Transcript splicing is essential for functional Histoplasma capsulatum URA5 expression

Gene 230 (1999) 181–185

Transcript splicing is essential for functional Histoplasma capsulatum URA5 expression Diane M. Retallack, Jon P. Woods * University of Wisconsin Medical School, Department of Medical Microbiology and Immunology, Madison, WI, USA Received 11 November 1998; received in revised form 29 January 1999; accepted 31 January 1999; Received by C.M. Kane

Abstract The isolation of auxotrophic markers is important for molecular genetic studies of the dimorphic fungus Histoplasma capsulatum. We have isolated a UV-induced mutant of H. capsulatum, resulting in nonreverting uracil auxotrophy due to a mutation in the URA5 gene. In this study, we show that this mutation is a GG to TA conversion bordering the 5∞ donor splice site of intron 2. The mutation results in the lack of splicing of intron 2 from the URA5 transcript, and subsequently premature termination of the peptide. This study is the first showing that consensus Group II intron sequences are both utilized and essential for functional expression of a gene in H. capsulatum. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Filamentous fungi; mRNA processing; Uracil auxotrophy; Yeast

1. Introduction The thermally dimorphic fungus Histoplasma capsulatum, which is endemic to the Mississippi and Ohio River valleys, is the causative agent of the most common systemic mycosis in the United States, histoplasmosis (Goodwin and Des Prez, 1978; Wheat, 1988; Eissenberg and Goldman, 1991). Infection with H. capsulatum most often manifests itself as a mild respiratory infection with flu-like symptoms, but can lead to severe systemic infection and even death in immunocompromised hosts such as AIDS or cancer patients ( Kauffman et al., 1978; Graybill, 1988; Johnson et al., 1988; Chaturvedi et al., 1995; Wheat, 1995). H. capsulatum exists as a saprophytic mold in the soil, or at room temperature in the laboratory, and as a yeast in the host, or at 37°C in the laboratory. Upon inhalation of the mold form the

organism enters pulmonary macrophages where it converts to the yeast form, replicating inside the phagolysosome and eventually lysing the cell ( Kimberlin et al., 1981; Newman et al., 1981; Newman et al., 1990). We have recently shown that expression of a functional URA5 gene is essential for growth and virulence of H. capsulatum in both murine and human cell lines and mice (Retallack et al., 1999). In this study, using RT-PCR and sequence analyses, we characterize a UV-induced mutant of a virulent H. capsulatum strain, which renders the fungus uracil auxotrophic, and consequently avirulent. This mutation, a 2 bp conversion bordering the donor site of URA5 intron 2, results in a lack of complete processing of the URA5 transcript and, subsequently, premature translation termination.

2. Materials and methods Abbreviations: bp, base pair; cDNA, complement deoxyribonucleic acid; DNA, deoxyribonucleic acid; dNTPs, an equimolar mixture of deoxyadenosine, deoxyguanosine, deoxycytosine and deoxythymidine triphosphate; M, molar; mg, microgram; ml, microliter; ml, milliliter; mM, millimolar; min, minutes; PCR, polymerase chain reaction; RNA, ribonucleic acid; TE, 10 mM Tris base 1 mM sodium ethylenediaminetetracetate pH 8.0; RT-PCR, reverse transcription polymerase chain reaction; s, seconds; UV, ultraviolet. * Corresponding author. Tel.: +1 608-265-6292; fax: +1 608-265-6717. E-mail address: [email protected] (J.P. Woods)

2.1. Fungal and bacterial strains used H. capsulatum strains G217B and G217Bura5-23 have been previously described ( Woods et al., 1998). The latter strain, generated by UV mutagenesis and 5-fluoroorotic acid selection ( Worsham and Goldman, 1988), is a uracil auxotroph that does not show detectable reversion (<10−9) to prototrophy. G217Bura5-23 shows an absolute requirement for exogenous uracil for

0378-1119/99/$ – see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 07 1 - 2

182

D.M. Retallack, J.P. Woods / Gene 230 (1999) 181–185

growth in either the yeast (37°C ) or mycelial (25°C ) form. Escherichia coli strain DH5a was obtained from Gibco-BRL.

resultant plasmids were transformed into E. coli strain DH5a. 2.4. Sequence analysis

2.2. Nucleic acid preparation H. capsulatum genomic DNA was prepared using Qiagen genomic DNA preparation kit with a few modifications. 20 ml of H. capsulatum late log/stationary phase culture (3–4 days) was pelleted and washed with 4 ml TE, then resuspended in 2 ml buffer Y1. Spheroplasts were prepared by adding 134 ml of 100 mg/ml Zymolyase 20T (Seikagaku Corp.)+ 100 mg/ml Novozyme (Calbiochem) (suspended in buffer containing 1 M sorbitol, 60 mM EDTA, 100 mM sodium citrate, pH 5.9) and 200 ml b-glucuronidase (Sigma) to the resuspended cells, and incubating for 1 h at 37°C. Spheroplasts were pelleted at 1400g and resuspended in 150 ml TE. To this, 4 ml Buffer G2, 200 ml 10 mg/ml proteinase K (Boerhinger Mannheim) and 80 ml 10 mg/ml RNase A (Sigma) were added, and incubated at 50°C for 1 h. After pelleting at 1400g, the supernatant was loaded onto a pre-equilibrated Qiagen tip-100, and DNA was isolated according to the manufacturer’s protocol. Total H. capsulatum RNA was prepared as previously described ( Woods et al., 1998). Plasmids were prepared for sequence analysis using the Qiaprep 8 miniprep kit according to the manufacturer’s protocol.

Both strands of cloned PCR products were sequenced using the BigDye automated sequencing kit (Perkin Elmer ABI Prism) and either the T3 or T7 primer with the following cycling profile: [94°C 2 min (94°C 20 s, 45°C 30 s, 60°C 2 min)×35, 72°C 7 min]. Products were purified using Autoseq G-50 columns (Pharmacia Biotech) according to manufacturer’s protocol. Automated sequencing and sequence analyses were performed by the University of Wisconsin Biotechnology Center Sequencing Facility using Perkin Elmer ABI Prism hardware and software. Sequence alignment was performed using the MacVector software ( Eastman Kodak).

3. Results and discussion To identify the nature of the nonreverting UVinduced URA5 mutation resulting in the uracil auxotro-

2.3. Molecular techniques Primer extension analysis of URA5 was performed using total RNA as previously described ( Woods et al., 1998). RT-PCR was performed as described below. Total H. capsulatum RNA was reverse transcribed to generate cDNA using Superscript II (BRL) according to the manufacturer’s protocol. The intron region of the URA5 gene from resultant cDNA, and also from genomic DNA, was amplified via PCR using primers 5∞ACGACTTTCCTCGAGTCCTG [nt 46–65 of published URA5 sequence ( Woods et al., 1998)] and 5∞CGGGTCGACGGGGATCCCACGATGCTCCC [SalI restriction site, then nt 548–527 of the published URA5 sequence ( Woods et al., 1998)]. 1 ml of cDNA or genomic DNA was used in a reaction with a final concentration of 200 mM dNTPs, 1 mM each primer, 1×Amplitaq buffer (Perkin Elmer) and one unit of Amplitaq and cycled as follows: [94°C 2 min, (94°C 30 s; 57°C 30 s; 72°C 30 s)×25, 72°C 10 min], using a Perkin Elmer 9600 thermal cycler. PCR products were resolved on a 1.5% Seakem agarose (FMC ) gel and the DNA from each band was extracted using the Prep-a-Gene gel extraction kit (Biorad). Following digestion of the PCR products with BamHI and XhoI, the products were ligated to BamHI and XhoI digested pBluescript (Stratagene). The

Fig. 1. RT-PCR analysis of the URA5 intron region. (A) PCR products from genomic or cDNA templates amplified using primers upstream of intron 1 and downstream of intron 2 were separated on a 1.5% agarose gel, then visualized by ethidium bromide staining. The relative mobility of Hae III digested phage wX174 (expressed in bp) (New England Biolabs) is shown on the left. Templates used are as follows: lane1, G217B genomic DNA; lane2, G217B cDNA; lane 3, G217Bura5-23 genomic DNA; lane 4, G217Bura5-23 cDNA. (B) A schematic representation of the URA5 gene (not to scale) is shown. Arrows indicate position of the primers used for RT-PCR, and dark boxes show the positions of the introns, with the size of the intron indicated above each box. The asterisks indicate translational stop signals that would be in frame if either intron alone were unspliced. The XhoI and BamHI sites used to clone amplified fragments are also shown.

D.M. Retallack, J.P. Woods / Gene 230 (1999) 181–185

183

Fig. 2. Sequence comparison of the URA5 intron region from H. capsulatum strains G217B and G217Bura5-23. Sequence alignment of the amplified URA5 intron region from G217B genomic DNA, G217Bura5-23 genomic DNA and G217Bura5-23 cDNA is shown. Single underlined, italicized, lowercase characters indicate the spliced introns of G217B. The 2 bp mutation in G217Bura5-23 is indicated by the lowercase, double underlined characters. These three sequences are identical except for this 2 bp change.

184

D.M. Retallack, J.P. Woods / Gene 230 (1999) 181–185

phy of H. capsulatum strain G217Bura5-23, we examined the first step in gene expression, transcription. Primer extension and RT-PCR analyses were used to determine first, whether a stable URA5 transcript is present, and second, whether this transcript is properly processed in the mutant strain G217Bura5-23. Identical-sized primer extension products were obtained with total RNA prepared either from wild type G217B or from the uracil auxotrophic strain, G217Bura5-23, revealing a single transcriptional start site 84 nucleotides upstream of the URA5 translational start site in both strains (data not shown). These results indicate that the transcriptional start site as determined for the published G184ASURA5 gene ( Woods et al., 1998) is also utilized by both G217B and G217Bura5-23. We next employed RT-PCR analysis to determine whether the two introns of the URA5 transcript are processed correctly in G217Bura5-23. cDNA was produced using total RNA prepared from either G217Bura5-23 or G217B as template. Using these cDNAs as templates for PCR, a portion of the URA5 coding region was amplified using specific primers as depicted in Fig. 1B. Genomic DNA prepared from each strain was also used as a positive control template for PCR analysis. The expected product size using genomic DNA as template is 519 bp, based on the previously reported sequence of URA5 cloned from the strain G184AS ( Woods et al., 1998). Since the amplified region spans the two intron sequences of URA5, the expected product size using cDNA as template is 374 bp [also based on the published G184AS sequence ( Woods et al., 1998)]. As seen in Fig. 1A, products of the expected size were detected from G217B genomic and cDNA templates ( lanes 1 and 2 respectively). Although the major band produced using G217B cDNA as template was the 374 bp band, we are able to detect less-intense bands indicating the presence of small amounts of transcript containing either one or two introns ( Fig. 1A, lane 2). However, no completely processed, 374 bp product is detected following PCR amplification using G217Bura5-23 cDNA as template. In Fig. 1A, only a 519 bp product is observed with either G217Bura5-23 genomic DNA or cDNA as template ( lanes 3 and 4 respectively), indicating the absence of processing of either URA5 intron. In some PCR reactions using G217Bura5-23 cDNA, an intermediate band resulting from partially processed transcript containing only one intron could be detected (data not shown). We have never observed removal of both introns at the level of detection of our RT-PCR method, but since this technique is nonquantitative, we cannot exclude the occurrence of an undetectable amount of fully spliced transcript. The deficiency in processing may be due to either a mutation in the RNA processing machinery, or a mutation in the processing signals within the URA5 coding region. A mutation in the processing machinery is

unlikely, since most sequenced H. capsulatum genes contain introns and so such a mutation would likely be lethal. Moreover, proper splicing of the hsp82 gene was detectable by RT-PCR in both G217B and G217Bura5-23 (data not shown). Sequence analysis was performed to determine whether a mutation in processing signals of the URA5 intron region of G217Bura5-23 is the cause of the incorrect processing. To facilitate sequencing, the PCR products were cloned into pBluescript as described in Section 2. The results of the sequence analyses are shown in Fig. 2. The sequence of the 519 bp product from G217Bura5-23 cDNA is identical to that of G217Bura5-23 genomic DNA, again indicating that neither intron is processed. Comparison of these sequences with that of the amplified product from G217B genomic DNA revealed a 2 bp conversion (GG to TA) that alters the conserved 5∞ splice site of intron 2, a G to A change at position 1. This mutation most likely results in the inclusion of intron 2. Retention of intron 2 will result in premature translation termination as indicated in Fig. 1B. Mutations in the 5∞ donor sites of introns often result in exon skipping (in higher eukaryotes), a lack of splicing resulting in inclusion of the intron, or activation of a cryptic splice site resulting in alternate splicing [for reviews, see (Parker and Patterson, 1987; Guthrie, 1991; Ruby and Abelson, 1991; Adams et al., 1996)]. In fact, similar G to A changes at position 1 of the 5∞ splice site of Saccharomyces cerevisiae actin (Fouser and Friesen, 1986; Vijayraghavan et al., 1986) and CYH2m (Newman et al., 1985) introns also result in reduced, incomplete, or no splicing. Although it has been shown previously that putative group II intron regions in H. capsulatum are processed (Minchiotti et al., 1991; Woods et al., 1998), this is the first demonstration, of which we are aware, that consensus group II 5∞, and presumably 3∞, splicing signals are essential for mRNA processing and functional gene expression to occur in this dimorphic fungus.

Acknowledgements This work was supported by Public Health Service Grant HL55949 from the National Heart Lung and Blood Institute. D.M.R. was supported by National Research Service Award F32 AI09720 from the National Institute of Allergy and Infectious Diseases, and a Basic Biomedical Research Grant from the Life and Health Insurance Medical Research Fund.

References Adams, M.D., Rudner, D.Z., Rio, D.C., 1996. Biochemistry and regulation of pre-mRNA splicing. Curr. Opin. Cell Biol. 8, 331–339.

D.M. Retallack, J.P. Woods / Gene 230 (1999) 181–185 Chaturvedi, S., Frame, P., Newman, S.L., 1995. Macrophages from human immunodeficiency virus-positive persons are defective in host defense against Histoplasma capsulatum. J. Infect. Dis. 171, 320–327. Eissenberg, L.G., Goldman, W.E., 1991. Histoplasma variation and adaptive strategies for parasitism: new perspectives on histoplasmosis. Clin. Micro. Rev. 4, 411–421. Fouser, L.A., Friesen, J.D., 1986. Mutations in a yeast intron demonstrate the importance of specific conserved nucleotides for the two stages of nuclear mRNA splicing. Cell 45, 81–93. Goodwin Jr, R.A., Des Prez, R.M., 1978. Histoplasmosis. Am. Rev. Resp. Dis. 117, 929–956. Graybill, J.R., 1988. Histoplasmosis and AIDS. J. Infect. Dis. 158, 623–626. Guthrie, C., 1991. Messenger RNA splicing in yeast: clues to why the spliceosome is a ribonucleotide. Science 253, 157–163. Johnson, P.C., Khardori, N., Najjar, A.F., Butt, F., Mansell, P.W.A., Sarosi, G.A., 1988. Progressive disseminated histoplasmosis in patients with acquired immunodeficiency syndrome. Am. J. Med. 85, 152–157. Kauffman, C.A., Isreal, K.S., Smith, J.W., White, A.C., Schwartz, J., Brooks, G.F., 1978. Histoplasmosis in immunosuppressed patients. Am. J. Med. 64, 923–932. Kimberlin, C.L., Hairiri, A.R., Hempel, H.O., Goodman, N.L., 1981. Interactions between Histoplasma capsulatum and macrophages from normal and treated mice: comparison of mycelial and yeast phases in alveolar macrophages. Infect. Immun. 34, 6–10. Minchiotti, G., Gargano, S., Maresca, B., 1991. The intron-containing hsp82 gene of the dimorphic pathogenic fungus Histoplasma capsulatum is properly spliced in severe heat shock conditions. Mol. Cell Biol. 11, 5624–5630. Newman, A.J., Lin, R.J., Cheng, S.C., Abelson, J., 1985. Molecular consequences of specific intron mutations on yeast mRNA splicing in vivo and in vitro. Cell 42, 335–344.

185

Newman, S.L., Gootee, L., Morris, R., Bullock, W.E., 1981. Digestion of Histoplasma capsulatum yeasts by human macrophages. J. Immunol. 149, 574–580. Newman, S.L., Bucher, C., Rhodes, J., Bullock, W.E., 1990. Phagocytosis of Histoplasma capsulatum yeasts and microconidia by human cultured macrophages and alveolar macrophages. Cellular cytoskeleton required for attachment and ingestion. J. Clin. Invest. 85, 223–230. Parker, R., Patterson, B., 1987. Architecture of fungal introns: implications for spliceosome assembly. In: Inouye, M. Dudock ( Eds.), Molecular Biology of RNA; New Perspectives. Academic Press, San Diego, CA, pp. 133–149. Retallack, D.R., Heinecke, E.L., Gibbons, R., Deepe Jr, G.S., Woods, J.P., 1999. The URA5 gene is necessary for Histoplasma capsulatum growth during infection of mouse and human cells. Infect. Immun. 67, 624–629. Ruby, S.W., Abelson, J., 1991. Pre-mRNA splicing in yeast. TIG 7, 79–85. Vijayraghavan, U., Parker, R., Tamm, J., Iimura, Y., Rossi, J., Abelson, J., Guthrie, C., 1986. Mutations in conserved intron sequences affect multiple steps in the yeast splicing pathway, particularly assembly of the spliceosome. EMBO 5, 1683–1695. Wheat, L.J., 1988. Histoplasmosis. Infect. Dis. Clin. N. Am. 2, 841–859. Wheat, L.J., 1995. Endemic mycosis in AIDS: a clinical review. Clin. Micro. Rev. 8, 146–159. Woods, J.P., Retallack, D.M., Heinecke, E.L., Goldman, W.E., 1998. Rare homologous targeting in Histoplasma capsulatum: disruption of the URA5 gene by allelic replacement. J. Bacteriol. 180, Hc 5135–5143. Worsham, P.L., Goldman, W.E., 1988. Selection and characterization of ura5 mutants of Histoplasma capsulatum. Mol. Gen. Genet. 214, 348–352.