Daughterless drives expression of α integrin ina-1 during DTC migration in C. elegans

Gene 568 (2015) 220–226

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Short communication

Transcription factor hlh-2/E/Daughterless drives expression of α integrin ina-1 during DTC migration in C. elegans Christopher M. Meighan ⁎, Allison P. Kann, Emily R. Egress Christopher Newport University, Newport News, VA 23606, USA

a r t i c l e

i n f o

Article history: Received 12 March 2015 Received in revised form 8 May 2015 Accepted 12 May 2015 Available online 14 May 2015 Keywords: C. elegans Integrins Gonadogenesis ina-1 hlh-2 Transcription regulation Cell migration

a b s t r a c t Integrins are involved in a vast number of cell behaviors due to their roles in adhesion and signaling. The regulation of integrin expression is of particular interest as a mechanism to drive developmental events and for the role of altered integrin expression profiles in cancer. Dynamic regulation of the expression of integrin receptors is required for the migration of the distal tip cell (DTC) during gonadogenesis in Caenorhabditis elegans. α integrin ina-1 is required for DTC motility, yet is up-regulated by an unknown mechanism. Analysis of the promoter for α integrin ina-1 identified two E-box sequences that are required for ina-1 expression in the DTC. Knockdown of transcription factor hlh-2, an established E-box binding partner and ortholog of E/Daughterless, prevented expression of a transcriptional fusion of the ina-1 promoter to RFP and blocked DTC migration. Similarly, knockdown of hlh-2 also prevented expression of a translational fusion of the genomic ina-1 gene to GFP while blocking DTC migration. Knockdown of HLH-2 binding partner MIG-24 also reduced ina-1 expression and DTC migration. Overall, these results show that the transcription factor hlh-2 is required for up-regulation of ina-1 at the onset of DTC migration. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Integrins are αβ heterodimeric transmembrane receptors that bind the extracellular matrix and facilitate interactions with the actin cytoskeleton. Integrin signaling has a role in many cell behavior events including cell division, survival, differentiation, adhesion, and migration (Hynes, 2002; Legate et al., 2009). The alteration of integrin expression is a powerful mechanism to alter cell behavior. In mice, the expression of 9 different α integrins is varied during cerebral cortex development (Schmid and Anton, 2003). In fruit flies, integrin βPS expression is used to regulate adhesion during wing development (Egoz-Matia et al., 2011). Improper integrin expression has been associated with tumor progression. For example, changes in the expression of integrin α3 have been noted in the conversion of mesothelial hyperplasia to malignant pleural mesothelioma and in lung cancer (Alì et al., 2013; Boelens et al., 2007). α3β1 signaling has multiple roles in the initiation and progression of breast cancer and reduced survival was seen in human breast cancer cases when α3 and its extracellular matrix binding partner laminin α5 were both overexpressed (Cagnet et al., 2014; Zhou et al., 2014). These findings emphasize the importance of determining the mechanisms capable of regulating integrin expression.

Abbreviations: DTC, distal tip cell; bHLH, basic helix–loop–helix. ⁎ Corresponding author. E-mail addresses: [email protected] (C.M. Meighan), [email protected] (A.P. Kann), [email protected] (E.R. Egress).

http://dx.doi.org/10.1016/j.gene.2015.05.030 0378-1119/© 2015 Elsevier B.V. All rights reserved.

The Caenorhabditis elegans ortholog of integrin α3 is ina-1 (Baum and Garriga, 1997). Our work in C. elegans showed that the downregulation of α integrin ina-1 was a key process in stopping the migration of the distal tip cell (DTC), a leader cell whose migration dictates the shape of the C. elegans hermaphrodite gonad (Meighan and Schwarzbauer, 2007). The down-regulation of ina-1 was lost when vab-3, the C. elegans ortholog of Pax6, was disrupted by mutation or RNAi, resulting in prolonged cell migration. ina-1 was also shown to be required for the act of cell motility during cell migration, with expression overlapping the duration of migration. Interestingly, vab-3 also drives the up-regulation of α integrin pat-2 during the late stages of DTC migration (Meighan and Schwarzbauer, 2007). Despite the requirement for ina-1 during migration and the established regulation of pat-2, the basis of ina-1 up-regulation is unknown. In addition to ina-1, three other key genes required for DTC function are expressed at the initiation of migration. gon-1 is a matrix metalloprotease required for proper DTC migration and gonad shape, the loss of gon-1 prevents DTC migration (Blelloch and Kimble, 1999; Blelloch et al., 1999). Similarly, the loss of ppn-1/papilin, an extracellular matrix protein, also prevents DTC migration (Cram et al., 2006). In addition to leader cell function during migration, the DTC also provides a niche environment to maintain germ cells in a mitotic state (Kimble and White, 1981). This activity is driven by lag-2 an ortholog of the Notch ligand Delta (Henderson et al., 1994; Tax et al., 1994). gon-1 expression, ppn-1 expression, and lag-2 expression in the DTC are all controlled by basic helix–loop–helix (bHLH) transcription factor hlh-2, an ortholog of mammalian transcription factor E and Daughterless in

C.M. Meighan et al. / Gene 568 (2015) 220–226

Drosophila melanogaster (Krause et al., 1997; Tamai and Nishiwaki, 2007; Cram et al., 2006; Chesney et al., 2009). Here we show that the transcription factor hlh-2 is responsible for ina-1 up-regulation during DTC migration. 2. Results 2.1. A 400 bp region of the ina-1 promoter is sufficient for DTC expression of ina-1 DTCs begin their migration from the gonad primordium on the ventral surface of the body cavity. Migration occurs along the ventral surface away from the primordium, with one DTC moving toward the

221

anterior and the other DTC moving toward the posterior. The DTCs then turn and migrate to the dorsal surface, where they turn back toward the middle of the nematode body and migrate to positions on the dorsal surface across from the original primordium. As the DTC migrates, the germ cells create a gonad arm that effectively traces the path of migration (Fig. 1A). α integrin ina-1 is required for motility during DTC migration. Prolonged expression of ina-1 due to a loss of function in transcription factor vab-3 results in excessive DTC migration (Meighan and Schwarzbauer, 2007). ina-1 expression is documented at the onset of migration, yet the transcription factors directing expression are unknown. In order to determine candidate transcription factors for ina-1 regulation, the minimal ina-1 promoter required for gene expression was mapped using

Fig. 1. 400 bp of ina-1 promoter is sufficient for GFP expression in the DTC. (A) DTC migration in the anterior of the nematode body. DTC migration starts at the vulva and moves along the ventral surface of the nematode body cavity. The DTC then moves to the dorsal surface where it turns again to migrate back to the mid-region of the nematode body. JE1111, ina-1p::RFP, has normal DTC migration along the dorsal surface of the nematode (A) and expression of RFP (B). ina-1p1000::GFP (C), ina-1p400::GFP (E), and ina-1p336::GFP (G) fusions of the ina-1 promoter to GFP all have DTC migration on the dorsal surface. Ina-1p1000::GFP (D) and ina-1p400::GFP (F) fusions have GFP expression. (H) ina-1p336::GFP has no GFP expression. A schematic of each transgene appears to the left of the related images; lines represent the ina-1 promoter, boxes represent the RFP or GFP gene as indicated. Dashed lines outline the gonad arm and arrows point to the DTCs in each image. Anterior is to the left. The ventral gonad arm was not outlined in F and H for clarity. Scale bar, 25 μm.

222

C.M. Meighan et al. / Gene 568 (2015) 220–226

ina-1 promoters of various lengths fused to the RFP or GFP gene (Fig. 1). A 5 kb region of the ina-1 promoter fused to RFP, strain JE1111, was previously established as an accurate marker for ina-1 expression (Meighan and Schwarzbauer, 2007). In addition to this strain, several lines were created using fusion PCR to connect the ina-1 promoter to the GFP gene. ina-1p1000::GFP connected 948 bp of ina-1 promoter sequence upstream of the ina-1 translational start site to the GFP gene. ina-1p400::GFP connected 410 bp of ina-1 upstream sequence to GFP. ina-1p336::GFP connected 336 bp of ina-1 upstream sequence to GFP. These fusions were used to create at least 3 independent lines by injection into N2 nematodes then were evaluated for transgene expression during DTC migration. Strain JE1111 had RFP expression in the DTC as expected (Fig. 1A and B). ina-1p1000::GFP and ina-1p400::GFP had GFP expression in 90.9 ± 5.1% (n = 140) and 94.1 ± 3.9% (n = 237) of DTCs respectively (Fig. 1C–F, Table 1). However, ina-1p336::GFP had GFP expression in only 18.7 ± 5.4% (n = 209) of DTCs (Fig. 1G and H, Table 1). This indicated that the key region of the promoter controlling DTC expression of ina-1 was between 400 bp and 336 bp from the start site of translation. 2.2. E-box sites in the ina-1 promoter are required for DTC expression of ina-1 Prior studies established that the transcription factor hlh-2 caused the expression of the Delta-ortholog lag-2, extracellular matrix protein ppn-1, and matrix metalloprotease gon-1 in the DTC (Chesney et al., 2009; Cram et al., 2006; Tamai and Nishiwaki, 2007). The requirement for ppn-1 and gon-1 expression at the onset of migration, the same time ina-1 is required for motility, suggested that ina-1 transcription could be controlled by a similar mechanism. Sequence analysis of the ina-1 promoter showed that the region of the promoter between 400 bp and 336 bp included three sites consistent with the E-box consensus sequence CANNTG (Fig. 2A). HLH-2 binding to E-boxes in C. elegans has been established through multiple in vitro binding studies (Krause et al., 1997; Portman and Emmons, 2000; Thellmann et al., 2003; Hwang and Sternberg, 2004). Other work demonstrated the requirement for intact E-boxes for HLH-2-driven expression of lag-2 and gon-1 (Karp and Greenwald, 2003; Tamai and Nishiwaki, 2007; Chesney et al., 2009). To demonstrate that the E-boxes are required for expression of ina-1, a new 400 bp promoter fusion to the GFP gene was constructed, ina-1p400M::GFP, which mutated the E-boxes from CAGATG and CACCTG, at positions − 407 and − 396 relative to the translation start site, to AAGAGG and AACCGG respectively (Fig. 2A). To enhance our ability to view DTC GFP, ina-1p400M::GFP transgenic nematodes were evaluated for GFP expression after dissection of the DTCs from the nematode body. ina-1p400M::GFP had GFP expression in only 7 ± 4.2% (n = 185) of DTCs compared to nearly 100% expression in ina-1p400::GFP. This showed that the E-boxes at positions −407 and −396 are required for ina-1 expression in the DTC (Fig. 2B–E, Table 1). ina-1 is also expressed in the sheath cells, smooth muscle-like cells required for oocyte movement in the somatic gonad (McCarter et al., 1997). ina-1p400::GFP and ina-1p400M::GFP had GFP expression in 90.5 ± 2.5% (n = 233) and 77.1 ± 8% (n = 131) of sheath cells

Fig. 2. E-box sites in the minimal 400 bp ina-1 promoter are required for expression in the DTC. (A) 410 bp upstream of the ina-1 translational start site. Bold sequences indicate the primers used to amplify the 400 bp and 336 bp promoters. E box sequences are underlined. Bases shown in italic in the first two E boxes were mutated for the ina1p400M::GFP promoter fusion with C changed to A and T changed to G in both cases. (B) Brightfield image of a dissected gonad arm from an ina-1400p::GFP nematode showing GFP in the DTC (C). (D) Brightfield image of a dissected gonad arm from an ina1400Mp::GFP nematode showing GFP in sheath cells, yet none in the DTC (E). Arrows point to the DTCs. Asterisk indicates the sheath cells. Scale bar, 25 μm.

respectively. This showed that the mutated residues in the 400 bp promoter had a specific impact on DTC expression of ina-1. 2.3. Knockdown of hlh-2 causes a loss of DTC migration and ina-1p::RFP expression

Table 1 E-boxes in the ina-1 promoter are required for ina-1 DTC expression. ina-1 promoter fusion

ina-1 promoter length

% RFP or GFP positive DTCs

N

ina-1p::RFP ina-1p1000::GFP ina-1p400::GFP ina-1p400M::GFP ina-1p336::GFP

5000 bp 1000 bp 400 bp 400 bp, mutated E boxes 336 bp

100 ± 0 90.9 ± 5.1 94.1 ± 3.9 7.0 ± 4.2 18.7 ± 5.4

141 140 237 185 209

ina-1 promoter fusions were evaluated for DTC expression of RFP or GFP as indicated. Averages and standard error were generated using three or more independent lines. n is the number of DTCs evaluated. ina-1p400M::GFP and ina-1p336::GFP were not significantly different from each other.

The requirement for E-boxes in the ina-1 promoter for gene expression in the DTC suggested that the hlh-2 transcription factor was responsible for ina-1 expression. To directly test the requirement for hlh-2 activity, hlh-2 was knocked down by RNAi. JE1111 nematodes, which contain a 5 kb region of the ina-1 promoter fused to RFP, exposed to the empty vector control had normal DTC migration and RFP expression in 98.5 ± 0.5% (n = 440) of DTCs (Fig. 3A, Table 2). Knockdown of hlh-2 by RNAi led to multiple DTC migration phenotypes. The majority had migration defects seen as premature migration termination on the ventral surface (26 ± 1.1%, n = 150) or no migration (56.7 ± 5.0%, n = 150, Fig. 3C, E). RFP expression appeared in 64.2 ± 10% (n = 39) of DTCs that

C.M. Meighan et al. / Gene 568 (2015) 220–226

223

Table 2 Knockdown of hlh-2 leads to reduced DTC migration and ina-1 expression. % DTC migration

n

% RFP positive

n

100 ± 0 0 0

440 440 440

98.5 ± 0.5 n/a n/a

440

ina-1p::RFP; hlh-2 RNAi Wild type 17.3 ± 8.5 Ventral only 26.0 ± 1.1 No migration 56.7 ± 5.0

150 150 150

96.1 ± 3.9 64.2 ± 10.0 13.7 ± 7.0

28 39 83

NG2517 ina-1::GFP; EV control Wild type Ventral only No migration

100 ± 0 0 0

130 130 130

100 ± 0 n/a n/a

NG2517 ina-1::GFP; hlh-2 RNAi Wild type Ventral only No migration

23.3 ± 9.0 32.7 ± 4.7 44.0 ± 14.2

ina-1p::RFP; EV control Wild type Ventral only No migration

87 87 87

85.4 ± 8.6 64.5 ± 1.2 11.6 ± 2.8

130

21 28 38

Averages and standard error were generated using three or more independent experiments. EV is empty vector. n is the number of DTCs evaluated.

no migration or early migration termination on the ventral surface compared to wild type migration after hlh-2 RNAi. This showed that the reduction in the intensity of RFP occurred exclusively with a reduction in the migration of the DTCs. 2.4. Knockdown of hlh-2 causes a loss of DTC migration and ina-1 expression

Fig. 3. hlh-2 is required for ina-1 expression from a transcriptional fusion. (A) JE1111, ina1p::RFP, after exposure to the empty vector control. (B) ina-1p::RFP with normal DTC migration after hlh-2 RNAi. (C) Brightfield image of ina-1p::RFP with early termination of DTC migration on the ventral surface of the nematode and limited RFP expression (D) after hlh2 RNAi. (E) Brightfield image of ina-1p::RFP with no DTC migration and no RFP expression (F) after hlh-2 RNAi. Arrows indicate the DTCs. Dashed lines trace the gonad arms. Anterior is to the left, dorsal is up. Scale bar, 25 μm. (G) Quantified RFP comparing expression after exposure to the empty vector control or hlh-2 RNAi. The distance each DTC migrated is indicated on the x axis. * indicates p value b 0.001 for the comparison noted by the bracket. n was at least 25 for each category.

migrated on the ventral surface and in only 13.7 ± 7% (n = 83) of DTCs with no migration (Fig. 3D and F, Table 2). 17.3 ± 8.5% (n = 150) of DTCs had a wild type migratory pattern with 96.1 ± 3.9% (n = 28) showing RFP expression, demonstrating a clear link between RFP expression and DTC migration (Fig. 3B). RFP expression was quantified in all DTC types. Treatment with the empty vector control led to a DTC RFP pixel intensity of 2801.7 ± 167.2 (Fig. 3G). DTCs with normal migration after knockdown of hlh-2 by RNAi had a RFP pixel intensity of 1625 ± 178.1, those with ventral migration only had a DTC RFP pixel intensity of 736.5 ± 83.3 (Fig. 3G). DTCs with no migration after hlh-2 RNAi had a RFP pixel intensity of 538.4 ± 45.5 (Fig. 3G). The change in pixel intensity was significant compared to the empty vector control in all cases. Furthermore, the intensity of RFP was reduced for DTCs with

The role of hlh-2 was further evaluated using strain NG2517, which contains 4 kb of ina-1 promoter, the genomic ina-1 gene, and an in frame fusion to the GFP gene (Baum and Garriga, 1997). Treatment of NG2517 with the empty vector control had normal DTC migration and GFP expression in 100% (n = 130) of DTCs (Fig. 4A, Table 2). Knockdown of hlh-2 by RNAi again generated three distinct categories of DTC migration. 23.3 ± 9% (n = 87) had normal DTC migration with ina-1::GFP expression in 85.4 ± 8.6% (n = 21) of DTCs (Fig. 4B). Migration that terminated early on the ventral surface occurred in 32.7 ± 4.7% (n = 87) of the population with ina-1::GFP expression in 64.5 ± 1.2% (n = 28) of DTCs (Fig. 4E). As seen in JE1111, the largest group of DTCs failed to migrate (44.0 ± 14.2, n = 87) and only had ina-1::GFP expression in 11.6 ± 2.8% (n = 38) of DTCs (Fig. 4C and D, Table 2). The presence of INA-1::GFP was quantified in all DTCs. Treatment with the empty vector had the highest pixel intensity. hlh-2 RNAi led to a reduced pixel intensity for wild type migration (820.4 ± 71.7) and early termination migration (523.6 ± 45). The lowest levels of pixel intensity were detected in DTCs with no migration (404.3 ± 27, Fig. 4F). This shows that the loss of hlh-2 leads to reduced ina-1 expression and reduced DTC migration. Taken together, our results show that the transcription factor hlh-2 is required for ina-1 expression in the DTC. 2.5. Knockdown of HLH-2 binding partner MIG-24 causes a loss of DTC migration and ina-1 expression HLH-2, and all Class I HLH proteins, function as heterodimers (Massari and Murre, 2000). gon-1 expression in the DTC is controlled by HLH-2 in a heterodimer with bHLH transcription factor MIG-24 (Tamai and Nishiwaki, 2007). This suggests that ina-1 expression could also be controlled by MIG-24. Treatment of JE1111 or NG2517 with the empty vector led to normal DTC migration and RFP or INA1::GFP expression (100%, n = 229, and 100%, n = 134, Fig. 5A and B).

224

C.M. Meighan et al. / Gene 568 (2015) 220–226

Fig. 4. hlh-2 is required for ina-1 expression from a translational fusion. (A) NG2517, ina1::GFP, after exposure to the empty vector control. (B) ina-1::GFP with normal DTC migration after hlh-2 RNAi. (C) Brightfield image of ina-1::GFP with no DTC migration and no GFP expression (D) after hlh-2 RNAi. (E) ina-1::GFP with early termination of DTC migration on the ventral surface of the nematode and limited GFP expression after hlh-2 RNAi. Arrows indicate the DTCs. Dashed lines trace the gonad arms. Anterior is to the left, dorsal is up. Scale bar, 25 μm. (F) Quantified GFP comparing expression after exposure to the empty vector control or hlh-2 RNAi. The distance each DTC migrated is indicated on the x axis. * indicates p value b 0.01 for the comparison noted by the bracket. n was at least 20 for each category.

Knockdown of mig-24 by RNAi on strain JE1111 led to early migration termination on the ventral surface for 21.6 ± 1.1% (n = 437) of DTCs, a rate consistent with the reported DTC migration defects caused by mig-24 RNAi (Cram et al, 2006). Pixel intensity for RFP was 728.9 ± 64.6 for DTCs with early migration termination compared to 2731.9 ± 233.5 for DTCs that followed a wild type migration pattern after mig-24 RNAi and 3350 ± 185.4 for the empty vector control (Fig. 5C and E). Knockdown of mig-24 by RNAi on strain NG2517 led to early migration termination on the ventral surface for 14.9 ± 0.7% (n = 161) of DTCs. Pixel intensity for GFP was 893.2 ± 199.9 for DTCs with early migration termination compared to 1817.2 ± 94.1 for DTCs that followed a wild type migration pattern after mig-24 RNAi and 2095.57 ± 114.1 for the empty vector control (Fig. 5D and F). This shows that the loss of mig-24 leads to reduced ina-1 expression and reduced DTC migration. Much like gon-1, ina-1 expression can be regulated by HLH-2 binding partner MIG-24. 3. Discussion In our previous work we showed α integrin ina-1 was required for motility during DTC migration and that ina-1 down-regulation and migration termination were controlled by transcription factor vab-3. Here we show that two E-box sequences and the transcription factor E/Daughterless ortholog hlh-2 are responsible for ina-1 up-regulation

Fig. 5. mig-24 is required for ina-1 expression. (A) JE1111, ina-1p::RFP, and (B) NG2517, ina-1::GFP, after exposure to the empty vector control. (C) ina-1p::RFP with no DTC migration and limited RFP expression after mig-24 RNAi. (D) ina-1::GFP with no DTC migration and limited GFP expression after mig-24 RNAi. Arrows indicate the DTCs. Dashed lines trace the gonad arms, the ventral gonad arm was not outlined in A and B for clarity. Anterior is to the left, dorsal is up. Scale bar, 25 μm. Quantified RFP (E) or GFP (F) comparing expression after exposure to the empty vector control or mig-24 RNAi. The distance each DTC migrated is indicated on the x axis. * indicates p value b 0.001 for the comparison noted by the bracket. n was at least 20 for each category.

in the DTC. We also show that the HLH-2 binding partner MIG-24 can regulate ina-1 expression. This work expands the prominent role of hlh-2 and bHLH transcription factors in DTC specification and function (Karp and Greenwald, 2004; Tamai and Nishiwaki, 2007; Chesney et al., 2009). Pairing the regulation of matrix metalloprotease gon-1 and extracellular protein ppn-1 with the adhesion molecule α integrin ina-1 allows one transcription factor to trigger multiple events needed for effective DTC migration. This suggests that other HLH-2 targets in the DTC could be crucial for migration initiation and would place the coordination of migration initiation under the control of a single factor. Knockdown of hlh-2 or mig-24 by RNAi failed to completely eliminate expression from the ina-1 promoter suggesting that other transcription factors could have a role in regulating ina-1 in the DTC, a finding consistent with results for gon-1 and lag-2 that increases the complexity of migration initiation control (Tamai and Nishiwaki, 2007; Chesney et al., 2009). A complex transcriptional network is already used by the DTC to regulate turning during migration, making a similarly complex network for migration initiation feasible (Wong et al., 2014). HLH-2/E/Daughterless has not been previously linked to α integrin expression. While regulation of the mouse α3 promoter by Ets has been established, the presence of an E-box site at position −241 could allow for α3 regulation by HLH-2/E/Daughterless (Kato et al., 2002; Kamoshida et al., 2012). The human promoters for α3, α7, α11, and β7 all have E-boxes. Though the E-boxes in α7 have been linked to

C.M. Meighan et al. / Gene 568 (2015) 220–226

class II bHLH transcription factor MyoD, the presence of E-boxes in these promoters allow for the possibility of control by HLH-2/E/Daughterless (Vigneault et al., 2007; Jethanandani and Kramer, 2005). The E2A gene is a member of the E family class I HLH transcription factors in vertebrates. E2A has a role in apoptosis, cell differentiation, proliferation, and lymphocyte development (Slattery et al., 2008). The dysregulation of E2A has been linked to both the progression and inhibition of tumor development. Knockdown of E2A inhibits cell division in breast and prostate cancer, yet increases proliferation in colorectal cancer, lymphoma, and leukemia (Slyper et al., 2012; Patel and Chaudhary, 2012; Huang et al., 2014; Zhao et al., 2013; Steininger et al., 2011; Park et al., 1999). E2A has a prominent role in epithelial to mesenchymal transition (EMT), a key component in tumor invasion and metastasis, due to its ability to repress E-cadherin (Sobrado et al., 2009). α3 integrins and matrix metalloproteases have also been identified as molecular markers for cells undergoing EMT and in aggressive cancers (Shirakihara et al., 2013). The joint role for E2A and α3 in EMT, when paired with our result, suggests a possible link between E2A activity and α3 integrin expression. The anchor cell in C. elegans is currently used as a model for EMT and cell invasion, our findings could allow the DTC to serve as a second model for aspects of EMT (Schindler and Sherwood, 2011). Our results show that the transcription factors hlh-2 and mig-24 regulate ina-1 expression during DTC migration. This addition to our previous work, which showed that vab-3 controlled pat-2 expression, further refines the model of integrin regulation during DTC migration. The addition of an α integrin to the regulatory network of hlh-2, especially matrix metalloprotease gon-1, suggests that the combination of the anchor cell and the DTC could allow C. elegans to provide a dynamic model for EMT and cancer metastasis. 4. Methods 4.1. Strains All strains were maintained at 20 °C as described (Brenner, 1974). N2 was used as wild type. Strain JE1111, jeIs1111[ina-1p::RFP rol6(su1006)], is a transcriptional fusion of 5 kb of upstream sequence from the translational start site of ina-1 to RFP (Meighan and Schwarzbauer, 2007). Strain NG2517, gmIs5[ina-1::GFP rol-6(su1006)], is a translational fusion of ina-1 to GFP including 4 kb of upstream sequence (Baum and Garriga, 1997). Strain ex(ina-1p1000::GFP), is a transcriptional fusion linking − 948 to + 1 (Wormbase: http://www. wormbase.org) of ina-1 upstream sequence to GFP. Strains ex(ina1p400::GFP) and ex(ina-1p400M::GFP) are transcriptional fusions linking −410 to +1 of ina-1 upstream sequence to GFP. Strain ex(ina1p336::GFP) is a transcriptional fusion linking −336 to +1 of ina-1 upstream sequence to GFP. For all transcriptional fusions, +1 refers to the A in ATG. 4.2. Transgenic line creation Fusion PCR connected 3 kb of upstream sequence of ina-1 from − 2991 to + 3 where A in ATG is + 1 (Wormbase: http://www. wormbase.org) to GFP (Hobert, 2002). The ina-1 upstream sequence was amplified from N2 nematodes using primers ina1p5kbF and ina1pGFPBR. GFP, including the 3′UTR of unc-54, was amplified from plasmid pPD95.77 using primers 9577C1F and 9577D1R. Products from both reactions were combined and amplified using primers ina1p3kbF and 9577D2R to create a fusion product which was cloned into T vector (Promega) and verified by sequence analysis. The cloned transcriptional fusion ina-1p::GFP in T vector was used as a template for PCR amplification of products containing 1 kb, 400 bp, mutated 400 bp, and 336 bp of ina-1 upstream sequence connected to GFP and the 3′ UTR of unc-54. ina-1p1000::GFP, which contains 948 bp of ina-1 upstream sequence fused to GFP was amplified using primers

225

ina1p1kbF and 9577D2R. ina-1p400::GFP, which contained 410 bp of ina-1 upstream sequence fused to GFP was amplified using primers ina1p400F and 9577D2R. ina-1p400M::GFP, which mutated two E box sites at positions − 407 and −396, and contained 410 bp of ina-1 upstream sequence fused to GFP was amplified using primers ina1p400MF and 9577D2R. ina-1p336::GFP, which contained 336 bp of ina-1 upstream sequence fused to GFP was amplified using primers ina1p336F and 9577D2R. N2 nematodes were injected with the PCR products described above using a standard injection protocol (Evans, 2006). Each promoter fusion was used to create at least three independent lines from separate injection events. 4.3. RNA interference The hlh-2 RNAi plasmid was constructed following the approach used in Kamath and Ahringer (2003). Primers NheIsjjM05B5.5f and HindIIIsjjM05B5.5b were used to amplify 2257 bp of genomic DNA in the hlh-2 gene. Restriction enzymes NheI and HindIII were used to insert the PCR product into plasmid pPD129.36 followed by transformation into HT115 bacteria. The mig-24 RNAi plasmid was purchased from Source BioScience. The construct contained 621 bp of genomic DNA from the mig-24 gene and was built according to Kamath and Ahringer (2003). RNA interference by feeding was performed at 23 °C (Timmons et al., 2001). Eggs were isolated using bleach and sodium hydroxide then added to bacteria expressing hlh-2 double stranded RNA from the plasmid described above or the empty vector control. After 48 h, nematodes were evaluated for RFP or GFP expression. 4.4. Microscopy and quantification of fluorescent proteins A Nikon Eclipse Ti fluorescence microscope with a Nikon DS-Qi1Mc camera run by Elements software was used to collect all fluorescent and bright field images. Nikon Elements software was used to quantify RFP and GFP by drawing a region of interest (ROI) around the DTC then measuring all pixels in that ROI. All quantified images were collected using the same exposure time and filters. 4.5. Calculations Pixel intensity for quantified images ranged from 0 to 4095. Data sets were compared using Student's T test. 4.6. PCR primers ina1p5kbF ATCCACATGATGATGTATCGTTG ina1p3kbF AACCGGGTCAGGTCATCTTA ina1p1kbF TTTTTCCAGATTTGCAGCAC ina1p400F TGACAGATGCACACCACCTGCGTCTC ina1p400MF TGAAAGAGGCACACAACCGGCGTCTC ina1p336F CAATTCAGTTGATATGAGTCACACCG 9577C1F AGTAAAGGAGAAGAACTTTTCACTGG 9577D1R CTTTCTTGCATCGTGCTCATC 9577D2R CCGTCCTCGAAACTCTTGAC ina1pGFPBR AAGTTCTTCTCCTTTACTCATGTTTCGGCGGGTGAGCTTT CTCTC NheIsjjM05B5.5fF TGGGAATGATAGTTTGAAATGCT HindIIIsjjM05B5.5bR TCTCATTTCTCAAGTGCAAGTCA Acknowledgments The authors would like to thank CNU for a Faculty development grant to CMM. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).

226

C.M. Meighan et al. / Gene 568 (2015) 220–226

References Alì, G., Borrelli, N., Riccardo, G., Proietti, A., Pelliccioni, S., Niccoli, C., Boldrini, L., Lucchi, M., Mussi, A., Fontanini, G., 2013. Differential expression of extracellular matrix constituents and cell adhesion molecules between malignant pleural mesothelioma and mesothelial hyperplasia. J. Thorac. Oncol. 8 (11), 1389–1395. http://dx.doi.org/10.1097/ JTO.0b013e3182a59f45 (Nov, PubMed PubMed [citation] PMID: 24084442). Baum, P.D., Garriga, G., 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron 19 (1), 51–62 (Jul, PubMed [citation] PMID: 9247263). Blelloch, R., Kimble, J., 1999. Control of organ shape by a secreted metalloprotease in the nematode Caenorhabditis elegans. Nature 399 (6736), 586–590. Blelloch, R., Anna-Arriola, S.S., Gao, D., Li, Y., Hodgkin, J., Kimble, J., 1999. The gon-1 gene is required for gonadal morphogenesis in Caenorhabditis elegans. Dev. Biol. 216 (1), 382–393 (Dec 1, PubMed [citation] PMID: 10588887). Boelens, M.C., van den Berg, A., Vogelzang, I., Wesseling, J., Postma, D.S., Timens, W., Groen, H.J., 2007. Differential expression and distribution of epithelial adhesion molecules in non-small cell lung cancer and normal bronchus. J. Clin. Pathol. 60 (6), 608–614 (Jun, Epub 2006 Feb 17. PubMed [citation] PMID: 16489176, PMCID: PMC1955047). Brenner, S., 1974. The genetics of Caenorhabditis elegans. Genetics 77 (1), 71–94 (May, PubMed [citation] PMID: 4366476, PMCID: PMC1213120). Cagnet, S., Faraldo, M.M., Kreft, M., Sonnenberg, A., Raymond, K., Glukhova, M.A., 2014. Signaling events mediated by α3β1 integrin are essential for mammary tumorigenesis. Oncogene 33 (34), 4286–4295. http://dx.doi.org/10.1038/onc.2013.391 (Aug 21, Epub 2013 Sep 30.PubMed [citation] PMID: 24077284). Chesney, M.A., Lam, N., Morgan, D.E., Phillips, B.T., Kimble, J., 2009. C. elegans HLH-2/E/ Daughterless controls key regulatory cells during gonadogenesis. Dev. Biol. 331 (1), 14–25. http://dx.doi.org/10.1016/j.ydbio.2009.04.015 (Jul 1, Epub 2009 Apr 17. PubMed [citation] PMID: 19376107, PMCID: PMC2776051). Cram, E.J., Shang, H., Schwarzbauer, J.E., 2006. A systematic RNA interference screen reveals a cell migration gene network in C. elegans. J. Cell Sci. 119 (Pt23), 4811–4818 (Dec 1, Epub 2006 Nov 7. PubMed [citation] PMID: 17090602). Egoz-Matia, N., Nachman, A., Halachmi, N., Toder, M., Klein, Y., Salzberg, A., 2011. Spatial regulation of cell adhesion in the Drosophila wing is mediated by Delilah, a potent activator of βPS integrin expression. Dev. Biol. 351 (1), 99–109. http://dx.doi.org/10. 1016/j.ydbio.2010.12.039 (Mar 1, Epub 2011 Jan 4.PubMed [citation] PMID: 21215259). Evans, T. C., ed. Transformation and microinjection (April 6, 2006), WormBook, ed. The C. elegans Research Community, WormBook, http://dx.doi.org/10.1895/wormbook. 1.108.1, http://www.wormbook.org. Henderson, S.T., Gao, D., Lambie, E.J., Kimble, J., 1994. lag-2 may encode a signaling ligand for the GLP-1 and LIN-12 receptors of C. elegans. Development 120 (10), 2913–2924 (Oct, PubMed [citation] PMID: 7607081). Hobert, O., 2002. PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. Biotechniques 32 (4), 728–730 (Apr, No abstract available. PubMed [citation] PMID: 11962590). Huang, A., Zhao, H., Quan, Y., Jin, R., Feng, B., Zheng, M., 2014. E2A predicts prognosis of colorectal cancer patients and regulates cancer cell growth by targeting miR-320a. PLoS One 9 (1), e85201. http://dx.doi.org/10.1371/journal.pone.0085201 (PubMed [citation] PMID: 24454819, PMCID: PMC3890311). Hwang, B.J., Sternberg, P.W., 2004. A cell-specific enhancer that specifies lin-3 expression in the C. elegans anchor cell for vulval development. Development 131 (1), 143–151 (Jan, Epub 2003 Dec 3. PubMed [citation] PMID: 14660442). Hynes, R.O., 2002. Integrins: bidirectional, allosteric signaling machines. Cell 110 (6), 673–687 (Sep 20, Review. PubMed [citation] PMID: 12297042). Jethanandani, P., Kramer, R.H., 2005. Alpha7 integrin expression is negatively regulated by deltaEF1 during skeletal myogenesis. J. Biol. Chem. 280 (43), 36037–36046 (Oct 28, Epub 2005 Aug 28. PubMed [citation] PMID: 16129691). Kamath, R.S., Ahringer, J., 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30 (4), 313–321 (Aug, PubMed [citation] PMID: 12828945). Kamoshida, G., Matsuda, A., Katabami, K., Kato, T., Mizuno, H., Sekine, W., Oku, T., Itoh, S., Tsuiji, M., Hattori, Y., Maitani, Y., Tsuji, T., 2012. Involvement of transcription factor Ets-1 in the expression of the α3 integrin subunit gene. FEBS J. 279 (24), 4535–4546. http://dx.doi.org/10.1111/febs.12040 (Dec, Epub 2012 Nov 22. PubMed [citation] PMID: 23094960). Karp, X., Greenwald, I., 2003. Post-transcriptional regulation of the E/Daughterless ortholog HLH-2, negative feedback, and birth order bias during the AC/VU decision in C. elegans. Genes Dev. 17 (24), 3100–3111 (Dec, PubMed [citation] PMID: 14701877, PMCID: PMC305261). Karp, X., Greenwald, I., 2004. Multiple roles for the E/Daughterless ortholog HLH-2 during C. elegans gonadogenesis. Dev. Biol. 272 (2), 460–469 (Aug 15, PubMed [citation] PMID: 15282161). Kato, T., Katabami, K., Takatsuki, H., Han, S.A., Takeuchi, K., Irimura, T., Tsuji, T., 2002. Characterization of the promoter for the mouse alpha 3 integrin gene. Eur. J. Biochem. 269 (18), 4524–4532 (Sep, PubMed [citation] PMID: 12230564). Kimble, J.E., White, J.G., 1981. On the control of germ cell development in Caenorhabditis elegans. Dev. Biol. 81 (2), 208–219 (Jan 30, PubMed [citation] PMID: 7202837). Krause, M., Park, M., Zhang, J.M., Yuan, J., Harfe, B., Xu, S.Q., Greenwald, I., Cole, M., Paterson, B., Fire, A.A., 1997. C. elegans E/Daughterless bHLH protein marks neuronal but not striated muscle development. Development 124 (11), 2179–2189 (Jun, PubMed [citation] PMID: 9187144).

Legate, K.R., Wickström, S.A., Fässler, R., 2009. Genetic and cell biological analysis of integrin outside-in signaling. Genes Dev. 23 (4), 397–418. http://dx.doi.org/10. 1101/gad.1758709 (Feb 15, Review. PubMed [citation] PMID: 19240129). Massari, M.E., Murre, C., 2000. Helix–loop–helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 20 (2), 429–440 (Jan, Review. PubMed [citation] PMID: 10611221, PMCID: PMC85097). McCarter, J., Bartlett, B., Dang, T., Schedl, T., 1997. Soma–germ cell interactions in Caenorhabditis elegans: multiple events of hermaphrodite germline development require the somatic sheath and spermathecal lineages. Dev. Biol. 181 (2), 121–143 (Jan 15, PubMed [citation] PMID: 9013925). Meighan, C.M., Schwarzbauer, J.E., 2007. Control of C. elegans hermaphrodite gonad size and shape by vab-3/Pax6-mediated regulation of integrin receptors. Genes Dev. 21 (13), 1615–1620 (Jul 1, PubMed [citation] PMID: 17606640, PMCID: PMC1899471). Park, S.T., Nolan, G.P., Sun, X.H., 1999. Growth inhibition and apoptosis due to restoration of E2A activity in T cell acute lymphoblastic leukemia cells. J. Exp. Med. 189 (3), 501–508 (Feb 1, PubMed [citation] PMID: 9927512, PMCID: PMC2192921). Patel, D., Chaudhary, J., 2012. Increased expression of bHLH transcription factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis. Biochem. Biophys. Res. Commun. 422 (1), 146–151. http://dx. doi.org/10.1016/j.bbrc.2012.04.126. Portman, D.S., Emmons, S.W., 2000. The basic helix–loop–helix transcription factors LIN32 and HLH-2 function together in multiple steps of a C. elegans neuronal sublineage. Development 127 (24), 5415–5426 (Dec, PubMed [citation] PMID: 11076762). Schindler, A.J., Sherwood, D.R., 2011. The transcription factor HLH-2/E/Daughterless regulates anchor cell invasion across basement membrane in C. elegans. Dev. Biol. 357 (2), 380–391. http://dx.doi.org/10.1016/j.ydbio.2011.07.012 (Sep 15, Epub 2011 Jul 18. PubMed [citation] PMID: 21784067, PMCID: PMC3164387). Schmid, R.S., Anton, E.S., 2003. Role of integrins in the development of the cerebral cortex. Cereb. Cortex 13 (3), 219–224 (Mar, Review. PubMed [citation] PMID: 12571112). Shirakihara, T., Kawasaki, T., Fukagawa, A., Semba, K., Sakai, R., Miyazono, K., Miyazawa, K., Saitoh, M., 2013. Identification of integrin α3 as a molecular marker of cells undergoing epithelial–mesenchymal transition and of cancer cells with aggressive phenotypes. Cancer Sci. 104 (9), 1189–1197. http://dx.doi.org/10.1111/cas.12220 (Sep, Epub 2013 Jul 20. PubMed [citation] PMID: 23786209). Slattery, C., Ryan, M.P., McMorrow, T., 2008. E2A proteins: regulators of cell phenotype in normal physiology and disease. Int. J. Biochem. Cell Biol. 40 (8), 1431–1436 (Epub 2007 May 29. Review. PubMed [citation] PMID: 17604208). Slyper, M., Shahar, A., Bar-Ziv, A., Granit, R.Z., Hamburger, T., Maly, B., Peretz, T., BenPorath, I., 2012. Control of breast cancer growth and initiation by the stem cellassociated transcription factor TCF3. Cancer Res. 72 (21), 5613–5624. http://dx.doi. org/10.1158/0008-5472.CAN-12-0119 (Nov 1, Epub 2012 Oct 22. PubMed [citation] PMID: 23090119). Sobrado, V.R., Moreno-Bueno, G., Cubillo, E., Holt, L.J., Nieto, M.A., Portillo, F., Cano, A., 2009. The class I bHLH factors E2-2A and E2-2B regulate EMT. J. Cell Sci. 122 (Pt 7), 1014–1024. http://dx.doi.org/10.1242/jcs.028241 (Apr 1, PubMed [citation] PMID: 19295128). Steininger, A., Möbs, M., Ullmann, R., Köchert, K., Kreher, S., Lamprecht, B., Anagnostopoulos, I., Hummel, M., Richter, J., Beyer, M., Janz, M., Klemke, C.D., Stein, H., Dörken, B., Sterry, W., Schrock, E., Mathas, S., Assaf, C., 2011. Genomic loss of the putative tumor suppressor gene E2A in human lymphoma. J. Exp. Med. 208 (8), 1585–1593. http:// dx.doi.org/10.1084/jem.20101785 (Aug 1, Epub 2011 Jul 25. PubMed [citation] PMID: 21788410, -PMCID: PMC3149217). Tamai, K.K., Nishiwaki, K., 2007. bHLH transcription factors regulate organ morphogenesis via activation of an ADAMTS protease in C. elegans. Dev. Biol. 308 (2), 562–571 (Aug 15, Epub 2007 May 25. PubMed [citation] PMID: 17588558). Tax, F.E., Yeargers, J.J., Thomas, J.H., 1994. Sequence of C. elegans lag-2 reveals a cellsignalling domain shared with Delta and Serrate of Drosophila. Nature 368 (6467), 150–154 (Mar 10, PubMed [citation] PMID: 8139658). Thellmann, M., Hatzold, J., Conradt, B., 2003. The Snail-like CES-1 protein of C. elegans can block the expression of the BH3-only cell-death activator gene egl-1 by antagonizing the function of bHLH proteins. Development 130 (17), 4057–4071 (Sep, PubMed [citation] PMID: 12874127). Timmons, L., Court, D.L., Fire, A., 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263 (1-2), 103–112 Jan 24, PubMed [citation] PMID: 11223248. Vigneault, F., Zaniolo, K., Gaudreault, M., Gingras, M.E., Guérin, S.L., 2007. Control of integrin genes expression in the eye. Prog. Retin. Eye Res. 26 (2), 99–161 (Mar, Epub 2006 Dec 27. Review. PubMed [citation] PMID: 17194617). Wong, M.C., Kennedy, W.P., Schwarzbauer, J.E., 2014. Transcriptionally regulated cell adhesion network dictates distal tip cell directionality. Dev. Dyn. 243 (8), 999–1010. http://dx.doi.org/10.1002/dvdy.24146 Aug, Epub 2014 May 26. PubMed [citation] PMID: 24811939, PMCID: PMC4321954. Zhao, H., Huang, A., Li, P., Quan, Y., Feng, B., Chen, X., Mao, Z., Zhu, Z., Zheng, M., 2013. E2A suppresses invasion and migration by targeting YAP in colorectal cancer cells. J. Transl. Med. 11, 317. http://dx.doi.org/10.1186/1479-5876-11-317 (Dec 26, PubMed [citation] PMID: 24369055, PMCID: PMC3879192). Zhou, B., Gibson-Corley, K.N., Herndon, M.E., Sun, Y., Gustafson-Wagner, E., TeohFitzgerald, M., Domann, F.E., Henry, M.D., Stipp, C.S., 2014. Integrin α3β1 can function to promote spontaneous metastasis and lung colonization of invasive breast carcinoma. Mol. Cancer Res. 12 (1), 143–154. http://dx.doi.org/10.1158/1541-7786.MCR-130184 (Jan, Epub 2013 Sep 3. PubMed [citation] PMID: 24002891, PMCID: PMC3947021).