling, R.A., Wilson, D.K., 2004. Structure of Toxoplasma gondii LDH1: active-site differences from human lactate dehydrogenases and the structural basis for efficient APAD+ use. Biochemistry 43, 879–889. Khan, A., Taylor, S., Su, C., Mackey, A.J., Boyle, J., Cole, R., Glover, D., Tang, K., Paulsen, I.T., Berriman, M., Boothroyd, J.C., Pfefferkorn, E.R., Dubey, J.P., Ajioka, J.W., Roos, D.S., Wootton, J.C., Sibley, L.D., 2005. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acids Research 33, 2980–2992. Kiefhaber, T., Rudolph, R., Kohler, H.H., Buchner, J., 1991. Protein aggregation in vitro and in vivo: a quantitative model of the kinetic competition between folding and aggregation. Biotechnology 9, 825–829. Lindsay, D.S., Dubey, J.P., Blagburn, B.L., Toivio-Kinnucan, M., 1991. Examination of tissue cyst formation by Toxoplasma gondii in cell cultures using bradyzoites, tachyzoites, and sporozoites. Journal of Parasitology 77, 126– 132. Mukhopadhyay, A., 1997. Inclusion bodies and purification of proteins in biologically active forms. Advances in Biochemical Engineering/Biotechnology 56, 61–109.
161
Reiter-Owona, I., Seitz, H., Gross, U., Sahm, M., Rockstroh, J.K., Seitz, H.M., 2000. Is stage conversion the initiating event for reactivation of Toxoplasma gondii in brain tissue of AIDS patients? Journal of Parasitology 86, 531–536. Roos, D.S., Donald, R.G., Morrissette, N.S., Moulton, A.L., 1994. Molecular tools for genetic dissection of the protozoan parasite Toxoplasma gondii. Methods in Cell Biology 45, 27–63. Soete, M., Fortier, B., Camus, D., Dubremetz, J.F., 1993. Toxoplasma gondii: kinetics of bradyzoite–tachyzoite interconversion in vitro. Experimental Parasitology 76, 259–264. Striepen, B., He, C.Y., Matrajt, M., Soldati, D., Roos, D.S., 1998. Expression, selection, and organellar targeting of the green fluorescent protein in Toxoplasma gondii. Molecular and Biochemical Parasitology 92, 325–338. Tomavo, S., 2001. The differential expression of multiple isoenzyme forms during stage conversion of Toxoplasma gondii: an adaptive developmental strategy. International Journal for Parasitology 31, 1023–1031. Van, T.T., Kim, S.K., Camps, M., Boothroyd, J.C., Knoll, L.J., 2007. The BSR4 protein is up-regulated in Toxoplasma gondii bradyzoites, however the dominant surface antigen recognised by the P36 monoclonal antibody is SRS9. International Journal for Parasitology 37, 877–885. Weiss, L.M., Kim, K., 2000. The development and biology of bradyzoites of Toxoplasma gondii. Frontiers in Bioscience 5, D391–D405. Yang, S., Parmley, S.F., 1995. A bradyzoite stage-specifically expressed gene of Toxoplasma gondii encodes a polypeptide homologous to lactate dehydrogenase. Molecular and Biochemical Parasitology 73, 291–294. Yang, S., Parmley, S.F., 1997. Toxoplasma gondii expresses two distinct lactate dehydrogenase homologous genes during its life cycle in intermediate hosts. Gene 184, 1–12.
Contents lists available at ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Toxoplasma gondii: Over-expression of lactate dehydrogenase enhances differentiation under alkaline conditions Urszula Liwak, Sirinart Ananvoranich * Department of Chemistry and Biochemistry, University of Windsor, 401 Sunset Avenue, Windsor, Ont., Canada N9B 3P4
a r t i c l e
i n f o
Article history: Received 14 November 2008 Received in revised form 22 January 2009 Accepted 23 January 2009 Available online 6 February 2009 Keywords: Toxoplasma gondii Lactate dehydrogenase Differentiation Enzymatic activity
a b s t r a c t Toxoplasma gondii, an intracellular parasite, has two distinctive growth stages, namely rapidly growing tachyzoites and slowly growing bradyzoites. Here we report a unique physiological function of the last committed glycolytic enzyme of T. gondii, lactate dehydrogenase (TgLDH), which is present in two isoforms and expressed in a stage-specific manner. TgLDH1 is present in tachyzoites while TgLDH2 is found in bradyzoites. Using clonal transgenic parasites over-expressing either TgLDH1 or TgLDH2, we showed that the enzymatic activity, growth, and virulence of tachyzoites were unaffected by the presence of the recombinant protein. Interestingly, under alkaline conditions the presence of the recombinant TgLDH proteins increased the differentiation, as detected by the formation of cyst structures in vitro, while green fluorescent protein did not. The differentiation enhancement of the recombinant TgLDH1 and TgLDH2 strongly suggests that TgLDH1 and TgLDH2 have an important physiological function, in addition to being glycolytic enzymes and differentiation markers. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction Toxoplasma gondii is an intracellular protozoan parasite of the Apicomplexa phylum that infects a variety of mammals and birds, including approximately one-third of the human population. Acute infection of T. gondii is often asymptomatic and the parasites may exist as rapidly dividing tachyzoites. In response to the host immunity, the tachyzoites differentiate into the slow-replicating bradyzoites. Having distinct physiological features, the bradyzoites encyst and remain in the infected host tissues throughout the life of the host (Ferguson et al., 2002; Lindsay et al., 1991). The bradyzoite-to-tachyzoite stage conversion was suggested to be the cause of recurrent infection (Reiter-Owona et al., 2000). In vitro when the infected monolayers are subjected to stress conditions, such as alkaline media (Boothroyd et al., 1997; Soete et al., 1993), the tachyzoite-to-bradyzoite stage conversion can be observed mimicking the parasite’s response to the host immunity. Hence, such conditions allow the study of differentiation and facilitate the search for possible drug targets and the development of preventive strategies and therapeutic agents for toxoplasmosis (Dando et al., 2001; Kavanagh et al., 2004). Although tachyzoites and bradyzoites have equally functional glycolytic pathways (Denton et al., 1996), a unique set of glycolytic enzymes are responsible for the energy production of each differentiation stage (Fleige et al., 2007; Tomavo, 2001). With the excep* Corresponding author. Fax: +1 519 973 7098. E-mail address: [email protected] (S. Ananvoranich). 0014-4894/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2009.01.016
tion of hexokinase and glucose-6-phosphate isomerase, each glycolytic enzyme is coded by at least two independent genes whose mRNAs are differentially regulated (Fleige et al., 2007). We are particularly interested in two isoforms of Toxoplasma lactate dehydrogenase (TgLDH1 and TgLDH2, EC 1.1.1.27), the last committed enzyme of the glycolytic pathway. The expression of genes encoding TgLDH1 and TgLDH2 are differentially regulated and commonly used as markers of the differentiation stage: TgLDH1 is the marker of the tachyzoite stage, while TgLDH2 is that of the bradyzoite stage (Yang and Parmley, 1997). Both TgLDH1 and TgLDH2 catalyze the inter-conversion of pyruvate to lactate. Structural and biochemical analyses showed that the active sites of TgLDH1 and TgLDH2 carry a pentapeptide insertion and have a preference for the co-enzyme APAD as well as NAD (Kavanagh et al., 2004). Having structural differences from human LDH isoenzymes, TgLDH1 and TgLDH2 are considered ideal targets for the development of anti-parasitic agents with a board spectrum to combat both acute and recurrent toxoplasmosis (Dando et al., 2001; Kavanagh et al., 2004). Binding to this pentapeptide insertion, small molecules/ligands would interfere with the activity of TgLDH1 and TgLDH2. More importantly, the inhibition of TgLDH2 might confer a highly potent anti-parasitic effect because the encysted and slow-replicating bradyzoites lack a functional TCA cycle and respiratory chain (Denton et al., 1996), and would consequently depend greatly on the activity of TgLDH2 for energy production under anaerobic respiration. Moreover, the previous study on TgLDH1 and TgLDH2 showed that the physiological level of TgLDH1 and TgLDH2 expression is required for the parasites to
156
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
maintain their normal growth and to allow for differentiation (AlAnouti et al., 2004). This evidence thus indicates that the activity of TgLDH1 and TgLDH2 together with the temporal regulation of TgLDH1 and TgLDH2 expression could be used as potential drug targets. This study further investigated whether the TgLDH protein, with or without its enzymatic activity, would enhance the differentiation and delay growth. The hypothesis was validated by addressing whether the increase of TgLDH expression would give rise to a higher number of cysts and parasites per cyst. Transgenic parasites that over-express either TgLDH1 or TgLDH2 were created. Although the over-expression of TgLDH1 or TgLDH2 did not change the overall TgLDH enzymatic activity, increase the growth of tachyzoites, or yield a more virulent parasite strain, a significant in vitro differentiation to bradyzoites was detected after increased TgLDH1 or TgLDH2 expression. 2. Materials and methods 2.1. Plasmid designs and constructs The coding sequences of TgLDH1 and TgLDH2 (GenBank Accession Nos. U35118 and U23207) were amplified from pMAL_LDH1 and pMAL_LDH2 (plasmids obtained from Dr. S. Parmley, Palo Alto Medical Foundation) using specific primers, 50 LDHxNsiI: GATTTC AGAATTCGG ATCC and 30 LDHxPacI: CCCTTAATTAAGTGCCAAGC TTAAGATC and used to generate the PCR products with NsiI cutting site on their 50 -terminus and PacI cutting site on their 30 -terminus. The PCR products were subsequently cloned into the Toxoplasmaexpression plasmid, pTUB8Myc_His_X-HX (gift from Dr. D. Soldati, University of Geneva) so that the expression of TgLDH1 or TgLDH2 was under the control of a modified tubulin (TUB) promoter and the recombinant protein was led by MYC- and His-epitope tags on their N-terminus to give predicted molecular weights of 39.2 and 39.9 kDa, respectively. The constructs were confirmed by nucleotide sequencing reactions. 2.2. Parasite and host cultures Human foreskin fibroblasts (HFF) and a laboratory strain, RHDHX, which is a type I strain of T. gondii were obtained from Dr. D. Roos, University of Pennsylvania. HFF were grown in DMEM (Invitrogen) supplemented with 10% cosmic calf serum (Hyclone), and antibiotic–antimycotic (Invitrogen) and used for T. gondii infection. The infected HFF monolayers were maintained using MEM (Invitrogen) supplemented with 1% dialyzed calf serum (Hyclone) and antibiotic–antimycotic. The parasite, RHDHX, was chosen because of its rapid growth and well characterization allowing for the generation of transgenic parasites using hypoxanthine–xanthine–guanine phosphoribosyltransferase (HXGPRT) as a selectable marker (Donald et al., 1996). Using a previously described method (Roos et al., 1994), transgenic parasites were generated by electroporation of RHDHX with plasmids containing HXGPRT and selected and maintained in the culture media containing 25 lg/ml mycophenolic acid and 50 lg/ml xanthine. Freshly released parasites were subcultured every few days until further needed. To monitor the tachyzoite growth, the parasites were infected onto HFF monolayers grown on coverslips and kept under 37 °C and 5% CO2 for 24 and 48 h which is defined as the tachyzoite growth conditions (AlAnouti et al., 2004). Tachyzoite-to-bradyzoite stage conversion was induced by keeping the infected monolayers under atmospheric CO2 and in RMPI-1640 (Sigma–Aldrich) supplemented with 50 mM Hepes, pH 8.2, 5% dialyzed serum, and antibiotic–antimycotic for 5 days (Soete et al., 1993; Tomavo, 2001) to ensure and maintain the differentiation. After 5 days, the alkaline stress was removed and parasites were grown under tachyzoite conditions for 48 h to
measure whether the encysted parasites retained their ability to convert back to tachyzoites. 2.3. Growth assays The growth assays were performed as previously described (AlAnouti et al., 2004) Infected monolayers grown on coverslips were fixed with 3% paraformaldehyde, and their nuclei were stained using 100 lM Hoechst (Sigma–Aldrich) to enable to the visualization of intracellular parasites and host cells, respectively. We conducted a growth assay using clonal parasites from early and late passages, where the former were from less than three passages and the latter from six passages, to ensure that the results were consistent. Following infection under tachyzoite conditions, the number of parasites in the vacuoles was monitored from the early (Fig. 2B) and late passages (Supplementary data, S1). FITC conjugated Dolichos biflorus agglutinin (Sigma–Aldrich, 1:300 dilution), which specifically interacts with the glycoprotein of the cyst wall, was used for the visualization of the locations of cyst structures. We counted, in triplicate, the parasites from an average of 100 vacuoles or cysts per coverslip to determine the number of parasites per vacuole or cyst. 2.4. Immunofluorescence assays and Western blot analyses For other immunofluorescence assays, the paraformaldehyde fixed monolayers were permeabilized with 0.25% Triton X-100 in PBS, and non-specific sites were blocked using 5% bovine serum albumin (BSA, Sigma–Aldrich). The protein of interest (antigen) was revealed after subsequent incubations and washes with PBS with; (i) the primary antibodies, the mouse anti-MYC (9E10, 1:500), the rabbit anti-TgLDH1 or anti-TgLDH2 antibodies (obtained from Dr. S. Parmley, 1:1000) and (ii) the secondary antibodies, rhodamine conjugated goat anti-mouse (Rockland Immunochemicals, 1:800) or rhodamine conjugated goat anti-rabbit (Rockland Immunochemicals, 1:800) were used. To reveal the cyst wall structure and nuclei, FITC conjugated D. biflorus agglutinin (Sigma–Aldrich, 1:300) and 100 lM Hoechst were used. All images were taken with a Q-imaging CCD camera on a Leica DMIRB microscope using the Northern Eclipse software (Al-Anouti et al., 2004). Western blot analyses were performed using the lysates prepared from freshly lysed parasites, including parental RHDHX and transgenic parasites over-expressing either LDH1 or LDH2, in PBS containing 10 lM PMSF (Al-Anouti et al., 2004). The samples were resolved on a 12% SDS–PAGE and transferred to a nitrocellulose membrane (Pall Corporation). Following the incubation in primary antibody specific to TgLDH1 (1:2000), TgLDH2 (1:2000), MYC (9E10, 1:1000), or TUB (12G10, 1:1000), the blots were incubated in the appropriate secondary antibodies; either horseradish peroxidase conjugated goat anti-rabbit (1:20,000) for TgLDH1 and TgLDH2, or horseradish peroxidase conjugated goat anti-mouse (1:10,000) for MYC and TUB. Chemiluminescent detection was performed using the chemiluminescent HRP substrate kit (Millipore). Densitometric measurements were determined using the ImageJ program developed at the National Institutes of Health. To further confirm that the cyst structure was a direct consequence of the differentiation, Western blot analysis was performed using the antiBAG1 antibody (Bohne et al., 1995) to validate the presence of bradyzoite-specific antigen 1 (BAG1). BAG1 is a bradyzoite-specific antigen and used as a marker for differentiation. 2.5. Lactate dehydrogenase enzyme activity Enzymatic assays were performed as previously described (AlAnouti et al., 2004; Dando et al., 2001; Kavanagh et al., 2004).
157
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
Briefly, freshly released tachyzoites were harvested and lysed in 100 mM Tris, pH 7.4 and 0.5 mM phenylmethylsulfonylfluoride protease inhibitor. Protein concentrations were determined using the Bio-Rad protein assays. Reactions were carried out at 25 °C in a reaction buffer containing 100 mM Tris, pH 7.4, 0.1 mg/ml NADH (Sigma–Aldrich), and 5 lg of cell-free lysates. Reactions were initiated by the addition of 1.6 mM pyruvate (Sigma–Aldrich) and monitored at 340 nm for the change in absorbance of NADH ( = 6220 M1 cm1). The assays were performed in triplicate, and average values were presented with their standard deviations.
3. Results and discussion 3.1. Transgenic parasites over-expressing recombinant TgLDHs To investigate the effect of the over-expression of TgLDH1 and TgLDH2 on the parasite multiplication, we transformed a type I strain of T. gondii, RHDHX, with constructed transforming plasmids. Several clonal parasites, which over-expressed either the TgLDH1 protein or the TgLDH2 protein, were selected for the study and named RML1-A and RML1-B and RML2-A to RML2-D, respectively, where R indicates the RHDHX parental strain, M indicates the Myc tag, and L1 and L2 indicates over-expressed LDH1 and LDH2, respectively. The levels of recombinant TgLDH1 and TgLDH2 expression in the tachyzoite stage were monitored by Western blot analysis (Fig. 1A). The tachyzoites of the parental parasite (RHDHX) strain expressed detectable levels of TgLDH1, but not TgLDH2. This result is in agreement with previous observations documented by Yang and Parmley (1995, 1997). The endogenous TgLDH1 (approximately 35 kDa) was detected in all samples prepared from the selected clones and RHDHX strain. The recombinant TgLDH1 protein was detected by the anti-MYC and anti-TgLDH1 antibodies only in the clonal parasite RML1-A and RML1-B strains. These recombinant TgLDH1 bands were resolved as approximately 39 kDa, whose larger size corresponds to the MYC-tag and additive peptide. Four clonal RML2 (A–D) strains expressed relatively high levels of the TgLDH2 protein (approximately 40 kDa, Fig. 1A) as detected by the anti-TgLDH2 and anti-MYC antibodies. To normalize the expression of the recombinant proteins of the transgenic clonal parasites, the expression levels of recombinant proteins were quantified against those of tubulin (Fig. 1B). Between the clonal TgLDH1 strains, RML1-A exhibited a higher level of recombinant TgLDH1 than RML1-B. Among the clonal TgLDH2 strains, RML2-C exhibited the lowest amount of recombinant TgLDH2 and RML2A and RML2-D had the highest levels. It was noted that there was no direct relationship between the level of recombinant protein expression and the endogenous level of TgLDH1 expression. The varied levels of recombinant TgLDH1 and TgLDH2 expression in the clonal strains might be the result of the integration frequency and location where the random gene integration took place, which is quite common in T. gondii (Donald et al., 1996; Striepen et al., 1998). To determine if the varied levels of over-expression altered the overall activity of TgLDH, enzymatic assays were performed (Table 1). The TgLDH activity of the parental tachyzoites, RHDHX, was 1473 ± 4 nmol min1 mg1. The over-expression of TgLDH1 in the RML1-A and RML1-B strains displayed similar activity as parental, 1428 ± 107 and 1933 ± 241 nmol min1 mg1, respectively. The RML2-A, RML2-B, RML2-C, and RML2-D strains with over-expressed TgLDH2, with activities of 1260 ± 287, 1072 ± 210, 1009 ± 185, and 1167 ± 132 nmol min1 mg1, also resembled the activity of parental. Due to the distinctive over-expression, we expected a change in the overall TgLDH enzymatic activity. We detected neither an increase nor decrease in TgLDH activity. It has
Fig. 1. Expression of the recombinant proteins in the selected clones. (A) Western blot analyses of recombinant Toxoplasma gondii lactate dehydrogenase (TgLDH1 and TgLDH2) expression. Anti-MYC, -TgLDH1, -TgLDH2, and -TUB antibodies were used in the revealing of the corresponding proteins as indicated on the left. Estimated sizes of the detected bands are indicated on the right. The light bands found in the a-LDH2 panel were the residual signals resulting from successive a-Myc and aLDH2 antibody incubations. The blot was first revealed using a-Myc antibody and then stripped, prior to a-LDH2 incubation. (B) Comparative levels of the recombinant TgLDH protein among the clonal strains was obtained following densitometric measurements of the band intensities and normalized against those of TUB.
Table 1 The enzymatic activity of Toxoplasma gondii lactate dehydrogenase. The enzymatic activity of LDH was calculated for all the transgenic parasites and compared to parental in nmol min1 mg1. Strains
Activities (nmol min1 mg1)
RHDHX RML1-A RML1-B RML2-A RML2-B RML2-C RML2-D
1473 ± 4 1428 ± 107 1933 ± 241 1260 ± 287 1072 ± 210 1009 ± 185 1167 ± 132
been suggested that the active TgLDH enzyme is formed upon the assembly of a homotetrameric complex (Dando et al., 2001). If the recombinant proteins were non-functional, due to mis-folding or mutation, the proteins would have interfered with the assembly of wild-type LDH complexes and would have decreased the overall TgLDH activity. It is also likely that the mis-folded proteins would have been degraded and given rise to truncated and unstable forms of the recombinant proteins. If this was the case, we would have detected multiple bands with varying molecular weights. However, the Western blot analyses showed single bands (Fig. 1A) when either the anti-MYC or anti-TgLDH antibody was used. On the other hand, if the recombinant proteins were functional and able to form ternary complexes, we should have de-
158
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
tected an increase in the overall enzymatic activity. Another possible explanation is that the recombinant proteins were sequestered upon over-expression, similar to the formation of inclusion bodies in bacteria (Kiefhaber et al., 1991; Mukhopadhyay, 1997). The recombinant proteins would have been protected from degradation and the formation of active ternary complexes, while remaining in the cytosol.
Prior to a phenotypical analysis, to ensure that the recombinant TgLDH1 and TgLDH2 proteins were expressed uniformly in each clone, we performed immunofluorescence assays. We detected the recombinant TgLDH1 and TgLDH2 proteins localized in the cytosol which is in agreement with previous studies shown by Ferguson et al. (2002). The level of recombinant protein expression in the RML1-B strain, which was uniformly expressed and similar to all the other clones, was detected by the anti-MYC primary anti-
Fig. 2. Tachyzoites’ growth analyses. (A) Immunofluorescence detection of MYC-tagged Toxoplasma gondii lactate dehydrogenase 1 (TgLDH1) in the tachyzoites of RML1-B. Nuclei of the HFF host and the tachyzoites were stained with Hoechst, as indicated by an arrowhead and an arrow, respectively. The recombinant TgLDH1 was localized in the cytosol. The bar represents 15 lm. (B) Comparative growth analysis of an early passage was displayed as the fraction (%) of vacuoles (y-axis) containing various numbers of the tachyzoites (x-axis) counted from the parental and clonal parasites at 24 or 48 h post-infection.
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
body and the rhodamine conjugated anti-mouse secondary antibody (Fig. 2A, a-MYC-Rho). Since there was no apparent correlation between the levels of over-expression, localization and the overall TgLDH activity, for convenience, clonal RML1-B, RML2-A, and RML2-D strains were selected for further analysis. Subsequently we determined if overexpression of TgLDH had an effect on the growth of tachyzoites. It has previously been reported that serial passages of transgenic T. gondii cultures may cause a reduction in the expression of recombinant proteins (Van et al., 2007); therefore, we conducted a growth assay using clonal parasites from early and late passages, where the former were from less than three passages and the latter from six passages, to ensure that the results were consistent. Following infection under tachyzoite conditions, the numbers of parasites in the vacuoles were monitored from the early (Fig. 2B) and
159
late passages (Supplementary data, S1). At 24 h post-infection, 50% of vacuoles formed by all strains, including RML1-B, RML2-A, RML2-D, and RHDHX, contained 8 parasites. The early and late passages exhibited the same trend. At 48 h post-infection, all strains showed a similar growth pattern of having about 50% of vacuoles with more than 32 parasites. These results suggest that the overexpression of recombinant TgLDH1 or TgLDH2 proteins had no effect on the growth of tachyzoites, as compared to parental strain, under tested conditions. 3.2. The over-expression of TgLDH1 or TgLDH2 enhances the parasite’s ability to differentiate The conversion between the rapidly dividing tachyzoites and the slowly growing bradyzoites is an important event in the para-
Fig. 3. Differentiation and growth analyses of Toxoplasma gondii under alkaline stress. (A) Immunofluorescence images show the differentiation and cyst structure. Nuclei were stained with Hoechst. The arrowhead indicates the nuclei of the HFF host cell, while the arrow those of the bradyzoites of the RML2-A strain. The recombinant MYCtagged TgLDH2 was revealed by anti-MYC antibody (see Section 2). The cyst structure was revealed using the FITC conjugated Dolichos biflorus staining. The bar represents 8 lm. (B) Quantitative analyses of cyst formation were conducted in the differentiated RML1-B, RML2-D, RML2-A, and RHDHX. The fraction (%) of vacuoles that formed cysts (y-axis) was calculated from at least 100 vacuoles and from three independent assays. (C) The growth of the parasites under alkaline conditions was analyzed. The fraction of the vacuoles (y-axis) was plotted against different number of parasites (x-axis).
160
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161
site life cycle. The expression of TgLDH1 and TgLDH2 has been used as a marker for the presence of the rapidly dividing tachyzoites and the slowly growing bradyzoites, respectively (Weiss and Kim, 2000; Yang and Parmley, 1997). It was thus important to investigate whether the alteration of the TgLDH1 or TgLDH2 expression affected the ability of the parasite to convert between these growth stages. Following infection, the monolayers were cultured under alkaline conditions. The anti-MYC antibody (Fig. 3A, a-MYC-Rho) was used to evaluate the level of the recombinant proteins in the clonal parasites, and the FITC conjugated Dolichos-lectin, specifically interacting with the glycoprotein of the cyst wall, was used to monitor the cyst wall formation. We observed that the parental RHDHX strain could differentiate; 14% of vacuoles formed cyst structures under conditions tested. Since the type I strain was previously shown to exhibit a limited ability to differentiate and form cysts (Soete et al., 1993), it was necessary to ensure that the parental strain used in this study was not contaminated with any type II strains of T. gondii while being maintained in our laboratory. We thus genotyped this parasite strain using previously reported oligonucleotide primers specific to the SAG2 and GRA6 genes of the type I and type II strains of T. gondii (Khan et al., 2005). Only products specific to type I were detected, confirming that the parental RHDHX strain used here had no contamination (data not shown). To further confirm that the cyst structure was a direct consequence of the differentiation, we conducted Western blot analyses to validate the presence of bradyzoite-specific antigen 1 (BAG1) using the anti-BAG1 antibody (Bohne et al., 1995). BAG1 is a bradyzoite-specific antigen and used as a marker for differentiation. The protein corresponding to BAG1 (approximately 30 kDa) was detected only in the lysate prepared from the samples with cyst structures (data not shown). The cyst wall formation is thus indicative of the ability of RHDHX to differentiate at a detectable level under tested conditions. Notably, all clonal strains, including RML1-B, RML2-A, and RML2-D, showed an enhanced ability to differentiate and form cyst structures (Fig. 3A and B). From all transgenic parasite clones counted, over half of the vacuoles exhibited distinctive cyst structures. To ensure that the differentiation and cyst formation was not an artifact derived from the expression of a recombinant protein, we over-expressed an unrelated protein, MYC-tagged GFP, and monitored the differentiation. We observed that the GFP over-expression resulted in 14% of cyst formation similar to parental strain, suggesting that the differentiation was not enhanced by an unrelated protein. It thus confirmed that the increase in differentiation is directly correlated to TgLDH overexpression. To further determine whether over-expression of TgLDH was the direct cause of differentiation, we monitored the spontaneous formation of cysts under tachyzoite conditions. We did not detect any cyst structures in all clonal parasites or RHDHX, suggesting that TgLDH may play a role in maintaining cysts under alkaline conditions rather than causing differentiation to occur. It was further determined that the over-expression of LDH did not alter the parasite’s ability to convert back into tachyzoites after the alkaline stress was removed. It was observed that both parental and transgenic clones could successfully convert into tachyzoites after 48 h where RHDHX formed 7.2 ± 0.2% cysts from 18.3 ± 4.2% cysts, and transgenic clones formed 8.5 ± 0.3% cysts from 49.6 ± 3.8% cysts. Thus, although LDH over-expression may play a role in enhancing the differentiation process, it does not cause the parasites to remain in cyst structures after the stress is removed. To evaluate the parasite growth under alkaline conditions, we counted the number of parasites in each vacuole. The parental RHDHX strain retained a sufficient ability to multiply under alkaline conditions and formed 2, 4, 8, and 16 parasites per vacuole at 5 days post-infection. The distribution of these vacuoles was almost equal (20–30%). In the clonal RML1-B and RML2-D strains, the majority (50–60%) of the vacuoles contained two parasites
(Fig. 3C), suggesting that the alkaline conditions halted parasite multiplication at an early division stage. On the other hand, the RML2-A strain exhibited a unique growth pattern blending the characteristic of (i) the parental parasites in having even distribution of the number of vacuoles containing either 2, 4, and 8 parasites per vacuole, but not 16 parasites per vacuole and (ii) other clonal parasites in having 50–60% differentiated vacuoles. Overall, all clonal parasites expressing the recombinant TgLDH protein can easily differentiate and slowly multiply in comparison to the parental parasite under alkaline conditions. This finding suggests that the TgLDH protein, despite its enzymatic activity, enhanced the differentiation and delayed growth. This data is in agreement with the previous findings that the normal physiological level of TgLDH protein is necessary for the growth of the parasite. The decrease of TgLDH expression gave rise to a lower number of cysts and lower number of parasites per cyst (Al-Anouti et al., 2004); whereas the increase of TgLDH expression increased the differentiation and amount of detectable cyst structures. In conclusion, our study is the first to suggest an important physiological function of TgLDH, in addition to being a glycolytic enzyme. To further determine the domains responsible for the function, one would perform deletion studies in which the substrate, co-enzyme-binding domains or truncated proteins can be assayed for their effects on the differentiation efficiency. Acknowledgments This work was supported by the Natural Sciences and Engineering Research Council of Canada (S.A., Grant No. 222969) and Canadian Foundation for AIDS Research (S.A., Grant No. 18026). The 9E10 and 12G10 monoclonal antibodies developed by J. Michael Bishop, Joseph Frankel, and E. Marlo Nelsen, respectively, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. We also thank Michael Holmes for proof-reading, Drs. Louis Weiss (Albert Einstein College of Medicine), Stephen Parmley (Palo Alto Medical Foundation), Dominique Soldati (University of Geneva), and David Roos (University of Pennsylvania) for the reagents used in the study. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.exppara.2009.01.016. References Al-Anouti, F., Tomavo, S., Parmley, S., Ananvoranich, S., 2004. The expression of lactate dehydrogenase is important for the cell cycle of Toxoplasma gondii. Journal of Biological Chemistry 279, 52300–52311. Bohne, W., Gross, U., Ferguson, D.J., Heesemann, J., 1995. Cloning and characterization of a bradyzoite-specifically expressed gene (hsp30/bag1) of Toxoplasma gondii, related to genes encoding small heat-shock proteins of plants. Molecular Microbiology 16, 1221–1230. Boothroyd, J.C., Black, M., Bonnefoy, S., Hehl, A., Knoll, L.J., Manger, I.D., OrtegaBarria, E., Tomavo, S., 1997. Genetic and biochemical analysis of development in Toxoplasma gondii. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 352, 1347–1354. Dando, C., Schroeder, E.R., Hunsaker, L.A., Deck, L.M., Royer, R.E., Zhou, X., Parmley, S.F., Vander Jagt, D.L., 2001. The kinetic properties and sensitivities to inhibitors of lactate dehydrogenases (LDH1 and LDH2) from Toxoplasma gondii: comparisons with pLDH from Plasmodium falciparum. Molecular and Biochemical Parasitology 118, 23–32. Denton, H., Roberts, C.W., Alexander, J., Thong, K.W., Coombs, G.H., 1996. Enzymes of energy metabolism in the bradyzoites and tachyzoites of Toxoplasma gondii. FEMS Microbiology Letters 137, 103–108. Donald, R.G., Carter, D., Ullman, B., Roos, D.S., 1996. Insertional tagging, cloning, and expression of the Toxoplasma gondii hypoxanthine–xanthine–guanine phosphoribosyltransferase gene. Use as a selectable marker for stable transformation. Journal of Biological Chemistry 271, 14010–14019.
U. Liwak, S. Ananvoranich / Experimental Parasitology 122 (2009) 155–161 Ferguson, D.J., Parmley, S.F., Tomavo, S., 2002. Evidence for nuclear localisation of two stage-specific isoenzymes of enolase in Toxoplasma gondii correlates with active parasite replication. International Journal for Parasitology 32, 1399– 1410. Fleige, T., Fischer, K., Ferguson, D.J., Gross, U., Bohne, W., 2007. Carbohydrate metabolism in the Toxoplasma gondii apicoplast: localization of three glycolytic isoenzymes, the single pyruvate dehydrogenase complex, and a plastid phosphate translocator. Eukaryotic Cell 6, 984–996. Kavanagh, K.L., Elling, R.A., Wilson, D.K., 2004. Structure of Toxoplasma gondii LDH1: active-site differences from human lactate dehydrogenases and the structural basis for efficient APAD+ use. Biochemistry 43, 879–889. Khan, A., Taylor, S., Su, C., Mackey, A.J., Boyle, J., Cole, R., Glover, D., Tang, K., Paulsen, I.T., Berriman, M., Boothroyd, J.C., Pfefferkorn, E.R., Dubey, J.P., Ajioka, J.W., Roos, D.S., Wootton, J.C., Sibley, L.D., 2005. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acids Research 33, 2980–2992. Kiefhaber, T., Rudolph, R., Kohler, H.H., Buchner, J., 1991. Protein aggregation in vitro and in vivo: a quantitative model of the kinetic competition between folding and aggregation. Biotechnology 9, 825–829. Lindsay, D.S., Dubey, J.P., Blagburn, B.L., Toivio-Kinnucan, M., 1991. Examination of tissue cyst formation by Toxoplasma gondii in cell cultures using bradyzoites, tachyzoites, and sporozoites. Journal of Parasitology 77, 126– 132. Mukhopadhyay, A., 1997. Inclusion bodies and purification of proteins in biologically active forms. Advances in Biochemical Engineering/Biotechnology 56, 61–109.
161
Reiter-Owona, I., Seitz, H., Gross, U., Sahm, M., Rockstroh, J.K., Seitz, H.M., 2000. Is stage conversion the initiating event for reactivation of Toxoplasma gondii in brain tissue of AIDS patients? Journal of Parasitology 86, 531–536. Roos, D.S., Donald, R.G., Morrissette, N.S., Moulton, A.L., 1994. Molecular tools for genetic dissection of the protozoan parasite Toxoplasma gondii. Methods in Cell Biology 45, 27–63. Soete, M., Fortier, B., Camus, D., Dubremetz, J.F., 1993. Toxoplasma gondii: kinetics of bradyzoite–tachyzoite interconversion in vitro. Experimental Parasitology 76, 259–264. Striepen, B., He, C.Y., Matrajt, M., Soldati, D., Roos, D.S., 1998. Expression, selection, and organellar targeting of the green fluorescent protein in Toxoplasma gondii. Molecular and Biochemical Parasitology 92, 325–338. Tomavo, S., 2001. The differential expression of multiple isoenzyme forms during stage conversion of Toxoplasma gondii: an adaptive developmental strategy. International Journal for Parasitology 31, 1023–1031. Van, T.T., Kim, S.K., Camps, M., Boothroyd, J.C., Knoll, L.J., 2007. The BSR4 protein is up-regulated in Toxoplasma gondii bradyzoites, however the dominant surface antigen recognised by the P36 monoclonal antibody is SRS9. International Journal for Parasitology 37, 877–885. Weiss, L.M., Kim, K., 2000. The development and biology of bradyzoites of Toxoplasma gondii. Frontiers in Bioscience 5, D391–D405. Yang, S., Parmley, S.F., 1995. A bradyzoite stage-specifically expressed gene of Toxoplasma gondii encodes a polypeptide homologous to lactate dehydrogenase. Molecular and Biochemical Parasitology 73, 291–294. Yang, S., Parmley, S.F., 1997. Toxoplasma gondii expresses two distinct lactate dehydrogenase homologous genes during its life cycle in intermediate hosts. Gene 184, 1–12.