Transactivation of the rat oxytocin and vasopressin promoters by nuclear hormone receptors

Regulatory Peptides, 45 (1993) 31-35

31

© 1993 Elsevier Science Publishers B.V. All rights reserved 0167-0115/93/$06.00

REGPEP 01349

Transactivation of the rat oxytocin and vasopressin promoters by nuclear hormone receptors J. Peter H. Burbach, Roger A.H. Adan, Joke J. Cox and Sofia Lopes da Silva Rudolf Magnus Institute, Department of Pharmacology, Utrecht University, Utrecht(The Netherlands)

Key words: Steroid hormone; Thyroid hormone; Retinoic acid; Estrogen; Gene regulation; Hormone response element

Introduction

Transactivation

The regulation of the oxytocin (OT) and vasopressin (VP) genes in the magnocellular neurons of the supraoptic (SON) and paraventricular nuclei (PVN) displays remarkable parallels. For instance, the levels of OT mRNA and VP mRNA increase similarly during postnatal development, hyperosmolality, pregnancy and lactation [ 1]. It is believed that the similarity in responsiveness resides in either common regulatory elements in the genes or in common neural or hormonal inputs of the OT and VP neurons [2]. Although there is no significant overall homology between the 5'-flanking regions of the OT and VP genes, both genes contain a number of TGACC motifs [3]. Such sequences are often part of response elements of nuclear hormone receptors. Steroid hormones have been implicated in the regulation of OT and VP systems [4]. We here summarize the results of experiments aimed to determine and compare the responsiveness of OT and VP genes to members of the steroid/thyroid hormone receptor superfamily.

Since cultured cells with abundant expression of the OT gene or VP gene are not available experiments were performed in heterologous expression systems, i.e., tumor cell lines without endogenous OT or VP gene expression that were transfected with OT or VP promoter-reporter gene constructs. Two types of cell lines were used: cell lines with endogenous hormone receptors, e.g., MCF-7 breast tumor cells containing the estrogen receptor (ER) and thyroid hormone receptors (TR) and P 19 embryocarcinoma (EC) cells containing retinoic acid receptors (RAR) and retinoid X receptors (RXR), or cell lines cotransfected with plasmids expressing nuclear hormone receptors. The activity of the rat OT promoter (nucleotides -361 to + 16) was stimulated by the ligand-activated ER, TR~ and RAR~ and/~ [5-7]. The human OT promoter was similarly responsive to these hormone receptors [6-9]. In P19 EC cells the response to estrogens was by far the strongest (approx. 200-300 fold) and to thyroid hormone the weakest (approx. 10-fold) when using the -361 tot + 16 region of the rat OT gene coupled to luciferase (pROLUC). The stimulation was about 10-fold when the endogenous

Correspondence to: J.P.H. Burbach, Rudolf Magnus Institute, Department of Pharmacology, Utrecht University, Vondellaan 6, 3521 GD Utrecht, The Netherlands.

32

ER and TR in MCF-7 cells or the endogenous RARa in P19 EC cells were activated [6,7]. Since the C O U P transcription factor (COUP-TF) is an orphan of the steroid/thyroid hormone receptor superfamily [10] and has been implicated in interaction with the bovine OT promoter [11 ], its effect on the activity of the OT promoter was assessed by cotransfection assays. While C O U P - T F I did not display intrinsic activity on the rat OT promoter ( - 3 6 1 or -172 to + 16), the stimulations by estrogens, thyroid hormone as well as RA were completely repressed by cotransfection of equimolar C O U P - T F I expression plasmid. The estrogen response was still suppressed to 5 0 ~ when the C O U P - T F expression was used in a 1 to 100 ratio to the ER expression plasmid. The activity of the rat VP promoter (2 kb and 1 kb upstream region) was suppressed for about 7 0 ~ by the ligand-activated estrogen receptor in receptorcotransfected P19 EC cells and there was no significant effect of thyroid hormone in this system [2]. Similar results were obtained for the human VP promoter (nucleotides -175 to + 44) [2].

"I|| "111 CCC~¥T i GAGCTCAGGTCATTAGCTC.~GGCGGTGA

>

~.,

"148 "

<

Since testosterone is the hormone that causes sexually dimorphic expression of the VP gene in the bed nucleus of the stria terminalis and the amygdala [ 12] the responsiveness of the rat and human VP promoters to androgens was also tested. In P19 EC cells cotransfected with an expression vector of the human androgen receptor (AR) testosterone nor the synthetic androgen RU 1881 in the concentration range o f 1 0 - ] l tO 10 - 6 M stimulated VP promoter activity, but rather a suppression of 70~o maximal was found [2].

Hormone-dependent enhancers in the OT gene By step-wise deleting regions from the 5'-end of the rat OT gene elements conferring responses to hormones were mapped [ 6,7,13 ]. These experiments showed that deleting the region between nucleotides -172 and -148 resulted in complete loss of thyroid hormone responsiveness and most of the responsiveness to estrogen and RA. The latter two ligands were still able to stimulate the truncated promoter weakly

"11t TGCAAATGAAGGGCCTGCTTCTAAACAGTG~"

--T7 .CCAAC~GACCTGGCTGTGAC~G TCATGCA

<

4X

< SX

RAR 1ox

TR

:......... 20X

8X

ER composite hormone response element

~)

AQGTCA MOTIF

Fig. 1. Hormone-dependent enhancers of the rat O T promoter. The sequence of nucleotides -198 to - 6 8 of the rat OT promoter is shown with the position of the start sites of the deletion mutants indicated with sequence numbers. The A G G T C A hexamer [ 15] is indicated by the arrow. The approximate fold inductions by each enhancer motif for transactivation by RAR, T R and ER are shown above the boxes that indicate the position of the enhancers.

33

through proximal elements between nucleotides -148 to -77. Thus, a response element sensitive to three different hormones is located in the - 1 7 2 / - 148 region of the rat OT gene (Fig. 1). These findings agree with the function of this region as a estrogen response element (ERE) on a heterologous promoter [ 14 ] and the properties of the corresponding element in the human OT gene [8,9]. The interaction of nuclear hormone receptors with the 5'-flanking region of the rat OT gene was analyzed in band shift assays and by footprinting. Extracts enriched in ER, TRy, RARfl and C O U P - T F I were used (Refs. 6,7, and unpublished data). The - 1 7 2 / - 148 element was the only region to which all three receptors bound. Two additional binding sites for RARfl and one for the ER were located in the proximal region of the OT gene. These binding sites agree with the hormone-dependent enhancers mapped by deletion analysis (Fig. 1). Binding of TR~ was confined to the - 1 7 2 / - 148 hormone response element. Interestingly, the region between nucleotides -195 and -172, which contributes to the responsiveness to thyroid hormone, did not bind the TR. C O U P - T F I also bound to the - 1 7 2 / - 148 element.

The composite hormone response element of the OT gene The integration of responsiveness to estrogens, thyroid hormone and RA within a single element is a unique feature of the rat and human OT genes. Thus, the - 1 7 2 / - 148 element of the OT gene may be considered as a composite hormone response element. The - 1 7 2 / - 148 element is composed of three T G A C C motifs (Fig. 2). Two of them form an inverted repeat with a spacing of three nucleotides that differs in one nucleotide from the palindromic, canonical ERE. Another combination forms a direct repeat (DR) with no spacing. This is the DR0 configuration according to Umesono et al. [15] who defined optimal response elements for TR, RAR and vitamine D 3 receptors by varying the spacing be-

-166

RAT OXYTOCIN

GENE

-156

G G T G A C C TTGACCC *¢

RAT VASOPRESSIN

GENE

(

*

GCTGACCTTGACCT -961

-956

Fig. 2. Direct repeats in the 5'-flanking regions of the rat oxytocin and vasopressin genes. The composite hormone response element of the rat oxytocin gene consists of an ERE (in bold), that is a palindromic TGACC repeat with spacing of three nucleotides [4], and the direct repeat of AGGTCA with spacing zero, DR0 (arrows). A comparison of a region in the rat vasopressin promoter with a perfect DR0 element is made. Sequences are from [3]. * represents a difference in the element between the two genes.

tween direct repeats of the hexamer A G G T C A as DR3, DR4 and DR5, respectively. However, mutagenesis of the - 1 7 2 / - 1 4 8 element could only partly distinguish between the two configurations [7]. Mutations in the palindrome of the ERE diminished the response to estrogen. However, estrogen responsiveness was also reduced by mutations in the spacing between the two half-sites of the palindrome. Likewise, mutations just outside the DR0 also reduced the responses to thyroid hormone and RA. Furthermore, mutations were found that distinguished between the responsiveness to thyroid hormone and RA. When the T G A C C T motif in the centre of the - 1 7 2 / - 148 element was mutated into TGgCCT or TGgCCa, thyroid hormone transactivation was not or only slightly affected, while the response to RA was reduced to the response of the construct lacking the - 1 7 2 / - 148 region.

Discussion The survey of the transactivation of OT and VP promoters by nuclear hormone receptors thus far did not reveal a common responsiveness to the tested hormone receptors, despite the presence of two closely related DR0 elements in the two genes (Fig. 2). In the rat OT gene nucleotides -166 to -155 are a DR0 with one mismatch. It is part of a composite hormone response element that integrates responses to estrogens, thyroid hormone and RA.

34 This element combines the D R 0 configuration with an E R E . A c t i v a t i o n as well as repression o f the O T gene can be conferred by this element. The repression o f h o r m o n e inductions by C O U P - T F I illustrates t h a t the presence o f such a factor can result in hormone-insensitivity even in the presence o f the app r o p r i a t e receptors. T h e inability o f the rat VP p r o m o t e r to r e s p o n d to the three h o r m o n e receptors acting on the O T gene a p p e a r e d a surprising result, since examination o f the 5'-flanking region o f the rat VP gene revealed a perfect D R 0 element f o r m e d by nucleotides - 9 6 1 to - 9 5 0 (Fig. 2) [3]. T h e r e a s o n for the lack o f r e s p o n siveness m a y reside in the sequence context o f this element. It has indeed been shown that the - 1 7 2 / - 148 element alone is an inactive or negative R A r e s p o n s e element and that p r o x i m a l T G A C C motifs are required for the full, positive R A r e s p o n s e [16]. It will be o f interest to examine the D R 0 element in the VP p r o m o t e r in m o r e detail with respect to the surrounding sequences a n d the possiblity that other factors act on this gene through this element. A t present it is n o t k n o w n which e n d o g e n o u s factors in O T or VP n e u r o n s act on this type o f element. T h e c o m p o s i t e h o r m o n e r e s p o n s e element in the O T gene m a y be a m o r e optimal element for interaction with other m e m b e r s o f the nuclear h o r m o n e r e c e p t o r family t h a n the T R s a n d R A R s , that prefer D R 3 a n d D R 4 elements, or ER. T h e option that such factors do n o t discriminate between the D R 0 elements in the VP a n d O T genes a n d thus contribute to the parallels in in vivo regulation is still open.

Acknowledgements

W e are grateful to P. C h a m b o n , S. Green, R . M . Evans, C.C. T h o m p s o n , M . G . Parker, M. Stunnenberg, A . O . B r i n k m a n a n d S.Y. Tsai for providing expression vectors a n d nuclear extracts. R . A . H . A d a n is s u p p o r t e d by a grant from the N e t h e r l a n d s O r g a n i z a t i o n for Scientific R e s e a r c h ( N W O ) , project No. 900-546-065.

References

1 Burbach, J.P.H. and Wiegant, V.M., Gene expression, biosynthesis and processing of proopiomelanocortin peptides and vasopressin. In D. De Wied (Ed.), Neuropeptides: Basics and Perspectives. Elsevier, Amsterdam, 1990, pp. 45-103. 2 Adan, R.A.H. and Burbach, J.P.H., Regulation ofvasopressin and oxytocin gene expression by estrogen and thyroid hormones, Prog. Brain Res., 92 (1992) 127-136. 3 Schmitz, E., Mohr, E. and Richter, D., Rat vasopressin and oxytocin genes are linked by a long interspersed repeated DNA element (LINE): sequence and transcriptional analysis of LINE, DNA Cell Biol., 10 (1991) 81-91. 4 Beato, M., Gene regulation by steroid hormones, Cell, 56 (1989) 335-344. 5 Burbach, J.P.H., Adan, R.A.H., Van Tol, H.H.M., Verbeeck, M.A.E., Axelson, J.F., Van Leeuwen, F.W., Beekman, J.M. and Ab, G., Regulation of the rat oxytocin gene by estradiol, J. Neuroendocrinol., 2 (1990) 633-639. 6 Adan, R.A.H., Cox, J.J., Van Kats, J.P. and Burbach, J.P.H., Thyroid hormone regulates the oxytocin gene, J. Biol. Chem., 267 (1991) 3771-3777. 7 Adan, R.A.H., Oxytocin and vasopressin genes: transcriptional regulation and signal transduction, Doctoral Thesis, Utrecht University, 1992. 8 Richard, S. and Zingg, H.H., The human oxytocin gene promoter is regulated by estrogens, J. Biol. Chem., 265 (1990) 6098-6103. 9 Richard, S. and Zingg, H.H., Identification of a retinoic acid response element in the human oxytocin promoter, J. Biol. Chem., 266 (1991) 21428-21433. 10 Wang, L.-H., Tsai, S.Y., Cook, R.G., Beattle, W.G., Tsai, M.-J. and O'Malley, B.W., COUP transcription factor is a member of the steroid receptor superfamily, Nature, 340 (1989) 163-166. 11 Walther, N., Wehrenberg, U., Brackmann, B. and Ivell, R., Mapping of the bovine oxytocin gene control region: identification of binding sites for luteal nuclear proteins in the 5' non-coding region of the gene, J. Neuroendocrinol., 3 (1991) 539-549. 12 De Vries, G.J., Best, W. and Sluiter, A.A., The influence of gonadal steroids on the development of a sex difference in the vasopressinergic innervation of the brain, Dev. Brain Res., 8 (1983) 377-380. 13 Adan, R.A.H., Walther, N., Cox, J.J. and Burbach, J.P.H., Comparison of the estrogen responsiveness of the rat and bovine oxytocin gene promoters, Biochem. Biophys. Res. Commun., 175 (1991) 117-122. 14 Mohr, E. and Schmitz, E., Functional characterization of estrogen and glucocorticoid responsive elements in the rat oxytocin gene, Mol. Brain Res., 9 (1991) 293-298.

35 15 Umesono, K., Murakami, K.K., Thompson, C.C. and Evans, R.M., Direct repeats as selective elements for the thyroid hormone, retinoic acid, and vitamine D receptors, Cell, 65 (1991 ) 1255-1266. 16 Lipkin, S.M., Nelson, C.A., Glass, C.K., Rosenfeld, M.G., A

negative retinoic acid response element in the rat oxytocin promoter restricts transcriptional stimulation by heterologous transactivation domains, Proc. Natl. Acad. Sci. USA, 89 (1992) 1209-1213.