Tracking sources of Listeria contamination in a cooked chicken meat factory by PCR-RAPD-based DNA fingerprinting

Food Control 27 (2012) 64e72

Contents lists available at SciVerse ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Tracking sources of Listeria contamination in a cooked chicken meat factory by PCR-RAPD-based DNA fingerprinting Suwimon Keeratipibul*, Punnida Techaruwichit Department of Food Technology, Faculty of Science, Chulalongkorn University, 254 Phayathai Road, Bangkok 10330, Thailand

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 August 2011 Received in revised form 20 February 2012 Accepted 25 February 2012

As a means to reduce the risk of Listeria spp. contamination in cooked frozen chicken meat process this study investigated the sources and the routes of infection using PCR-RAPD-based molecular typing. A total of 12,833 samples of final products (865), intermediate stage precut and packaged meat (4325) and environmental surfaces (7643) were screened for the presence of Listeria spp. Of the 401 positive isolates from the processing environment, the species were comprised of Listeria innocua (82.3%), Listeria welshimeri (11.2%), Listeria seeligeri (5.5%) and Listeria monocytogenes (1%). Twelve positive isolates of L. innocua and one each of L. welshimeri and L. seeligeri were found in the finished product. A total of 415 Listeria contaminated samples were further subjected to RAPD (randomly amplified polymorphic DNA) analysis to evaluate the relationship of the contaminants in the final product and those in the environment. L. innocua type LI 1.1, L. welshimeri type LW 1.5 and L. seeligeri type LS 1 were the only isolates found in the finished product, whilst L. innocua type LI 1.1 was persistently found in the surfaces of the food processing plant throughout the sampling period. The surfaces from which Listeria spp. were most frequently recovered were the liquid N2 chiller exhaust pipe, the metal detector conveyor belt and the freezer drain. Therefore, the cleaning and sanitizing procedures were revised and strictly implemented to reduce and eliminate the real sources of Listeria contamination in the cooked frozen chicken meat process. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Chicken meat Listeria Transmission route Molecular typing RAPD

1. Introduction Cooked chicken meat products are economically important to several countries, spanning the developed to the developing countries, and include the Thai food processing industry. The annual export value for Thailand of 1e1.7 billion U.S. dollars (Thai Broiler Processing Exporters Association, 2010) makes Thailand the fourth largest cooked chicken meat exporting country in the world, after the United States of America, Brazil and the European Union (EU). Japan and the EU are the main importers of Thai chicken exports (Department of Foreign Trade, 2009). However, despite the significant production and distribution of Thai cooked chicken meat products, tracking the relevant pathogens to the source of contamination in these products remains poorly studied in Thailand. The genus Listeria, which are gram-positive, non-spore forming bacteria, are comprised of eight species: Listeria monocytogenes,

* Corresponding author. Tel.: þ66 2 2185515 6, þ66 2 2185519; fax: þ66 2 2544314. E-mail address: [email protected] (S. Keeratipibul). 0956-7135/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2012.02.026

Listeria innocua, Listeria welshimeri, Listeria seeligeri, Listeria grayi, Listeria ivanovii, Listeria rocourtiae (Leclercq et al., 2009) and Listeria marthii (Graves et al., 2010). L. monocytogenes is the species most widely associated with human disease (listeriosis), where this pathogen most often affects those with severe underlying conditions (such as immunosuppressive therapy, AIDS, and chronic conditions, such as cirrhosis), pregnant women, unborn or newly delivered infants and the elderly. All strains of L. monocytogenes appear to be pathogenic and infections can be life threatening, with fatality rates of 20e30% (WHO/FAO, 2004). Despite the fact that a wide variety of foods may be contaminated with L. monocytogenes, outbreaks and sporadic cases of listeriosis are predominately associated with ready-to-eat foods (Pradhan et al., 2009; WHO/FAO, 2004). An important factor in foodborne listeriosis is that the pathogen can grow to significant numbers at refrigeration temperatures when given sufficient time (ICMSF, 1996; MacGowan, Bowker, & Mclauchlin, 1994; WHO/FAO, 2004). Hence, L. monocytogenes directly affects the chilled and frozen ready-to-eat food industries. Although the regulatory standards of the Department of Livestock Development of Thailand, and various countries including Japan and the EU for ready-to-eat meat and poultry

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

products require a zero tolerance (negative in 25 g sample) for L. monocytogenes (Commission Regulation (EC) No. 2073/2005; Department of Livestock Development, 2010), Listeria spp. occurrence, and not only L. monocytogenes, in these products is unacceptable to both the exporters and importers (Interview data from QA manager of the cooked chicken meat factory in Thailand). Many studies support that the presence of any Listeria species in a specific environment can indicate the presence of the others, including L. monocytogenes (Barros et al., 2007; Slade, 1992). Thus, fairly extensive research by worldwide food producers and researchers related to Listeria elimination and prevention has been conducted. Many authors have also demonstrated a high prevalence of L. monocytogenes, and other Listeria spp., in meat and poultry product processing environments; for example: in chilling and cutting rooms (Van de Elen & Snijders, 1993), workers’ hands (Kerr, Kite, Heritage, & Hawkey, 1995), conveyor belt rollers (Tompkin, 2002) and processing equipment (Lawrence & Gilmour, 1995), strongly suggesting that the processing environment represents a significant source of these organisms in finished products. While processed meat and poultry products are cooked to destroy Listeria, these bacteria can recontaminate the product while it is being handled, packaged or distributed (Lekroengsin, Keeratipibul, & Trakoonlerswilai, 2007; Tompkin, Scott, Bernard, Sveum, & Gombas, 1999). Early studies of transmission routes depended solely on isolating and counting the organism at different places along the processing line (Eklund et al., 1995; Lekroengsin et al., 2007). When the organism was found on any environmental surface, cleaning and sanitizing was then implemented on the contaminated surfaces. However, the organism found on those surfaces might not be the organism that contaminated the product since by using conventional species identification, different strains of the same species could not be identified. Therefore, there has been a limitation to find the real source of product contamination. As a consequence, the control and prevention strategies implemented might not correct the contamination source. Thus, recent studies have been greatly facilitated by the use of molecular-typing methods with high discriminatory power, including randomly amplified polymorphic DNA (RAPD) profile analysis (Boerlin, Bannerman, Ischer, Rocourt, & Bille, 1995; Byun, Jung, & Yoo, 2001; Chambel et al., 2007; Fonnesbech Vogel, Jørgensen, Ojeniyi, Huss, & Gram, 2001). Molecular studies on the ecology of Listeria species strains present in the food processing environment provide crucial information for the development of better control and prevention strategies for this important foodborne pathogen (Norton et al., 2001). However, despite its importance, at present there are only a few studies on the Listeria profile and its control in the Thai chicken meat processing plants, and there is no report of the molecular typing of Listeria to track the source of contamination to implement a better understanding and control of the route of food contamination by this organism in Thailand. Therefore, the purpose of this study was to investigate the prevalence and the transmission routes of Listeria species to cooked (steamed) chicken meat products in a representative Thai cooked frozen chicken meat processing plant using PCR-RAPD molecular detection. 2. Materials and methods 2.1. Processing plant and product manufacturing This study was performed in a cooked (steamed) chicken meat processing plant in Thailand. The steam production line has a processing capacity of 23 metric tons per day, using raw chicken meat obtained from a certified slaughter house. The flow diagram of the cooked chicken meat processing line is presented in Fig. 1. The raw

65

Steaming (Product core temperature of 75 oC for not less than 1 min)

Pre-chilling in a liquid N2 chiller (Product core temperature of 50 – 60 oC)

Chilling in an air blast spiral chiller (Product core temperature of 10 oC)

Slicing or dicing by man or machine

Individual quick freezing (IQF) (Product core temperature of -18 oC)

Filling and packing Fig. 1. The schematic flow diagram of the cooked chicken meat processing line.

chicken meat was cooked by steaming to bring the product core temperature to 75  C for not less than 1 min. After that the meat was pre-chilled in a liquid nitrogen (N2) chiller until the product core temperature reached around 50e60  C and further cooled down to 10  C in an air blast spiral chiller. Then, the meat was diced or sliced by hand or dicing machine, frozen in an individual quick freezer (IQF) until the product core temperature was lower than 18  C and packed in a plastic bag. The ambient temperature in the plant was controlled at 10  C. The different processing operations of the cooked meat took place in a big hall with separated sections and with a continuous flow process. A strict procedure regarding personal hygiene was instructed and followed. All employees wore gloves which were sanitized every half an hour and changed at least twice a shift. Daily cleaning and sanitizing was carried out at the middle and the end of each production shift (day shift: 12:00e13:00, 17:00e18:00; night shift: 24:00e1:00, 5:00e6:00). A thorough cleaning was carried out on Sunday when there is no production. 2.2. Sampling The processing environmental surfaces and the different intermediate stages of chicken meat processing and the finished product, were sampled over a 16-week period between Oct 2009 and Jan 2010. Sampling was performed three days per week (Tuesday, Thursday and Friday) at six times per, day. That is for the day shift at 7:00 (start of the day-shift production), 10:00 and 16:00 h; and for the night shift at 19:00 (start of the night shift), 22:00 and 4:00 h. A total of 11,968 samples were collected and screened for Listeria spp. Samples of chicken meat were immediately taken after each processing step, i.e. after the cooking, pre-chilling, chilling, dicing, and freezing steps. In all cases, 500 g of each product sample was taken and sealed in a sterile plastic bag and transported in a cooler

66

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

to the laboratory for further analysis. A bag (5 kg e packaged) of the finished product was also sampled before exporting to the customers and transported in a cooler to the laboratory. Environmental sampling was performed in the different processing plant areas. Sampling locations were chosen to represent those most likely to harbor Listeria. Sampling sites were divided into three zones, based on the contact and proximity to the product. Zone 1 is the product-contact surfaces, zone 2 is the non-product contact surfaces in close proximity to the product and zone 3 is the non-product contact surfaces that are further away from the product. The area of environmental sampling varied depending on the sampling location. All sampling sites in the production environment were swabbed with sterile cotton swabs moistened with 0.85% NaCL (w/v). After sampling, the swabs were soaked in 10 ml of Dey/Engley(D/E) Neutralizing Broth and kept in a cooler during transport to the laboratory. 2.3. Listeria species identification by VIDASÒ method Upon arrival at the laboratory, 25 g chicken samples were each homogenized for 1 min in 225 ml Half-Fraser (HF) broth (bioMérieux) in a stomacher, and incubated at 30  1  C for 20e26 h as a pre-enrichment step. One ml of the suspension was transferred to tubes containing 10 ml of Fraser Broth and incubated at 30  1  C for 20e26 h. Then, 1 ml of the Fraser Broth was transferred to tubes and heated at 95e100  C for 15  1 min. After heating, the tubes were cooled and mixed, and then 0.5 ml of the boiled broth was transferred into the sample well on VIDASÒ strip. Vidas Assay (Vidas LIS/48 min) for Listeria spp. detection was then performed. For the environmental samples, the swabs were resuspended in 90 ml HF broth and incubated at 30  1  C for 24e26 h. One ml of the suspension was then transferred to tubes and heated at 95e100  C for 15  1 min. Then, 0.5 ml of the boiled broth was transferred into the sample well on VIDASÒ strip. Vidas Assay (Vidas LSX/70 min) for Listeria spp. detection was then performed (bioMérieux, Durham, France). One loop of all positive samples were streaked on Listeria selective agar (Oxford; OXOID) and Ottaviani Agosti agar (OAA) plates (bioMérieux), incubated at 37  1  C for 48  2 h and then observed for the presence of typical Listeria colonies according to ISO 11290-1. From each plate, three colonies with morphological characteristics of Listeria were picked off, streaked onto TSAYE (Tryptone Soy Agar; OXOID) with 0.6% (w/ v) Yeast Extract (Merck) plates and incubated at 37  1  C for 18e24 h. Colonies presumptive for Listeria spp. on TSAYE were selected and subjected to Gram staining, catalase test and motility at 25  1  C for 48 h. The API Listeria System incubated at 35  1  C for 18e24 h was used to confirm the identified species (bioMérieux S.A.). 2.4. Listeria strain identification by RAPD 2.4.1. DNA preparation A single isolated colony of Listeria on TSAYE was picked up and cultured in TSBYE (Tryptic Soy Broth with 0.6% (w/v) Yeast Extract; Merck) overnight at 37  C. The cells from 3 ml of the overnight culture were recovered by centrifugation (10,000  g for 10 min), from which the total DNA was extracted using the Genomic DNA Extraction Kit (YGB, RBC Bioscience). The concentration of extracted DNA was determined by measuring the absorbance at O.D.260. 2.4.2. RAPD analysis For single primed PCR-RAPD fingerprinting, an initial screening of the 16 different primers; the universal forward (UFS), Tn21 and ampC gene sequencing primers (MacGowan et al., 1993); UBC155, UBC156, UBC127 (Farber & Addison, 1994), HR4, ECO2

(Niederhauser et al., 1994), PB1, PB4 (Byun et al., 2001), HLWL 74, HLWL 85, OMP-01 (Aguado, Vitas, & Garcia-Jalon, 2004), CsM 13, inl AF and pH (Chambel et al., 2007), was performed with five strains of L. innocua, three strains of L. welshimeri and two strains of L. seeligeri isolated from the environmental surfaces of the processing plant. Based upon the PCR-RAPD banding profiles obtained, four of these 16 primers were selected for RAPD typing. Amplification was performed in a thermocycler (Corbett Research), using a total volume of 20 ml solution which included 10 reaction buffer, 1 U of Taq DNA polymerase (Invitrogen), 10 mM of each deoxynucleoside triphosphate (Fermentas), 50 mM Mg2Cl, 10 mM of primer and 1 ml of DNA extract. A concentration of 5 ng/reaction DNA template was used in the RAPD reaction. The same volume (1 ml) of double deionized water was used to replace the bacterial DNA extract as a negative control, while a template DNA of L. innocua was used as a positive control. The primers selected were the universal forward sequencing primer (UFS: 50 TTATGTAAAACGACGGCCAGT30 ), HLWL 74 (50 ACGTATCTGC30 ), HLWL 85 (50 ACAACTGCTC30 ) and OMP-01 (50 GTTGGTGGCT30 ). The PCR cycling conditions used for these primers were as follows. For the UFS primer, 94  C for 3 min followed by 4 cycles of 94  C for 45 s, 26  C for 2 min and 72  C for 2 min; 30 cycles of 94  C for 45 s, 36  C for 1 min and 72  C for 2 min; plus one additional cycle at 72  C for 5 min. For the HLWL 74, HLWL 85 and OMP-01 primer, the cycling program was 45 cycles of 94  C for 4 min, 39  C for 45 s, 72  C for 1 min; plus 1 additional cycle of 72  C for 10 min. To differentiate the strains, pattern analysis was performed. One ml of the amplification products from each of the four selected primer reactions was mixed and loaded on an Agilent DNA 7500 kit and the pattern was examined by using Agilent 2100 Bioanalyzer. 3. Results 3.1. Prevalence of Listeria species From a total of 4325 intermediate chicken meat samples, taken from five processing steps, none of the samples were positive for Listeria spp. However, from a total of 865 finished product samples that were analyzed, 14 (approximately 1.6%) were found to be positive for Listeria spp., comprised of 12 samples being positive for L. innocua and one each for L. welshimeri and L. seeligeri, with no samples being co-infected with multiple species of Listeria spp. A total of 2954 environmental samples from zone 1 surfaces, 3645 samples from zone 2 and 1044 samples from zone 3 were swabbed and revealed the prevalence of Listeria in 1.1, 5.8 and 13.4% of the samples, respectively. The species compositions of these 401 contaminated samples were L. innocua (82.3%), L. welshimeri (11.2%), L. seeligeri (6%) and L. monocytogenes (1.0%). The prevalence (% positive samples) of Listeria spp. on the surfaces at the start of day-shift production (7:00 h) ranged from low, but not zero (0.8%) at zone 1 up to high, (12.1%) for zone 3 and typically increased by the start of night-shift production (19:00 h), especially in zone 3 (Fig. 2). Importantly, Listeria spp. were present on the surfaces in zones 1, 2 and 3 at all production times, but whilst the prevalence of Listeria spp. on surfaces in zones 1 and 2 were broadly consistent in most production times, that on the zone 3 surfaces increased rapidly and continuously from 10:00 (minima) until the end of the production time of the night shift (04.00 h). 3.2. Development and optimization of RAPD assay Sixteen primers, which have been used in other studies for RAPD analyses of L. monocytogenes and other species in this genus of different origin, were tested for their discriminatory abilities

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

Fig. 2. Trend of Listeria spp. prevalence as that recovered from all environmental surface swabs with respect to each zone and the daily production time.

against five isolates of L. innocua, three of L. welshimeri and two of L. seeligeri isolates from the environmental surfaces of the processing plant. The fingerprints produced by eight of the primers (Tn 21, PB 1, PB 4, CsM 13, inl AF, pH, HR4 and ECO2), could not differentiate the strains that showed different fingerprints when the other primers were used. However, four of the primers (OMP01, HLWL 74, HLWL 85 and UFS), provided the highest discriminating power among the 16 tested primers. Primer OMP-01 could differentiate all five L. innocua isolates, primers HLWL 85 and HLWL 74 could differentiate all three L. welshimeri isolates, and primers OMP-01, HLWL 85, HLWL 74 and UFS could differentiate both L. seeligeri isolates. However, to enhance the discriminatory potential, the four primers (OMP-01, HLWL 85, HLWL 74 and UFS) were used for every isolate regardless of which species it was. 3.3. RAPD profiling and prevalence of Listeria species and strains Reproducible distinct electrophoretic patterns were obtained using the combined amplicons from the separate RAPD-PCR amplifications of all four primers (OMP-01, HLWL 74, HLWL 85 and UFS). Three main RAPD patterns (strains LI 1, LI 2 and LI 3) were obtained for the 342 L. innocua isolates examined with strain LI 1 being further divided into four substrains (LI 1.1, LI 1.2, LI 1.5 and LI 1.6), as shown schematically in Fig. 3, with an example of the strain and substrain classification shown in Fig. 4. Strain LI 2 was divided into two different substrains (LI 2.1 and LI 2.2) whilst strain LI 3 did not have a different RAPD substrain. L. innocua strain LI 1.1 was the dominant strain, represented by 77.1% of all the L. innocua samples. The other L. innocua strains presented in the processing environment were LI 2.2 (11.5%), LI 1.2

67

(4.1%), LI 1.6 (3.5%), LI 2.1 (1.8%), LI 3 (1.8%) and LI 1.5 (0.3%). Only strain LI 1.1 was found in the finished product. This strain was widely distributed on the environmental surfaces of all zones of every processing step along the processing line throughout the sampling period. The high frequency of contamination (58.6%) was at the exhaust pipe of the in-feed liquid N2 chiller where the product was fed into the chiller. On this surface, a greater diversity of L. innocua strains were found, being LI 1.2, LI 1.6, LI 2.1 and LI 2.2, than on any other environmental surface (Table 1). For L. welshimeri, three main different RAPD profiles (strains LW 1, LW 2 and LW 3) were obtained from the 46 isolates, with strain LW 1 being further divided into five substrains (LW 1.1, LW 1.5, LW 1.6, LW 1.7 and LW 1.8), as shown in Fig. 3. L. welshimeri strain LW 1.7 was the dominant strain (37.5%) of L. welshimeri found in the processing environment. The other L. welshimeri strains contaminated in the processing environment were LW 1.1 (25%), LW 2 (10%), LW 3 (10%), LW 1.6 (7.5%), LW 1.8 (7.5%) and LW 1.5 (5%). The only L. welshimeri found in finished product was strain LW 1.5. The prevalence of the various L. welshimeri strains on the environmental surfaces in the processing plant are shown in Table 2. The main sources of L. welshimeri contamination were in the late process stages and in zone 3, followed by zone 2 and then zone 1. The main sources in zone 1 (direct contact) were the workers’ gloves in quality control/packing (LW 1.7 and LW3) and the freezer (LW1.6). For L. seeligeri, one sample of the finished product was contaminated, whilst 21 contaminated areas were found in the processing environment. All 22 isolates belonged to a single RAPD strain (LS 1, Fig. 3). A high prevalence was found in the late process stages on the floor of the packing area and the freezer area surfaces, which are the same areas as L. welshimeri LW 1.7, except that one LS1 sample was also isolated on the floor of dicing area. For L. monocytogenes, one main RAPD profile based strain, LM 1, was obtained from the four L. monocytogenes isolates, which was further divided into substrain LM 1.1 and LM 1.2 (Fig. 3). No L. monocytogenes isolate was found in the finished product. Two isolates belonging to substrain LM 1.1 were found on floor of the packing area and gloves of the quality control worker at the packing step, whilst the other two LM 1.2 isolates being found on the wiremesh tray which was connected to the out-feed conveyor belt of the freezer.

3.4. Correlation of Listeria RAPD types in cooked chicken meat and in the processing environment As mentioned in Section 3.1, a total of 14 Listeria isolates, 12 from L. innocua LI 1.1 and one each from L. welshimeri LW 1.5 and L. seeligeri LS 1,were obtained from the finished chicken product.

Fig. 3. Representative RAPD patterns of Listeria species strains/substrains from a cooked chicken meat processing plant generated with primer OMP-01, HLWL 74, HLWL 85 and UFS. L, ladder. Lanes 1 and 2, L. monocytogenes strains (LM 1.1 and LM 1.2, respectively). Lanes 3e9, L. innocua strains (LI 1.1, LI 1.2, LI 1.5, LI 1.6, LI 2.1, LI 2.2 and LI 3, respectively). Lanes 10e15, L. welshimeri strains (LW 1.1, LW 1.5, LW 1.6, LW 1.7, LW 2, and LW 3, respectively). Lane 16, L. seeligeri strain (LS 1).

68

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

Fig. 4. Examples of electropherograms of L. innocua RAPD subtypes among 363 isolates. The seven strains of L. innocua shown are (A) LI 1.1, (B) LI 1.2, (C) LI 1.5, (D) LI 1.6, (E) LI 2.1, (F) LI 2.2 and (G) LI 3. The electropherograms were obtained from an Agilent 2100 Bioanalyzer. The vertical axis is the concentration of the RAPD products (nmol/l). The horizontal axis is the elution time (s) of the RAPD products. The first and last peaks represent the lower and higher mass standard markers, respectively.

Examination of the environmental surfaces in the processing area that were contaminated with L. innocua LI 1.1 on the same or a nearby day that the finished products were contaminated reveals that L. innocua LI 1.1 was mainly found in the exhaust pipe of infeed liquid N2 chiller as well (Tables 3 and 4). Moreover, L. innocua LI 1.1 was also found on conveyor belts of the in-feed liquid N2 chiller, dicer, metal detector and heat sealer, as well as the control monitor of the dicer, tray supporter under the liquid N2 chiller, floor of the dicing area, draining pipe of the freezer, floor of the packing area and the gloves of the worker who carried equipment to be cleaned. For L. welshimeri, substrain LW 1.5 was found in the finished product on 14/11/09 yet no environmental surface in the processing line was found to be contaminated with L. welshimeri LW 1.5 on or close to that day. One month later on 18/12/09, L. welshimeri LW 1.5 was found once again in the draining pipe of the freezer. The source of contamination of substrain LW 1.5 in the finished product on 14/ 11/09 has not been revealed yet. Only one finished product sample was contaminated with L. seeligeri LS 1, but no environmental surface was contaminated with L. seeligeri LS 1 at that time. However, 4 days before the product was contaminated, the gloves of packing worker (zone 1 surface) were contaminated with L. seeligeri LS 1. In addition, two days after the date the product was contaminated the floor of the

packing area (zone 3) and the draining pipe of the freezer (zone 3) were positive for L. seeligeri LS 1. 4. Discussion Detectable levels of Listeria spp. were isolated from samples of the finished meat product and environmental surface swabs in the processing plant, but none in the intermediate product. Thus, either Listeria spp. contamination occurs in the processing, or else preexisting contaminations in the meat are at a low rate and concentration or are distributed unevenly in the product making it difficult to detect Listeria spp. Given the proportion of Listeria spp. found in the finished product and environmental surfaces of the processing plant, compared to the number of negative intermediate meat samples, it is likely that contamination of Listeria spp. in the finished product came, at least in part if not totally, from the environmental surface. Certainly, Listeria spp. contamination was found to occur on at least some environmental surfaces in every zone throughout both the production shifts, suggesting that, the cleaning and sanitizing at the end of each production shift could not completely eliminate Listeria spp. on all the surfaces of each zone, in addition to any new contamination brought in by the workers each day. The increasing prevalence of Listeria spp. on zone 3 surfaces during the two

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

69

Table 1 Prevalence (% positive from 7643 screened samples) of L. innocua strains on the environmental surfaces in the three zones (see Methods) of the processing line. Zone

Swab surfaces

LI 1.1

LI 1.2

LI 1.5

LI 1.6

LI 2.1

LI 2.2

LI 3

1

Out-feed conveyor belt of cooker In-feed conveyor belt of liq. N2 chiller In-feed conveyor belt of chiller Out-feed conveyor belt of chiller Conveyor belt of dicer Gloves of QC worker after dicing In-feed conveyor belt of freezer Out-feed conveyor belt of freezer Gloves of worker at freezer Gloves of packing worker

e 2.3 0.6 0.6 1.7 1.1 0.6 1.1 1.1 0.6

e e e 0.6 e e e 0.6 e 0.6

e e e e e e e e e e

0.6 e e e e e e e e e

e e e e e e e e e e

e 0.6 0.6 e e e e e e e

e e e e e e e e e e

2

Frame of the exit of cooker Tray supporter under conveyor belt of the cooker Exhaust pipe of liquid N2 chiller Tray supporter under conveyor belt of liquid N2 chiller Monitor of dicer controller External area of the dicer Controller box of dicer Packing table Conveyor belt of metal detector and heat sealer Belt for transferring equipment

0.6

e 0.6 0.6 e e e e e e e

e e e e e e e e e e

e e 2.9 e e e e e 1.7 e

e e 2.3 e e e e e e e

e e 9.2 e e e 0.6 e e e

e e e e e 1.1 e e 0.6 e

Gloves of worker carrying used equipment Floor of dicing room Wall of freezer Draining pipe of freezer Floor at packing area

0.6 9.8

1.1 e e 0.6

e e e 0.6 e

e 1.1 e e e

e e e e 0.6

e 2.3 e e 0.6

e 0.6 0.6 0.6 e

3

L. innocua strains/substrains

58.6 4.0 0.6 0.6 1.1 1.1 7.5 0.6

22.4 14.4

For the finished product, only isolate L1.1 was found in 12/865 samples.

production shifts reflects that more attention was paid to surfaces in zones 1 and 2 during the mid-shift cleaning and sanitizing, including the frequent brief sanitizing with 70% (v/v) ethanol during production which can reduce the prevalence of Listeria spp. However, even with respect to zones 1 and 2, the cleaning and sanitizing procedures do not appear to be able to totally eliminate Listeria spp. In this study site four of the eight Listeria species were recovered, with L. grayi, L. ivanovii, L. rocourtiae and L. marthii not being found. Moreover, only four of the positive samples were found to be isolates of the pathogenic L. monocytogenes (1%). Instead, L. innocua (82.3%) was the most prevalent species. This result is in accordance with other authors, especially the predominance of L. innocua over L. monocytogenes and other species (Barros et al., 2007; Capita, Alonso-Calleja, Moreno, & Garcia-Fernandez, 2001). However, the presence of Listeria spp. is useful in assessing the potential presence of L. monocytogenes in the process plant environment (Tompkin, 2002). Rather strong and prompt action should be taken following the isolation of any Listeria spp.

The development of a better understanding of the route of contamination with Listeria species in food processing plants, in combination with rapid, standardized detection and typing systems, will provide critical tools and knowledge for the development and verification of improved control strategies (Norton et al., 2001). Among various molecular fingerprinting methods, PCR-RAPD has been shown to be a rapid, reproducible and powerful genomic typing method for L. monocytogenes (Boerlin et al., 1995; Cocolin et al., 2005; Farber & Addison, 1994; Fonnesbech Vogel et al., 2001; Kerr et al., 1995). Comparing with other subtyping methods, Kerouanton et al. (1998) compared serotyping, electrophoretic typing of esterases (zymotyping), restriction fragment length polymorphism of ribosomal DNA (ribotyping), pulsed-field gel electrophoresis (PFGE) and RAPD (with 1 primer) in a study designed to adapt a strategy for epidemiologically typing of L. monocytogenes strains. Five serotypes, eight zymotypes, ten ribotypes, 12 PFGE patterns and 13 RAPD patterns were identified among their 35 strains. Giovannacci et al. (1999) determined the origin of pork cuts contamination by L. monocytogenes using RAPD

Table 2 Prevalence (% positive from 7643 screened samples) of L. welshimeri strains on the environmental surfaces in the three zones of the processing line. Zone

Swab surfaces

LW 1.1

LW 1.5

LW 1.6

LW 1.7

LW 1.8

LW 2

LW 3

1

Gloves of worker at the freezer Gloves of packing worker and QC worker at packing step

e e

e e

0.6 e

e 0.6

e e

e e

e 0.6

2

Exhaust pipe of liquid N2 chiller Monitor of dicer controller Conveyor belt of metal detector and heat sealer

e 0.6 2.3

e e e

e e 0.6

e 0.6 0.6

e e 0.6

e e e

0.6 e e

3

Floor at cooking area Wall of the freezer Draining pipe of the freezer Floor at packing area

e 1.1 1.7 e

e e 0.6 e

e e e e

e 2.9 2.9 0.6

e 0.6 0.6 e

1.1 0.6 e 1.1

e 0.6 0.6 e

For the finished product, only isolate LW 1.5 was found, and in 2/865 cases.

L. welshimeri strains/substrains

70

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

Table 3 The contamination of L. innocua LI 1.1 on different environmental surfaces on the day, or close by it, that the finished product contamination was found. Source of contamination

Zone

15/11/09 (4a)

20/11/09 (1)

21/11/09 (1)

14/12/09 (1)

04/01/10 (3)

13/01/10 (1)

16/01/10 (1)

Conveyor belt of in-feed liquid N2 chiller Exhaust pipe on in-feed liquid N2 chiller Tray supporter under the conveyor belt of liquid N2 chiller Floor of dicing room Monitor of dicing controller Conveyor belt of dicer Draining pipe of freezer Floor at packing area Conveyor belt of heat sealer Conveyor belt of metal detector Gloves of worker carrying equipment

1 2 2 3 2 1 3 3 2 2 1

e 1 e e e e e e e e e

e 4 e 1 e e e e e e e

e 4 e 2 e e e e e e e

e 4 e e e e e e 1 1 e

e 6 e 1 e e 1 e e 1 1

1 5 1 e 1 1 2 e e e e

e 4 e 1 e e 4 1 e 1 e

a

Number of contaminated finished product found on the day.

with five different primers, PFGE and a PCR-restriction enzyme analysis (PCR-REA) based on the polymorphism existing within the inlA and inlB genes. Results obtained from RAPD and PFGE were closely related and distinguished respectively 17 RAPD types and 17 PFGE types among the 287 isolates, whereas the PCR-REA analysis only yielded two profile. Therefore, RAPD method was chosen as a tool for Listeria investigation in this study. In general, it has been recommended that at least three informative (polymorphic) primers be used if RAPD is the sole molecular-typing method employed (Kerr et al., 1995). In this study the four informative (polymorphic) primers (OMP-01, HLWL 74, HLWL 85 and UFS) that were selected and used in this study have already shown their discriminatory power in other studies (Aguado et al., 2004; MacGowan et al., 1993). The L. innocua strains in this study contained PCR-RAPD profiles that were comprised of largely similar product sizes, but there were some different bands allowing discriminatory designation of different substrains. Of the isolates that were placed in the same substrain, they were analyzed at different times and on different days, suggesting the reproducibility of this system. In addition to environmentally induced mutations, the genomic heterogeneity of Listeria might result from differential selection from environmental stresses, such as the use of sanitizers and/or the change of cleaning and sanitizing agents, upon a mixed population, or mixed colonizers brought in, for example, by the workers. Buchrieser, Cossart, Kunst, Glaser, and Rusniok (2003) and Lou and Yousef (1997) indicated that acid sanitizers and ethanol might cause adaptation of the organism to endure and survive in the environment. Adaptive responses may also occur in response to heat and acid stresses factors that are frequently involved in cleaning and sanitizing treatments (Hill, Driscoll, & Booth, 1995). L. innocua LI 1.1 was found in the cooked chicken meat processing plant at all sampling periods with a persistent contamination of the processing line. Continuous contamination of processing lines by incoming raw material does not seem probable since the cooking temperature and time is sufficient to destroy the Listeria

Table 4 The occurrence of L. innocua on the exhaust pipe at in-feed side (product incoming side) and out-feed side (product leaving side) of liquid N2 chiller. Month

January February March April May

Number of contaminated samples/number of analyzed samples The exhaust pipe at in-feed side

The exhaust pipe at out-feed side

0/5 9/10 3/5 4/5 7/11

1/1 0/10 0/5 0/5 0/5

spp. In addition and importantly, no Listeria spp. were detected in the product taken after the cooking step. This result is in accordance with Lundén, Autio, and Korkeala (2002), who reported that the sources of contamination came from the processing lines i.e. dicing machine, not from the raw material. Autio, Keto-Timonen, Lunden, Björkroth, and Korkeala (2003) and Miettinen, Björkroth, and Korkeala (1999) also reported that they did not find persistent L. monocytogenes (pulsed-field gel electrophoresis typing) in raw materials. Miettinen et al. (1999) showed that the packing machine sustained the contamination, and Autio et al. (2003) observed that L. monocytogenes contamination was associated with processing machines, particularly dicing machines. Although many potential sources of contamination of L. innocua LI 1.1 were found in this study, the surface that was the most frequently infected was the exhaust pipe of the in-feed liquid N2 chiller (used for cooling the product of 75  C down to about 40e50  C), and this correlated to product contamination. Although located in zone 2, and so is not a product-contact surface, it was quite near the product and the employee traffic flow around there was always congested. Thus, the cross contamination potential was very high. Moreover, the condensate from the exhaust pipe of the liquid N2 chiller frequently dropped on the floor, where it might be carried and distributed to other environmental surfaces by employees working around that area. Although the environmental surfaces in zone 1 (product-contact surface) are the direct route for product contamination, any persistent contamination in zone 2 can also easily cause product contamination through zone 1 (e.g. conveyor belt of in-feed liquid N2 chiller) and workers. Therefore, more attention should be paid to the non-product contact surfaces (zones 2 and 3) as well. That L. innocua occurred on the exhaust pipe at in-feed side (product entering side) and not on the out-feed side (product leaving side) of the liquid N2 chiller is likely explained by the difference in their temperatures. The in-feed side (6e10  C) being compatible with Listeria growth in contrast to the colder out-feed side (91  C). The liquid nitrogen chiller exhaust vent is of a nonuniversal design. The in-feed pipe is very long and installed high up through the ceiling to exhaust the N2 gas out of the factory. Additionally, the vent pipe is not straight but is doglegged, bending at 45 to the perpendicular for about 2.5 m before reverting back to vertical and venting for a considerable height out of the building. In addition, some parts cannot be disassembled and so prevents a considerable difficulty in thoroughly cleaning and sanitizing. Due to the high-speed flow of the exhausted N2 gas, chicken meat residues accumulated inside the pipe. Since Listeria can grow and multiply at temperatures as low as 0.4  C (Walker, Archer, & Banks, 1990), the in-feed side provides ideal conditions for Listeria growth and it is a perfect harborage site (residence) of Listeria. Although this is not a general design, but a specific problem to this

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

meat plant, the general principal is nevertheless important. That is that the design of all aspects of a processing plant, and not just those in zone 1 but also those in zones 2 and 3, should allow for ease of complete sanitization to prevent the development of harborage sites. Considering the contamination of L. welshimeri, substrain LW 1.7 was found to be the most prevalent L. welshimeri in the processing environment, but no analyzed product sample was contaminated with substrain LW 1.7. Indeed, in all the sampling in this study, only one sample of the finished product was contaminated with L. welshimeri, and this was with substrain LW 1.5. Thus, although investigation of contamination at molecular level can help reveal the real source of product contamination, and so help in reducing the contamination of the cooked chicken meat, in this study the real source of L. welshimeri LW 1.5 contamination was not found and further investigation is needed. After investigating the potential sources of Listeria contamination in the product, various corrective and preventive actions were implemented to eradicate the contamination. These included dissembling all equipments at the end of the shift, revision of cleaning and sanitizing procedures (types of chemical and frequency of cleaning and sanitizing), and for those parts of equipment which could not be dissembled, then subjected to steam heating at 75  C for 15 min. After implementing the new procedure, the prevalence of Listeria spp. in the finished product and processing environment were decreased. The contamination of Listeria spp. in the finished product decreased some eight-fold (from 1.6% down to 0.2%). However, the Listeria strain found in the final finished product was L. innocua substrain LI 1.6 (instead of LI 1.1) which was also found at the exhaust pipe of in-feed liquid N2 chiller. L. welshimeri, particularly substrain LW 1.7, became the dominant species found on the processing environment, instead of L. innocua, suggesting that total elimination of Listeria spp. is not completely achieved and needs further investigation. Listeria spp. can survive in the production environment as various substrains that can be evaluated by molecular techniques to track the real sources of product contamination. Although the contamination of Listeria could not be completely eliminated, it is necessary to control the contamination to the lowest logistically possible level. Sanitary design of the equipment and appropriate plant design (including employee and product flow) are crucial for controlling Listeria contamination. In addition, the correct, appropriate and frequent cleaning and sanitizing procedure must be strictly implemented, as the presence of persistent strains indicated the chance of product contamination.

Acknowledgments We are indebted to the management and staff of the frozen cooked ready-to-eat chicken meat factory and laboratory that participated in this study. This study was supported by grants from the National Research University Project of CHE and the Ratchadaphiseksomphot Endowment Fund (FW 004A).

References Aguado, V., Vitas, A. I., & Garcia-Jalon, I. (2004). Characterization of Listeria monocytogenes and Listeria innocua from a vegetable processing plant by RAPD and REA. International Journal of Food Microbiology, 90, 341e347. Autio, T., Keto-Timonen, R., Lunden, J., Björkroth, J., & Korkeala, H. (2003). Characterization of persistent and sporadic Listeria monocytogenes strains by pulsedfield gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP). Systematic and Applied Microbiology, 26, 539e545. Barros, M. A. F., Nero, L. A., Silva, L. C., d’Ovidio, L., Monteiro, F. A., Tamanini, R., et al. (2007). Listeria monocytogenes: occurrence in beef and identification of the main contamination points in processing plants. Meat Science, 76, 591e596.

71

Boerlin, P., Bannerman, E., Ischer, F., Rocourt, J., & Bille, J. (1995). Typing Listeria monocytogenes: a comparison of random amplification of polymorphic DNA with 5 other methods. Research in Microbiology, 146, 35e49. Buchrieser, C., Cossart, P., Kunst, F., Glaser, P., & Rusniok, C. (2003). Comparison of the genome sequences of Listeria monocytogenes and Listeria innocua: clues for evolution and pathogenicity. FEMS Immunology and Medical Microbiology, 35, 207e213. Byun, S. K., Jung, S. C., & Yoo, H. S. (2001). Random amplification of polymorphic DNA typing of Listeria monocytogenes isolated from meat. International Journal of Food Microbiology, 69, 227e235. Capita, R., Alonso-Calleja, C., Moreno, B., & Garcia-Fernandez, M. C. (2001). Occurrence of Listeria species in retail poultry meat and comparison of a cultural/ immunoassay for their detection. International Journal of Food Microbiology, 65, 75e82. Chambel, L., Manuela, S., Fernandes, I., Barbosa, M., Zilhão, I., Barata, B., et al. (2007). Occurrence and persistence of Listeria spp. in the environment of ewe and cow’s milk cheese dairies in Portugal unveiled by an integrated analysis of identification, typing and spatialetemporal mapping along production cycle. International Journal of Food Microbiology, 116, 52e63. Cocolin, L., Stella, S., Nappi, R., Bozzetta, E., Cantoni, C., & Comi, G. (2005). Analysis of PCR-based methods for characterization of Listeria monocytogenes strains isolated from different sources. International Journal of Food Microbiology, 103, 167e178. Commission Regulation (EC) No. 2073/2005. Available from http://ec.europa.eu/ food/food/biosafety/hygienelegislation/legisl_en.htm. Department of Foreign Trade. (2009). Available from http://www.depthai.go.th/dep/ doc/ 53/53003610.doc. Department of Livestock Development. (2010). Microbiological criteria of livestock products for export [online]. Available from http://www.dld.go.th/certify/th/index. php? option¼com_content&view¼article&id¼609:law&catid¼118:docuqmentary. Eklund, M. W., Poysky, F. T., Paranjpye, R. N., Lashbrook, L. C., Peterson, M. E., & Pelroy, G. A. (1995). Incidence and sources of Listeria monocytogenes in coldsmoked fishery products and processing plants. Journal of Food Protection, 58, 502e508. Farber, J. M., & Addison, C. J. (1994). RAPD typing for distinguishing species and strains in the genus Listeria. Journal of Applied Bacteriology, 77, 242e250. Fonnesbech Vogel, B., Jørgensen, L. V., Ojeniyi, B., Huss, H. H., & Gram, L. (2001). Diversity of Listeria monocytogenes isolates from cold-smoked salmon produced in different smokehouses as assessed by random amplified polymorphic DNA analyses. International Journal of Food Microbiology, 65, 83e92. Giovannacci, I., Ragimbeau, C., Queguiner, S., Salvat, G., Vendeuvre, J. L., Carlier, V., et al. (1999). Listeria monocytogenes in pork slaughtering and cutting plants. Use of RAPD, PFGE and PCR-REA for tracing and molecular epidemiology. International Journal of Food Microbiology, 53, 127e140. Graves, L. M., Helsel, L. O., Steigerwalt, A. G., Morey, R. E., Daneshvar, M. I., Roof, S. E., et al. (2010). Listeria marthii sp. nov., isolated from the natural environment, Finger Lakes National Forest. International Journal of Systematic and Evolutionary Microbiology, 60, 1280e1288. Hill, C., Driscoll, B. O., & Booth, I. (1995). Acid adaptation and food poisoning microorganisms. International Journal of Food Microbiology, 28, 245e254. ICMSF. (1996). Micro-organisms in foods 5: Characteristics of microbial pathogens. New York: Blakie Academic and Professional. Kerouanton, A., Brisabois, A., Denoyer, E., Dilasser, F., Grout, J., Salvat, G., et al. (1998). Comparison of five typing methods for the epidemiological study of Listeria monocytogenes. International Journal of Food Microbiology, 43, 61e71. Kerr, K. G., Kite, P., Heritage, J., & Hawkey, P. M. (1995). Typing of epidemiologically associated environmental and clinical strains of Listeria monocytogenes by random amplification of polymorphic DNA. Journal of Food Protection, 58, 609e613. Lawrence, L., & Gilmour, A. (1995). Characterization of Listeria monocytogenes isolated from poultry products and from the poultry-processing environment by random amplification of polymorphic DNA and multilocus enzyme electrophoresis. Applied and Environmental Microbiology, 61, 2139e2144. Leclercq, A., Clermont, D., Bizet, C., Grimont, P., Le Flèche-Matéos, A., Roche, S., et al. (2009). Listeria rocourtiae sp. nov. International Journal of Systematic and Evolutionary Microbiology, 60, 2210e2214. Lekroengsin, S., Keeratipibul, S., & Trakoonlerswilai, K. (2007). Contamination profile of Listeria spp. in three types of ready-to-eat chicken meat products. Journal of Food Protection, 70, 85e89. Lou, A., & Yousef, A. E. (1997). Adaptation to sublethal environmental stresses protects Listeria monocytogenes against lethal preservation factors. Applied and Environmental Microbiology, 63, 1252e1255. Lundén, J. M., Autio, T. J., & Korkeala, H. J. (2002). Transfer of persistent Listeria monocytogenes contamination between food-processing plants associated with a dicing machine. Journal of Food Protection, 65, 1129e1133. MacGowan, A. P., Bowker, K., & Mclauchlin, J. (1994). The occurrence and seasonal changes in the isolation of Listeria spp. in shop bought foodstuffs, human faces, sewage and soil from urban sources. International Journal of Food Microbiology, 21, 325e334. MacGowan, A. P., O’Donaghue, K., Nicholls, S., Mclauchlin, J., Bennett, P. M., & Reeves, D. S. (1993). Typing of Listeria spp. by random amplified polymorphic DNA (RAPD) analysis. Journal of Medical Microbiology, 38, 322e327. Miettinen, M. K., Björkroth, K., & Korkeala, H. J. (1999). Characterization of Listeria monocytogenes from an ice cream plant by serotyping and pulsed-field gel electrophoresis. International Journal of Food Microbiology, 46, 187e192.

72

S. Keeratipibul, P. Techaruwichit / Food Control 27 (2012) 64e72

Niederhauser, Ch., Hofelein, Ch., Allmann, M., Burkhalter, P., Luthy, J., & Candrian, U. (1994). Random amplification of polymorphic bacterial DNA: evaluation of 11 oligonucleotides and application to food contaminated with Listeria monocytogenes. Journal of Applied Bacteriology, 77, 574e582. Norton, D. M., McCamey, M. A., Gall, K. L., Scarlett, J. M., Boor, K. J., & Wiedmann, M. (2001). Molecular studies on the ecology of Listeria monocytogenes in the smoked fish processing industry. Applied and Environmental Microbiology, 67(1), 198e205. Pradhan, A., Ivanek, R., Gröhn, Y. T., Geornaras, I., Sofos, J., & Wiedmann, M. (2009). Quantitative risk assessment for Listeria monocytogenes in selected categories of deli meats: impact of lactate and diacetate on listeriosis cases and deaths. Journal of Food Protection, 72(5), 978e989. Slade, P. J. (1992). Monitoring Listeria in the food production environment. I. Detection of Listeria in processing plants and isolation methodology. Food Research International, 25, 45e56.

Thai Broiler Processing Exporters Association. (2010). Thai chicken meat export [online]. Available from http://www.thaipoultry.org/STATISTIC /tabid/248/Default.aspx. Tompkin, R. B. (2002). Control of Listeria monocytogenes in the food-processing environment. Journal of Food Protection, 65, 709e725. Tompkin, R. B., Scott, V. N., Bernard, D. T., Sveum, W. H., & Gombas, K. S. (1999). Guidelines to prevent post-processing contamination from Listeria monocytogenes. Dairy, Food and Environmental Sanitation, 19, 551e552. Van de Elen, A. M. G., & Snijders, J. A. (1993). Criticals points in meat production lines regarding the introduction of Listeria monocytogenes. Veterinary Quarterly, 15, 143e145. Walker, S. J., Archer, P., & Banks, J. G. (1990). Growth of Listeria monocytogenes at refrigeration temperatures. Journal of Applied Microbiology, 68(2), 157e162. WHO/FAO. (2004). Risk assessment of Listeria monocytogenes in ready-to-eat foods: interpretative summary [online]. Available from http://www. fao.org/docrep/ 010/y5394e /y5394e00.htm.