Transcription of brain creatine kinase in U87-MG glioblastoma is modulated by factor AP2

Biochimica et Biophysica Acta 1728 (2005) 18 – 33 http://www.elsevier.com/locate/bba

Transcription of brain creatine kinase in U87-MG glioblastoma is modulated by factor AP2 Dianna Willis, Yanping Zhang, George R. MolloyT Department of Biological Sciences, University of Delaware, 117 Wolf Hall, Newark, DE 19716, United States Received 14 November 2004; received in revised form 14 January 2005; accepted 19 January 2005

Abstract Our previous studies established in U87-MG glioblastoma cells that elevated cAMP increased transcription of the endogenous as well as a transiently-transfected brain creatine kinase (CKB) gene, despite the absence of a cAMP response element (CRE) in the CKB proximal promoter. This report employed transfection to show that the transcription of CKB in U87 cells is induced by transcription factor AP2a, which is known to be activated by cAMP. Dominant-negative forms of AP2a not only prevented the AP2a-mediated activation of CKB but also blocked the cAMP-mediated increase in CKB transcription caused by forskolin treatment. The mutation of the four potential AP2 elements within the CKB proximal promoter showed that induction of CKB by AP2 was mediated principally through the AP2 element located at 50 bp in the promoter. Electromobility shift assays revealed a protein in U87 nuclear extracts that bound to a consensus AP2a element as well as to the ( 50) AP2 element in CKB. Interestingly, the CKB ( 50) AP2 element contains GCCAATGGG which also bound NF-Y, the CCAAT-binding protein, suggesting that interplay between AP2 and NF-Y may modulate CKB transcription. This is the first report of a role for AP2 in the regulation of CKB transcription and of an AP2 element within which an NF-Y site is located. D 2005 Elsevier B.V. All rights reserved. Keywords: AP2; Astrocyte; Cyclic AMP; Energy metabolism; Transcription; U87 glioblastoma

1. Introduction The creatine kinase (CK) isozymes catalyze the reversible transfer of a high-energy phosphoryl group between ATP and creatine to form phosphocreatine (PCr) which is subsequently transferred to ADP to regenerate ATP in cells types where the utilization of ATP is rapid and/or sudden [1]. In vertebrates, four distinct CK enzymes exist which are products of separate, single-copy, nuclear-located genes: the brain isoform (CKB), the muscle isoform (CKM) and two mitochondrial isoforms (MiCK) (ubiquitous [uMiCK] and sarcomeric [sMiCK]) [1]. In some brain regions, CKB is coordinately expressed with uMiCK [2,3]. While most CKB is in the cytosol [4], a minor amount of CKB protein is associated with the plasma membrane [5,6]. uMiCK selfassociates to form octamers localized on the outer surface of T Corresponding author. Tel.: +1 302 831 8478; fax: +1 302 831 2281. E-mail address: [email protected] (G.R. Molloy). 0167-4781/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2005.01.007

the inner mitochondrial membrane [1]. Much of the energy utilized by CKB comes from the ATP generated by mitochondrial oxidative phosphorylation. This ATP is converted by uMiCK to PCr which is then exported (via the porin protein) and is used by the cytoplasmic CKB to regenerate ATP at sites of high ATP consumption [1]. The functional coupling of uMiCK and CKB generates a bPCr energy shuttleQ in which CKB functions as a subcellular, site-specific regulator of ATP regeneration rather than a pancellular generator of ATP such as oxidative phosphorylation [1]. CKB expression is highest in brain, ten-fold lower in heart and nearly undetectable in liver [7]. In primary rat brain cell cultures, we found that CKB messenger RNA (mRNA) levels were 15- to 17-fold higher in astrocytes and oligodendrocytes than in embryonic neurons [8]. This suggested an important role for CKB in the energydemanding reactions of (i) myelinogenesis in oligodendrocytes [9], which is consistent with the high CK enzyme

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

activity observed in cultured rat oligodendrocytes [4] and (ii) the transport of ions and glutamate by astrocytes [9–11]. Also, CKB activity was recently found to be essential during the morphological change in stellate astrocytes that was triggered by thrombin activation of its receptor PAR1 [5,12], possibly for the regeneration of ATP needed for cytoskeleton reorganization. The CKB proximal promoter contains a CCAAT box located at 80 bp and 50 bp, a TA-rich element (TATAAATA at 60 bp) and a nonconsensus TATA box (TTAA; at 28 bp) [13]. CKB transcription is initiated at two start sites (+1 bp and +4 bp) under the initiation direction of the 28 bp TTAA [13,14]. However, little is presently known of the protein factors that regulate CKB transcription in glial and neuronal cells or other cell types. Previous studies have shown that cAMP accelerates myelinogenesis in primary cultures of oligodendrocytes [15], stimulates growth of primary astrocytes [16] and regulates the extension of plasma membrane projections that control the aforementioned stellate morphology of astrocytes [17], all of which are cellular events associated with increased utilization of ATP. This raised the question of whether cAMP regulates CKB expression. We have previously shown in U87-MG human glioblastoma cells, a valuable model system for cultured astrocytes [18], that transcription of the endogenous human CKB as well as transfected rat CKB genes is induced by a forskolinmediated increase in cAMP via a mechanism requiring the activation of adenylate cyclase and protein kinase A (PKA) [19–21]. CKB induction occurred rapidly (with maximal induction after 6 h), did not require de novo protein synthesis and was also triggered by activators of Gas proteins (either prostaglandin E1 [PGE1], PGE2 or cholera toxin) suggesting that CKB transcription can be regulated by extracellular signals acting through G-protein coupled receptors [20]. In transient transfection experiments, we found that the level of forskolin-induced transcription from the genomic rat CKB gene was the same whether transcription was driven by 2.9 kb of the promoter plus 5V flanking sequences or only 0.2 kb of the CKB promoter. Also, the level of induced transcription of a CAT reporter gene driven by the 2.9 kb CKB promoter was the same as with the 0.2 kb CKB promoter [21]. The initiation sites of the cAMP-induced CKB transcripts were the same as in basal CKB transcription [21]. Analyses of 5V deletions of the 0.2 kb CKB promoter showed that sequences between 80 bp and +5 bp were sufficient for cAMP-induced CKB transcription, despite the absence of a consensus cAMP responsive element (CRE). However, we noticed that the 80 bp to +5 bp sequence has four potential AP2 sites each of which contains eight out of nine of the consensus AP2 base pairs. Therefore, we investigated in U87 glioblastoma (i) the ability of AP2 to directly activate CKB transcription, (ii) the importance of each AP2 element in the activation of CKB and (iii) the nuclear proteins which bind to the essential ( 50) AP2 element in CKB.

19

2. Materials and methods 2.1. Cell culture and transfection Human U87-MG glioblastoma cells (ATCC HTB14) were propagated as subconfluent monolayers as described [21], plated at 7105 cells per 100 mm dish for 24 to 36 h until achieving ~60% confluence and transiently transfected using the calcium phosphate protocol as described [21]. Unless otherwise stated, each dish of cells received 1.5 pmol (5.0 Ag) of CKB-CAT reporter plasmid, 0.5 Ag of plasmid pCMV-hGal as an internal measure of transfection efficiency, varying amounts of AP2a expression plasmid (pAP2a) and sufficient pUC19 DNA as a carrier to adjust total amount of DNA to 20 Ag per dish. When RNase Protection Assay was required, 0.5 Ag of pRSV-Neo was used as the internal control for transfection efficiency [19]. DNA was left in contact with the cells for 12 h, then the media containing DNA was removed, cells were rinsed with DMEM+10% fetal bovine serum (FBS) and 10 ml of fresh DMEM+10% FBS was added to each plate; cells were harvested 24 h later. Plasmid pMT-CAT, which contains three copies of the AP2 binding site from the human metallothionein IIa (hMTIIa) gene cloned upstream of the thymidine kinase core promoter in plasmid pBLCAT2, was used as a positive control since it is highly induced by AP2 [22]. The expression of AP2a and dominant negative (DN) AP2aB was controlled by the CMV promoter [22] while the RSV promoter controlled the expression of DN-AP2aDN278 [23]. 2.2. Pharmacological treatments U87 cells were treated for 12 h with 10 AM forskolin (BIOMOL) and 0.5 mM 3-isobutyl-1-methylxanthine ([IBMX]; CalBiochem) to elevate intracellular cAMP levels. The PKA inhibitor N-(2-[ p-Bromocinnamylamino] ethyl)-5-isoquinolinesulfonamide (H89; BIOMOL) was used at a final concentration of 30 AM for 12 h. Inducers and inhibitors were added to transfection plates for 12 h prior to harvesting cells [21]. 2.3. Assays for chloramphenicol acetyltransferase (CAT) and b-galactosidase Following transfection, cells were harvested and 200 Ag of cytosolic protein was assayed for CAT activity and 10 Ag of protein was assayed for h-galactosidase (h-gal) activity as a control for transfection efficiency as described [24]. Transfection results were expressed as CAT activity/h-gal activity which were then normalized to the CAT/h-gal level from U87 cells not induced by pAP2a. 2.4. Nuclear extracts of cultured cells U87 cells at ~70% confluence were harvested and nuclear extracts were prepared as described [25], except

20

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

that the hypotonic buffer of Zhao et al. [25] for cell lysis was supplemented with 0.4 mM NaF, 0.4 mM Na3VO4 and 5 Ag/ ml each of aprotinin, pepstatin A and leupeptin. After lysis, the nuclear pellet was resuspended in nuclear extract buffer (0.42 M NaCl, 20 mM HEPES [pH 7.9], 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 2 mM EGTA, 2 mM DTT, 25% glycerol, 5 mM NaF, 1 mM Na3VO4, and 5 Ag/ml each of aprotinin, pepstatin A and leupeptin) and rotary spun for 30 min at 4 8C. The insoluble debris was removed by centrifugation at 11,600g for 5 min at 4 8C. The nuclear extract was dialyzed (20 mM HEPES [pH 7.9], 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM DTT, 1 mM PMSF) for 4 h, aliquoted for single use, frozen in liquid nitrogen and stored at 808C. 2.5. In vitro transcription and translation In vitro synthesis of recombinant AP2a, NF-YA, NF-YB and NF-YC proteins was conducted using the TnT Coupled Reticulocyte Lysate System (Promega) following the manufacturer’s protocol; the generation of immunoreactive protein was confirmed using immunoblot analysis. 2.6. Oligonucleotide probes Synthetic oligonucleotides to the desired DNA sequences were synthesized (Qiagen) and equal amounts of sense and antisense oligonucleotides were added to the hybridization buffer (60 mM NaCl, 10 mM Tris–HCl [pH 7.4]), heated at 95 8C for 3 min and allowed to cool to room temperature in 100 ml of H2O initially at 65 8C. The annealed oligonucleotides were end-labeled with Klenow polymerase using 50 ACi [32P]-dCTP and 1 AM unlabeled dATP, dGTP and dTTP for 30 min at 30 8C. The probe was spun through a Sephadex STE SELECT-D, G-25 column (Eppendorf-5 Prime, Inc.) at 1500 g for 4 min to remove any unincorporated nucleotides (ntd) and then counted by liquid scintillation to determine its specific activity. 2.7. Electromobility Shift Assays (EMSAs) EMSAs to analyze protein–DNA interactions were conducted as described by Shen et al. [26]. Fifteen micrograms of U87 nuclear extract was incubated with binding buffer (8.5 mM HEPES [pH 7.9], 30 mM KCl, 1.5 mM MgCl2, 0.4 mM DTT, 0.3 mM PMSF), 4% Ficoll 400 and 1 Ag poly dI–dC (to reduce non-specific binding) for 10 min on ice. [32P] DNA probe (5104 cpm and 2.5 ng) was then added and incubated at 22 8C for 30 min in a volume of 20 Al. Supershift assays were performed as above except that the extract (or recombinant protein) was pre-incubated with a specific antibody for 1 h on ice prior to being added to the DNA-binding reaction described above. Antibodies used were mAb to either NF-YA or NFYB [27], mAb (5E4) to AP2a, epitope-selected rabbit polyclonal Ab to AP2h (h94), AP2g (g96) [28] or AP2y.

In some EMSAs, extract was preincubated with doublestranded, unlabeled competitor probe for NF-Y with the sequence 5V-ATCAGCCAATCAGAGC-3V (CyberSyn). DNA/protein complexes were resolved on 5% polyacrylamide gels (40:1 acrylamide:bis-acrylamide) electrophoresed for 4.5 h at 200 V at 4 8C, dried and visualized on a PhophorImager SI (Molecular Dynamics). 2.8. Isolation and quantification of RNA from U87 cells Total cell RNA from transfected U87 cells was isolated using the guanidinium thiocyanate/cesium chloride (CsCl) procedure [24]. The integrity of RNA was assayed by electrophoresis on a 1% agarose as described [24]. RNA was quantified by absorbance at OD260/OD280 on a Milton Roy SpectronicR 601. 2.9. RNase Protection Assay (RPA) RPA were performed as described [19]. Thirty micrograms of total RNA was hybridized with 4105 cpm of 32Plabeled riboprobe in 30 Al of hybridization buffer (80% deionized formamide, 0.4 M NaCl, 40 mM Pipes [pH 6.4], 1 mM EDTA) for 12–16 h at 50 8C. After RNase digestion [19], RNase-protected fragments were resolved on an 8 M urea–6% polyacrylamide gel in 1 TBE buffer (90 mM Tris, 90 mM boric acid, 2 mM EDTA) and quantified on a PhosphorImager-SI (Molecular Dynamics). pBR322 DNA, digested with MspI and labeled with [32P] dCTP using Klenow polymerase, was included on all gels as a molecular weight marker. 2.10. Antisense riboprobes Plasmid containing the CAT cDNA was linearized by Bsu36I and 32P-labeled antisense riboprobe was synthesized as described [19]. A full-length 616-nucleotide (ntd) antisense RNA probe was generated of which 260 ntd were RNase-resistant after hybridization to the CAT mRNA; this corresponded to the XbaI–EcoRI fragment of the CAT cDNA [29]. In transfected U87 cells, internal control Neo mRNA was detected by RPA as described [19]. SP6 RNA polymerase generated a 772 ntd full-length Neo probe of which 533 ntd were protected by the Neo mRNA. 2.11. Site-directed mutagenesis Site-directed mutagenesis of plasmid p 188/+5 CKBCAT (DVE) was performed using the QuikChangek SiteDirected Mutagenesis Kit (Stratagene) to mutate the potential AP2 elements. Mutations were performed using the following primer sequences: 5VCCCCTTAAGAGCTCAGGGAGCATTGATACTCC CCC TTAAGAGC TCAGGGAGCATTGATACT CCGTCGTGCATGCAG3V (for the 10 bp AP2 element);

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

5VGCCGCCAATGGGAGTTGATACACGCGCCCCTTAAGCCGCCAATGGGAGTTGATACACGCGCCCCTTAAGAGCTCAGGG3V (for the 40 bp AP2 element); 5VCGCGTCGCCGGCCTTTGATTGGTGGCTATTTATAGCGCGTCGCCGGCCTTTGATTGGTGGCTATTTATAGCCC3V (for the 50 bp AP2 element). 2.12. Generation of plasmids Plasmid p 188/+5 CKB-CAT was constructed as previously described [21]. CKB-CAT plasmids used in trans-

21

fection were restriction digested to remove a potential AP2 element within the pUCPL-CAT vector; therefore, they are labeled with the suffix DVE. To generate p 188/+5 CKBCAT (DVE), p 188/+5 CKB-CAT was digested with HindIII and EcoO109I (located in the vector) and religated after the removal of the vector fragment. To generate p 75/+5 CKBCAT (DVE), plasmid p 80/+5 CKB-CAT [21] (which contains a BspDI restriction site centered at 80 bp in the CKB promoter that eliminates the potential AP2 element at this site [30]) was digested with EcoO109I and BspDI and religated after the removal of the smaller fragment (see Fig.

Fig. 1. Plasmid pAP2a increases transcription of the proximal CKB promoter in transfected U87 cells. (A) Sequence of the proximal rat CKB promoter showing the ( 80) and ( 50) CCAATs, the ( 60) TA-rich element and the ( 28) TTAA box; the locations of the four potential AP2 elements in CKB are directly above the consensus AP2 elements (GCCNNNGGC). In Panel (A) and subsequent figures, lower case letters indicate the nucleotides in wild type (wt) CKB that deviate from the consensus AP2 sequence. (B) U87 cells were co-transfected with 5 Ag (1.5 pmol) of p 188/+5 CKB-CAT and either 0 Ag, 1 Ag, 5 Ag or 10 Ag of the AP2a expression plasmid pAP2a (rows 1–4, respectively). In row 5, U87 cells were transfected with 5 Ag of p 188/+5 CKBCAT and 5 Ag of pAP2a and the PKA inhibitor H89 was added at 30 AM for 12 h prior to cell harvest. U87 cells were transfected with 1.5 pmol of the positive control plasmid pMT-CAT either without pAP2a (row 6) or with 5 Ag pAP2a (row 7) or with 5 Ag pAP2a plus the addition of H89 (row 8); *Pb0.05 and **Pb0.001 compared to lane 1; Duncan’s Multiple Range Test. (C) U87 cells were transfected with p 188/+5 CKB-CAT without pAP2a (row 1), with 5 Ag of pAP2a (row 2) or 5 Ag of the empty expression plasmid p(-)AP2 (row 3). p 188/+5 CKB-CAT(DVE), which had the degenerate vector AP2 element removed by digestion with EcoO109I (E) and HindIII (H), was transfected into U87 cells either without pAP2a (row 4) or with 5 Ag of pAP2a (row 5). Plasmid p 75/+5 CKB-CAT(DVE), which lacks the degenerate AP2 vector elements and the potential AP2 element at 80 bp, was transfected without pAP2a (row 6) or with 5 Ag of pAP2a (row 7). In Panels (B) and (C), histogram shows the levels of CAT/h-gal activity which were then normalized to the CAT/h-gal level in U87 cells transfected with wt p 188/+5 CKB-CAT but not induced by pAP2a (row 1); *Pb0.001 compared to lane 1; Duncan’s Multiple Range Test.

22

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

1C). All plasmids used in the transfections were purified by two successive bandings on CsCl gradients [24]. 2.13. Data analysis Each experiment was repeated at least three times; all results are expressed as meansFS.E. Data were analyzed using STATMOST software initially for ANOVA analysis and, where appropriate, followed by Duncan’s Multiple Range Test.

3. Results 3.1. Plasmid pAP2a increases transcription of the proximal CKB promoter in transiently transfected U87 glioblastoma cells We have shown previously that the CKB promoter sequence between 80 bp and +5 bp is sufficient for the forskolin-mediated induction of CKB transcription despite the absence of a CRE element [21]. However, this region contains four potential AP2 elements each of which matches the consensus AP2 sequence GCCNNNGGC [23] in eight of nine bp (Fig. 1A). Therefore, we investigated the ability of the cAMP-responsive transcription factor AP2 to induce transcription of the 188 bp CKB promoter. Plasmid p 188/ +5 CKB-CAT, containing the CKB promoter sequences from 188 bp to +5 bp fused to the CAT reporter gene, was transiently transfected into cultured U87 cells in the absence or presence of a plasmid expressing AP2a (pAP2a). In the absence of pAP2a, CKB transcription was very low (Fig. 1B, row 1), however, the expression of pAP2a increased CKB transcription in a dose-dependent manner (rows 2–4). This N10-fold induction of CKB was comparable to that of a positive control gene pMT-CAT (Fig. 1B, rows 6 and 7), which contains three copies of the AP2 element from the human metallothionein IIa gene (hMTIIa) [22]. The addition of H89, a selective inhibitor of protein kinase A (PKA), completely inhibited AP2-mediated induction of p 188/+5 CKB-CAT and pMT-CAT (rows 5 and 8) indicating that the induction of p 188/+5 CKB-CAT by AP2a in U87 cells occurs through a pathway requiring PKA. However, we noticed that a degenerate AP2-like element exists in the pUCPL-CAT vector sequence [31] of p 188/+5 CKB-CAT, raising the slight possibility that AP2a bound to this vector element rather than one of the four AP2 elements in CKB. Therefore, plasmid p 188/+5 CKB-CAT(DVE) was constructed that lacked the degenerate AP2 site in the vector (Fig. 1C). The cotransfection of p 188/+5 CKBCAT(DVE) with pAP2a showed that pAP2a still activated CKB transcription ~10-fold (Fig. 1C, rows 4–5), which is consistent with an element(s) in the CKB promoter mediating induction by pAP2a. Control transfection of the expression plasmid lacking AP2a (p[-]AP2) did not significantly induce CKB (row 3). We previously showed

that the deletion of the sequence between 188 bp and 60 bp did not prevent the forskolin-mediated increased CKB transcription in transfected U87 cells [21]. Therefore, if stimulation by forskolin is also acting through factor AP2, the important AP2 element must reside between 60 bp and +5 bp and, thus, the deletion of the potential AP2 element at 80 bp of CKB should not greatly affect CKB induction by AP2a. Therefore, p 75/+5 CKB-CAT(DVE) was generated; Fig. 1C shows that pAP2a still strongly activated p 75/+5 CKB-CAT(DVE) (rows 6–7) indicating that the more important AP2 element(s) in CKB was located between 75 bp and +5 bp. Fig. 1C also shows that the uninduced (basal) expression of p 75/+5 CKB-CAT(DVE) is 2-fold higher than for p 188/+5 CKB-CAT(DVE) (compare rows 4 and 6) suggesting that a negative cis element exists in the CKB promoter between 188 bp and 75 bp, as we have noted previously [21]. 3.2. Dominant-negative form of AP2 blocks the AP2mediated increase in p 188/+5 CKB-CAT expression in transfected U87 cells To confirm that the induction in CKB-CAT expression in Fig. 1 was the direct result of transactivation by pAP2a, we attempted to block induction using two distinct dominantnegative (DN) forms of AP2a (pAP2aB and AP2aDN278). Both DN-AP2aB [22] and DN-AP2aDN278 [23] have been shown to inhibit wild type (wt) AP2 in binding to DNA. U87 cells were cotransfected with p 188/+5 CKBCAT(DVE), pAP2a and an increasing molar excess of DN-pAP2aB. Fig. 2A shows that DN-pAP2aB caused a dose-dependent decrease in the AP2a-mediated induction of p 188/+5 CKB-CAT(DVE) (lanes 1 to 6). In the absence of AP2a, however, DN-pAP2aB had no significant affect on basal CKB transcription (lane 7). Also, the cotransfection of the empty expression plasmid lacking DN-AP2aB did not significantly inhibit AP2a-mediated induction of CKB transcription (lane 8). Similarly, Fig. 2B shows that DNAP2aDN278 inhibited the AP2a-mediated induction of CKB in a dose-dependent manner (lanes 1 to 5); this is similar to the DN-AP2aDN278 inhibition of the AP2amediated induction of the c-erbB2 promoter reported by Bosher et al. [32]. Our results are consistent with pAP2a directly activating the transcription of p 188/+5 CKBCAT(DVE) through one or more of the AP2 elements in the promoter. Note that the induction of CAT expression in Fig. 2 was less than that in Fig. 1 because a lower amount of the inducing pAP2a (i.e. 0.75 Ag) was used to facilitate its inhibition by DN-AP2a. 3.3. AP2a-mediated induction of CKB transcription is mediated principally through the AP2 element located at 50 bp in the CKB promoter To determine which of the AP2 elements mediates the induction of CKB, each of the four elements was mutated

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

Fig. 2. Dominant negative (DN) forms of AP2a inhibit the transactivation of CKB by pAP2a. (A) All U87 cells were transfected with 1.5 pmol of p 188/+5 CKB-CAT(DVE) either without pAP2a (lanes 1 and 7) or with 0.75 Ag of pAP2a (lanes 2–6 and 8). In lanes 3 to 6, 0.75 Ag of pAP2a was co-transfected with a 1-, 5-, 10- or 15-fold molar excess of pDN-AP2aB, respectively. In lane 8, pAP2a was cotransfected with 0.75 Ag of empty expression plasmid lacking DN-AP2aB; **Pb0.001 and *Pb0.05 compared to lane 1; Duncan’s Multiple Range Test. (B) All U87 cells were transfected with 1.5 pmol of p 188/+5 CKB-CAT(DVE) either without pAP2a (lane 1) or with 0.75 Ag of pAP2a (lanes 2–6). In lanes 3 to 5, pAP2a was co-transfected with a 1-, 5- or 10-fold molar excess of pDNAP2aDN278, respectively. In lane 6, pAP2a was cotransfected with a 5fold molar excess of empty expression plasmid lacking DN-AP2aDN278 (p[-] DN-AP2DN278); *Pb0.05 compared to lane 1; **Pb0.05 compared to lane 2; Duncan’s Multiple Range Test. In Panels (A) and (B), histogram shows the levels of CAT/h-gal activity which were then normalized to the CAT/h-gal level from U87 cells transfected with wt p 188/+5 CKBCAT(DVE) but not induced by pAP2a (lane 1).

and the CKB promoter was then tested for its response to pAP2a in transfected U87 cells. Firstly, since Fig. 1C showed that the deletion of the CKB sequences from 188 bp to 75 bp only slightly diminished (by 22%F3%) AP2a-mediated induction of CKB, we assumed that the

23

( 80) AP2 element was not essential for strong induction. Each of the three remaining AP2 elements was systematically changed by site-directed mutagenesis in p 188/+5 CKB-CAT(DVE) to prevent the binding of AP2 at the respective mutated site (Fig. 3A). The mutation of the AP2 element located at 10 bp (i.e. p 10 AP2mut CKB; see Fig. 3A) only reduced AP2a-mediated CKB induction by an average of 24% (Fig. 3B, compare lanes 4 and 5 to lanes 1–3). Since previous reports showed that in some promoters multiple AP2 sites in close proximity may act independently and that the mutation of any single site may have little effect on transcription [33,34], we mutated the AP2 element at 40 bp in the background of p 10 AP2mut CKB plasmid to generate p 10/ 40 AP2mut CKB (Fig. 3A). The mutation of the ( 10) and ( 40) AP2 elements together did not diminish the AP2a-mediated CKB induction below that seen previously with p 10 AP2mut CKB (Fig. 3B, lanes 6–8). Next, the AP2 elements at ( 10) and ( 40) were retained in their wt sequence and the mutagenesis of the 50 AP2 element was designed to prevent the binding of AP2; however, the CCAAT box located within it (beginning at 54 bp) was not altered (see p 50 AP2mut in Fig. 3A) so as to preserve the possible binding of Nuclear Factor Y (NF-Y) [27] which could affect the basal (and possibly induced) transcription of CKB. Indeed, Fig. 3C shows that the transcription of p 50 AP2mut CKB plasmid was not activated by pAP2a (lanes 5–7), whereas in parallel transfections AP2a again strongly activated wt p 188/+5 CKB-CAT(DVE) (lanes 1–2) and p 10/ 40 AP2mut CKB (lanes 3–4). Importantly, the CCAAT box function in the p 50 AP2mut CKB promoter appeared not to be hindered since its basal transcription was maintained (Fig. 3C, lane 5) and was the same as the promoters for wt p 188/+5 CKB-CAT(DVE) and p 10/ 40 AP2mut CKB (lanes 1 and 3). We also used electromobility shift assays (EMSA) to confirm the maintenance of the CCAAT box function by comparing the ability of factor NF-Y, generated in vitro by transcription/translation (TnT), to bind to oligonucleotide probes encompassing the 60 to 32 region present in wt CKB or p 50 AP2mut CKB (Fig. 4A). Fig. 4B shows that both the wt CKB 60/ 32 and 50 AP2mut CKB probes bound in vitro NF-Y (lanes 1 and 3) with equal efficiency and were completely supershifted with a NF-Y monoclonal antibody (mAb) to NF-YA (lanes 2 and 4). 3.4. A dominant-negative AP2a blocks the forskolinmediated activation of CKB transcription in transfected U87 cells While Fig. 3 showed that AP2a activated CKB transcription by a mechanism requiring the 50 AP2 element, we addressed the broader question of whether our previously reported forskolin-induced increase in CKB transcription [19–21] occurs through a pathway involving AP2. Fig. 5A (lanes 1–5) shows that p 188/+5 CKB-CAT(DVE) was

24

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

Fig. 3. Effect of pAP2a in U87 cells on transcription of either wt CKB or mutant CKB promoters with altered AP2 elements. (A) Partial sequence of the proximal CKB promoter in wt p 188/+5 CKB-CAT(DVE) and mutant (mut) CKB promoters containing altered AP2 elements used in transfections. The bars above the sequence denote an AP2 element. In this and subsequent figures, mutated bases introduced into the AP2 elements are shown in underlined, bold italics. (B) CAT expression from either wt p 188/+5 CKB (lanes 1–3), mutant p 10 AP2mut CKB (lanes 4–5) or mutant p 10/ 40 AP2mut CKB (lanes 6– 8). U87 cells were co-transfected with either 0 Ag (lanes 1, 4, 6), 0.75 Ag (lanes 2 and 7) or 5 Ag (lanes 3, 5, 8) of pAP2a. Ac-Chl indicates acetylated chloramphenicol. (C) CAT expression from either wt p 188/+5 CKB (lanes 1 and 2), p 10/ 40 AP2mut CKB (lanes 3 and 4) or p 50 AP2mut CKB (lanes 5–7). Cells were co-transfected with either 0 Ag (lanes 1, 3, 5), 0.75 Ag (lane 6) or 5 Ag (lanes 2, 4 and 7) of pAP2a. Histogram shows level of CAT/h-gal activity which was then normalized to the CAT/h-gal level from U87 cells transfected with wt p 188/+5 CKB-CAT(DVE) but not induced by pAP2a (lane 1); *Pb0.01 compared to lane 1; Duncan’s Multiple Range Test.

transfected into U87 cells either in the absence or presence of DN-pAP2aB plasmid. Cells were then either untreated or treated with forskolin (and IBMX) for 12 h prior to harvest and the level of CAT mRNA was measured and normalized to

the internal control neomycin (Neo) mRNA (Fig. 5B). It was necessary to measure CAT mRNA levels, rather than CAT activity, due to the forskolin-mediated inhibition of the translation of some mRNAs [35]. Fig. 5A and C shows that

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

25

Fig. 4. EMSA shows that NF-Y binds to either the wt or mutant 60/ 32 CKB probe. (A) Sequence of the wt 60/ 32 CKB probe and the mutant probe in which the ( 50) AP2 element has been changed. The bars above the sequence denote each AP2 element; mutated bases are shown in underlined, bold italics. (B) EMSA using the wt 60/ 32 CKB probe (lanes 1 and 2) or the ( 50) AP2 mut 60/ 32 CKB probe (lanes 3 and 4). In vitro-generated NF-Y was incubated either directly with each probe (lanes 1 and 3) or was pre-incubated with a monoclonal antibody (mAb) specific to NF-YA prior to the addition of the probe (lanes 2 and 4). The position of the unbound probe was too low in the gel to be shown.

forskolin induced CAT mRNA synthesis (lanes 1–2) but induction was blocked by DN-pAP2aB in a dose-dependent manner (lanes 3–5). As a positive control in the same experiment, CAT mRNA synthesis was induced by pAP2a (compare lane 1 to 6 and 7) but induction was blocked by DNpAP2aB (lanes 8–10), as seen previously in Fig. 2A. Fig. 5A and C shows that DN-pAP2aB (in the absence of pAP2a) did not affect the basal levels of CAT mRNA transcription (compare lane 1 to 11). In Fig. 5A, lane 12 shows that CAT mRNA was not detected in U87 cells not receiving p 188/+5 CKB-CAT(DVE (lane 12) but was present in transfected HeLa cells (lane 13). It should be noted that the level of induction of CAT mRNA in Fig. 5C is less than the CAT activity induction seen in 1 and 3 due to the (i) lower amounts of the inducing pAP2a that were used so as to facilitate its inhibition by DN-pAP2aB and (ii) the instability of CAT mRNA [24]. 3.5. A protein in U87 nuclear extracts binds to a consensus AP2 probe EMSAs using a consensus AP2 probe (i.e. the AP2 element from the hMTIIa gene; Fig. 6A) showed that AP2a,

which was generated in vitro by TnT (henceforth referred to as in vitro-AP2a), bound this probe (Fig. 6B, lane 1), was completely super-shifted by mAb to AP2a (lane 2) and was competed away with an excess of unlabeled AP2 probe (lanes 3–4). In agreement, a protein in U87 nuclear extracts also bound the AP2-hMTIIa probe (lane 5, band I) and comigrated with in vitro-AP2a bound to probe and was competed by an excess of unlabeled AP2 probe (lanes 7–8). However, the pre-incubation of U87 extract with a mAb to AP2a resulted in a severe decrease in the intensity of band I (Fig. 6B, lane 6) rather than a supershift. While the U87 protein bound well to the AP2 probe, its failure to be supershifted suggested two major possibilities: (i) it might not be the previously-cloned AP2a [23] but rather an AP2arelated protein (henceforth referred to as AP2a-RP) or (ii) in U87 nuclear extracts, the configuration of AP2a is such that the epitope recognized by the antibody is required for AP2a to bind DNA; henceforth, this possibility will be referred to as AP2a*. Previously reported AP2a-RPs, which bind to AP2 elements, have displayed diminished DNA binding rather than a supershift after incubation with antibody to AP2a [36,37] or they showed neither a reduction in DNA binding nor a supershift [36]. In addition, U87 extracts

26

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

Fig. 5. Induction of CKB transcription by forskolin is blocked by a dominant negative AP2a. (A) In lanes 1 to 11, U87 cells were transfected with 4 Ag of p 188/+5 CKB-CAT(DVE) and the indicated amounts of DN-pAP2aB or pAP2a and then CAT mRNA levels were determined in 30 Ag of total cellular RNA after hybridization with the [32P]CAT antisense riboprobe using RPA. In lanes 2–5, cells were treated with 10 AM forskolin and 0.5 mM IBMX for 12 h prior to harvesting. Lanes 3–5 were co-transfected with increasing amounts of pDN-AP2aB (0.75 Ag, 3.75 Ag and 7.5 Ag, respectively). Lanes 6 and 7 were cotransfected with pAP2a (5 Ag and 0.75 Ag, respectively). Lanes 8–10 were co-transfected with 0.75 Ag pAP2a and increasing amounts of pDN-AP2aB (1-, 5and 10-fold molar excess over pAP2a, respectively). In lane 11 as a negative control, U87 were transfected with p 188/+5 CKB-CAT(DVE) and 0.75 Ag of pDN-AP2aB. Lane 12 is a negative control of U87 cells transfected with pRSV-Neo but without p 188/+5 CKB-CAT(DVE). Lane 13 is from HeLa cells transfected with 4 Ag of p 188/+5 CKB-CAT(DVE). The probe lane (P) is the full-length CAT antisense probe; the marker lane (M) is the molecular weight marker pBR322/MspI. (B) RPA of Neo mRNA as an internal control for transfection efficiency; lanes 1–13 correspond to the samples in Panel (A). (C) Histogram of the level of CAT mRNA in each sample after adjustment for the level of Neo mRNA and then normalized to the CAT/Neo mRNA level from U87 cells transfected with 188/+5 CKB-CAT(DVE) but not induced by either forskolin or pAP2a (lane 1). Lanes 1–11 in Panel (C) correspond to lanes 1–11 in Panel (A); *Pb0.05 and **Pb0.01 compared to lane 1; Duncan’s Multiple Range Test.

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

27

Fig. 6. EMSA shows that in vitro-generated AP2a and a protein in U87 nuclear extracts binds the consensus AP2 probe. (A) Sequence of the consensus AP2 probe and wild type (wt) CKB 60/ 32 probe; the bar above the sequence indicates the AP2 site. (B) EMSA with the AP2 probe and either in vitro-generated AP2a (lanes 1–4) or U87 nuclear extract (lanes 5–8). Where indicated, protein was pre-incubated with a mAb to AP2a prior to incubation with [32P] probe (lanes 2 and 6). Excess unlabeled AP2 oligonucleotide was pre-incubated with the protein as a specific competitor (lanes 3, 4 and 7, 8). (C) EMSA was performed using wt CKB 60/ 32 probe and either in vitro-generated NF-Y (lanes 1–2) or U87 nuclear extract (lanes 3–5). In lanes 2 and 5, protein was preincubated with an mAb to NF-YA or a 100-fold excess of unlabeled NF-Y oligonucleotide probe (lane 4). The asterisk marks the position of the nonspecific band.

displayed a second band (see asterisk) that was neither competed by unlabeled AP2 probe nor affected by mAb to AP2a and, thus, appears to be due to a protein binding nonspecifically (lanes 5–8). 3.6. A protein in the U87 nuclear extracts binds to the AP2 elements in the CKB promoter While the EMSAs in Fig. 6B clearly showed that U87 extracts contained a protein that specifically bound the AP2-hMTIIa probe, we wished to establish if this protein could bind to a CKB promoter probe containing the essential ( 50) AP2 element. Therefore, we initially employed a [32P] oligonucleotide probe encompassing the 60 bp to 32 bp region of CKB (i.e. wt 60/ 32

CKB probe, Fig. 6A). Note that this probe contains the ( 50) AP2 element, which upon mutation prevented CKB induction by AP2a (Fig. 3), as well as the ( 50) CCAAT box for NF-Y and the potential ( 40) AP2 element. Fig. 6C shows that the incubation of wt 60/ 32 CKB probe with in vitro-generated NF-Y produced a single band that was completely supershifted by mAb to NF-Y (lanes 1–2); the incubation of this probe with U87 extract produced two closely-spaced bands of which the faster-migrating band not only comigrated with in vitro NF-Y (lane 3) but was competed by excess unlabeled NF-Y probe (lane 4) and was supershifted by mAb to NF-Y (lane 5). In Fig. 6C (lanes 3–5), the band migrating slower than NF-Y would appear to be the AP2a-RP (or AP2a*) in U87 cells that was first observed binding to the AP2-hMTIIa probe (i.e.

28

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

band I in lane 5 of Fig. 6B). In Fig. 6C, it was likely that the AP2a-RP had bound to the ( 50) AP2 site since the sequence of the ( 40) AP2 site (GCCGGCGaC) is unfavorable for binding AP2a [38]. Mohibullah et al. [38] examined a complex set of oligonucleotides capable of binding to AP2a and found that (i) a G residue was always present at position 8 and (ii) the presence of a G in the 1 position (i.e. prior to the GCC motif) greatly reduced binding by AP2a. Indeed, the CKB ( 40) AP2 site has both an A at position 8 and a G at the 1 position (also see below). We further investigated the identity of the AP2a-RP in U87 extracts and whether it binds the ( 50) AP2 element in CKB. We employed either (i) [32P]-probe b 60/ 32 CKB mut 40 AP2Q, which has a mutated ( 40) AP2 site, or (ii) [32P]-probe b 60/ 32 CKB mut 40 AP2/mut G in NF-YQ, which has the same mutated ( 40) AP2 site plus an altered NF-Y element which had been mutated to CCAGT (in accord with the study of Mantovani [27]) so it would not bind NF-Y, however, the ( 50) AP2 element should still bind AP2. In agreement with Fig. 6C, the incubation of U87 extract with probe 60/ 32 CKB mut 40 AP2 generated two closely-spaced bands (Fig. 7B, lane 1) of which the faster band behaved like NF-Y since it was completely supershifted by mAb to NF-Y (lane 6).

The slower band was (i) significantly reduced in intensity by mAb to AP2a (lane 2), (ii) supershifted by antibody to AP2y (lane 5) but (iii) was unaffected by antibody to AP2h and AP2g (lanes 3–4). However, the incubation of U87 extract with probe [32P] 60/ 32 CKB mut 40 AP2/mut G in NF-Y generated only a single band (lane 7) that comigrated with the slower band seen in lane 1. This single band was (i) significantly reduced by mAb to AP2a (lane 8), (ii) supershifted by antibody to AP2y (lane11) but (iii) unaffected by antibody to AP2h and AP2g (lanes 9– 10). Similar conclusions were drawn from EMSAs using U87 extracts in Fig. 7C. Here the [32P] 60/ 32 CKB mut 40 AP2 probe was used in the presence of excess unlabeled NF-Y probe to suppress the binding of NF-Y (lanes 2–6). Lane 1 shows that in the absence of unlabeled NF-Y competitor, probe [32P] 60/ 32 CKB mut 40 AP2 generated two closely-spaced bands of which the faster band was competed away by unlabeled NF-Y probe (lane 2). In the presence of unlabeled NF-Y probe, the single band generated by U87 extracts was diminished by mAb to AP2a (lane 5), supershifted by antibody to AP2y (lane 6) but was not affected by mAb to either NF-YA or NF-YB (lanes 3–4); thus, the latter results confirmed that excess unlabeled NF-Y probe successfully suppressed binding by NF-Y. The use of the [32P] 60/ 32 CKB

Fig. 7. EMSA with U87 nuclear extracts using a 60/ 32 CKB probe containing a mutation in either the ( 40) AP2 site or in both the ( 40) AP2 site and the ( 50) NF-Y site. (A) Sequence of the 60/ 32 CKB mut 40 AP2 probe showing the mutant ( 40) AP2 site and the 60/ 32 CKB mut 40 AP2/mut G in NFY probe showing the mutant ( 40) AP2 site and the mutant G in the ( 50) NF-Y site. Mutated bases are shown in underlined, bold italics; lower case letters are bases in wt CKB that deviate from the consensus AP2 site. (B) EMSA using the 60/ 32 CKB mut 40 AP2 probe (lanes 1–6) or 60/ 32 CKB mut 40 AP2/mut G in NFY probe (lanes 7–11). Where indicated, U87 extract was preincubated with antibody specific for either AP2a, h, g, y (lanes 2–5 and 8– 11) or NF-YA (lane 6) prior to incubation with the [32P] probe. The positions of NF-Y, AP2, super-shifted (SS) NF-Y and SS-AP2y are indicated. (C) EMSA using the 60/ 32 CKB mut 40 AP2 probe (lanes 1–6) or 60/ 32 CKB mut 40 AP2/mut G in NFY probe (lanes 7–11). Where indicated, U87 extract was preincubated with antibody specific for either NF-YA, NF-YB, AP2a, AP2y (lanes 3–6 and 9–11) or with excess (100-fold) unlabeled NF-Y oligo (lanes 2– 6 and 8) prior to incubation with the [32P] probe. The position of unbound probe was too low in the gel to be shown.

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

mut 40 AP2/mut G probe generated only a single band (lane 7) that was reduced in intensity by mAb to AP2a (lane 10), supershifted by antibody to AP2y (lane 11) but was unaffected by mAb to NF-YA (lane 9) and excess unlabeled NF-Y probe (lane 8), which reconfirmed that this band did not contain NF-Y. In summary, the intensity of the slower band was reduced by mAb to AP2a by 43%F17% (n=4) and antibody to AP2y reduced it by 38%F8% (n=4) while the faster band was displaced completely either by mAb to NF-Y or excess competitor NF-Y probe. Therefore, Fig. 7 shows that the faster band contained NF-Y and the slower band contained AP2y as well as AP2a-RP since it was supershifted by antibody to AP2y significantly but not completely (due to residual AP2a-RP [or AP2a*]) and was reduced by mAb to AP2a significantly but not completely (due to residual AP2y). The AP2a-RP (or AP2a*) and AP2y (i) bound to the probe despite the absence of the ( 40) AP2 site and, therefore, must have bound to the ( 50) AP2 element and (ii) would appear to be in separate complexes which comigrate electrophoretically. Since these EMSAs were performed in probe excess, it is not presently known if AP2 and NF-Y can be bound to the same probe simultaneously.

29

3.7. In vitro-generated AP2a binds more efficiently to longer CKB proximal promoter fragments Fig. 3 showed that AP2a increased CKB transcription in transfected U87 cells by a mechanism dependent upon the 50 AP2 element in CKB. However, the EMSA in Fig. 8A shows that in vitro-AP2a did not bind to the wt 60/ 32 CKB probe with great affinity and a detectable, shifted band was only seen with higher amounts of in vitro-AP2a (lanes 1–2). Conversely, in vitro-AP2a readily bound the AP2-hMTIIa probe and was supershifted by mAb to AP2a (lanes 3–4). Therefore, we tested if in vitro-AP2a bound more efficiently to a longer CKB promoter probe that contained all four AP2 elements. Fig. 8B shows that in vitro-AP2a bound more readily to a CKB probe from 90 bp to +5 bp and generated a major and a minor band (lane 3) which were supershifted by antibody to AP2a (lane 4). The minor band in lane 3 might be a probe which has bound more than one AP2. Fig. 8B also shows that in vitro-AP2a bound to a 75/+5 CKB probe (lane 7) and was supershifted by mAb to AP2a (lane 8), although binding was less than to the 90/+5 CKB probe. Therefore, the AP2a-mediated increase in CKB transcription in transfected U87 cells

Fig. 8. EMSAs with in vitro-generated AP2a using either the consensus AP2 probe or wt CKB probes of varying length. (A) EMSAs with in vitro-AP2a using either wt 60/ 32 CKB probe (lanes 1–2) or consensus AP2 probe (lanes 3–4). Lane 2 contained twice the amount of in vitro-AP2a as the other lanes; in lane 4, AP2a was pre-incubated with mAb to AP2a. The position of unbound probe was too low in the gel to be shown. (B) EMSAs with in vitro-AP2a using either a wt CKB probe with sequence from 90 bp to +5 bp (lanes 1–4) or from 75 bp to +5 bp (lanes 5–8). Controls for probe not incubated with in vitro-AP2a (lanes 1and 5) or probe incubated with reticulocyte lysate not programmed with AP2a mRNA (lanes 2 and 6) are shown. In vitro-AP2a was incubated either directly with each probe (lanes 3 and 7) or pre-incubated with mAb to AP2a prior to the addition of probe (lanes 4 and 8). The position of the unbound (free) probe is indicated by F.P.

30

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

likely results from the high expression of AP2a during transfection with the stable binding of AP2a to the ( 50) AP2 element (i) being essential and (ii) possibly increased by other nuclear proteins that bind to the CKB promoter (e.g. NF-Y).

4. Discussion Previously we showed in U87-MG glioblastoma that the CKB promoter sequence from 80 bp to +5 bp was sufficient for the forskolin-mediated induction of CKB transcription despite the absence of a CRE element [21]. This report shows that the 80 to +5 CKB promoter contains four potential AP2 elements, each of which matches the AP2 consensus in eight of the nine bp, and that the cotransfection of U87 cells with a plasmid expressing AP2a induced CKB transcription via a pathway absolutely requiring the AP2 element located at 50 bp (Fig. 3). In agreement, the cotransfection of a plasmid expressing a dominant negative form of AP2 blocked the induction of CKB transcription not only by AP2a (Fig. 2) but, in separate experiments, also by forskolin treatment which indicates that the forskolin-mediated elevation in cAMP also increases CKB transcription via AP2 (Fig. 5). This is the first report of AP2 regulating CKB transcription. Experiments using site-directed mutagenesis to systematically change each of the four AP2 elements in the CKB 188 bp to +5 bp promoter showed that the ( 50) AP2 element was essential for the AP2-mediated induction of CKB (Fig. 3). For example, the mutation of just the ( 10) AP2 element reduced AP2-mediated induction of CKB by an average of only 24%; this was not reduced further when both the ( 10) and ( 40) AP2 elements were mutated suggesting that the ( 40) AP2 element may not be significant in induction by AP2. Similarly, the mutation of just the ( 80) AP2 element reduced the AP2-mediated induction of CKB by an average of only 22%. However, when only the ( 50) AP2 element was mutated, there was no AP2-mediated induction of the CKB 188/+5 promoter which indicated that the minor contributions made by the ( 80) and ( 10) AP2 elements must be directed through the ( 50) AP2 element. Interestingly, the ( 50) AP2 element sequence (GCCAATGGG) contains within it a CCAAT binding site for factor NF-Y. Indeed, EMSAs showed that NF-Y, which was either generated in vitro (Fig. 4) or present in U87 nuclear extracts (Figs. 6 and 7), bound to the ( 50) AP2 element. To our knowledge, this is the first report (i) of an AP2 element which contains within it an NFY site and of a promoter with multiple AP2 elements where the mutation of one specific AP2 element inhibits the contributions of the others; and (ii) that NF-Y binds to a CCAAT element in CKB. This raises the possibility that NFY facilitates binding of AP2 at the ( 50) site and/or that interplay between NF-Y and AP2 might regulate CKB

transcription. In this regard, it is of interest why the ( 80) AP2 element, which has the sequence GCCAATGGA and should also be able to bind AP2 and NF-Y, does not contribute to AP2 -mediated induction of CKB without a functional ( 50) AP2 element present. It is possible that the differences in the sequences immediately flanking the ( 80) and ( 50) AP2 elements can affect the ability of AP2 and NF-Y to bind in vivo. Also, in U87 glioblastoma, the ( 80) AP2 site might be occupied by a protein that binds the CCAAT motif (e.g. CCAAT displacement factor [39], CTF [40], or C/EBP [41]) and prevents binding of AP2 and/or NF-Y. We used several probes containing either the wt or mutant CKB promoter sequence from 60 bp to 32 bp in EMSAs to show that U87 nuclear extracts contained protein(s) that bound to the ( 50) AP2 site. Because the CCAAT element is part of the ( 50) AP2 site, one 60/ 32 CKB probe containing a single bp mutation in the ( 50) AP2 site (i.e. GCCAGTGGG) was especially useful since it no longer bound NF-Y but retained, at the ( 50) site, its ability to bind an AP2 protein in U87 extracts. This probe also had a mutated ( 40) AP2 site and was called b 60/ 32 CKB mut 40 AP2/mut G in NF-YQ (Fig. 7). A U87 protein(s) clearly bound this probe, however, an mAb to AP2a did not supershift it but rather reduced its binding to DNA; however, the protein was not affected by antibody to AP2h or AP2g (Fig. 7B and C). The failure of this protein to be supershifted suggested two major possibilities: (i) it might not be the previouslycloned AP2a [23] but rather an AP2a-related protein (i.e. an AP2a-RP) or (ii) in U87 nuclear extracts, the configuration of AP2a is such that the epitope bound by the antibody is necessary for AP2a to bind DNA; this possibility is referred to as AP2a*. Previously reported AP2a-RPs also displayed reduced DNA binding rather than a supershift after incubation with antibody to AP2a [36,37] or displayed neither a reduction in DNA binding nor a supershift [36]. In addition, this CKB probe also bound to a U87 protein that was supershifted by antibody to AP2y (Fig. 7B and C) and, therefore, U87 extracts appear to contain both an AP2a-RP and AP2y. It is interesting that the CKB ( 50) AP2 site is GCCAATGGG in view of previous reports which showed that AP2 sites that are AT-rich in the (central) N4N5N6 positions are not preferred by in vitro-generated AP2a [38] but are preferred by in vitro-AP2y [42]. This may explain why the U87 protein that bound the CKB ( 50) AP2 site behaved like an AP2a-RP and not like in vitro-AP2a and why the ( 50) site also bound AP2y in U87 extracts (Fig. 7). A second probe, b 60/ 32 CKB mut 40 AP2Q, which was mutated only in the ( 40) AP2 site, could bind NF-Y as well as AP2a-RP and AP2y (Fig. 7). However, since these EMSAs were performed in probe excess, further experiments are required to establish if both NF-Y and AP2 can bind to the ( 50) site simultaneously and whether this occurs in vivo.

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

Additional EMSAs showed further differences between AP2a-RP in U87 and the in vitro-AP2a. (i) While both in vitro-AP2a and the AP2a-RP in U87 readily bound the AP2-hMTIIa probe, mAb to AP2a supershifted in vitroAP2a but rather reduced the AP2a-RP bound to probe (Fig. 6B). (ii) Using the wt CKB 60/ 32 probe, the AP2a-RP in U87 bound well (Fig. 6C) but in vitro-AP2a bound poorly (Fig. 8A). However, in vitro-AP2a bound more readily to the longer CKB 90/+5 probe that contained all four AP2 elements (Fig. 8B). It is presently not known whether the AP2a in U87 is an AP2a-RP, a splice variant of AP2a or if a nuclear protein(s) in U87 cells associates with AP2a and alters its DNA-binding characteristics (e.g. so it is not supershifted by mAb to AP2a but rather is diminished in DNA-binding ability). However, the differences observed between AP2a in U87 and the in vitro-AP2a in binding to probes 60/ 32 CKB and AP2-hMTIIa and the effects therein of antibody to AP2a (Figs 6–8) might suggest that an AP2a-RP is the most likely possibility. Recent studies demonstrate that the mechanisms by which the AP2 protein family regulates gene expression can be complex, as exemplified by the genes for catecholamine synthesis. The expression of tyrosine hydroxylase (TH) in adrenergic and noradrenergic neuronal cells was dependent on AP2a while in dopaminergic neurons, the expression of TH was independent of AP2a [34]. In addition, the TH 5V promoter region has six AP2 elements and the mutation of at least four of them is required to inhibit transcription. In contrast, the dopamine h-hydroxylase (DBH) promoter has a single AP2 element which, when mutated, eliminates AP2-dependent transcription [34]. Our results present a different situation with the CKB 188/+5 promoter which has four potential AP2 elements but only the ( 50) AP2 element is essential for the AP2-mediated induction of CKB in U87 cells. Therefore, the regulation of genes like CKB, TH and DBH may vary among different cell types and might differ in specific anatomical regions within the nervous system. Indeed, the cell-specific transcription coactivators NurrI, Phox2a and Ptx3 have been implicated in the expression of TH in distinct brain cell types ([34] and references therein). Another catecholaminespecific gene promoter, PNMT, has several AP2 elements and is transactivated by AP2 in cooperation with glucocorticoid receptor and factor Egr-1 ([34] and references therein). This suggests an important role for the AP2 protein family in the phenotypic determination and maintenance of different neurons expressing TH and DBH as well as a number of other neural-specific genes [34] and possibly CKB. This adds to the previously established role of AP2 in neuroectodermal and neural crest lineage cells [16,43] and in early skeletal and eye development [44]. Indeed, the possible co-expression of a cell-type transcription coactivator(s) (e.g. NurrI, Phox2a) which might cooperate with an AP2a-RP similar to that

31

in U87 cells (or with AP2y)? may underlie the mechanism by which elevated cAMP may increase CKB transcription in specific glial and neuronal cells. Such regulation of CKB cannot be explained by the cAMP pathway that activates the CREB protein and gene promoters containing CRE elements, since the cAMP/ CREB pathway is not cell-type specific. We have previously shown with primary cell cultures derived from neonatal rat brain cerebrum that CKB mRNA levels in differentiated astrocytes and oligodendrocytes were much higher (15- to 17-fold) than in embryonic neurons [19]. However, in adult rat brain, significant amounts of CKB protein were found in some neurons, principally in neuronal processes and enriched in the synaptic layers of the cerebellum and hippocampus [3]. This suggests that as some neurons mature, the expression of CKB increases, possibly to support synaptic transmission [3]. Since AP2y is expressed in brain [42], it will be of interest to determine whether AP2y (and/or the AP2a-RP present in U87 cells) is involved in regulating CKB transcription in distinct glial and neuronal cell types either during differentiation or in pathological situations which alter cell physiology and/or morphology. An additional likely possibility is that, in some non-neural cell types, the regulation of CKB expression involves the (previously-cloned) AP2a. Indeed, AP2 might be involved in regulating other genes affecting energy metabolism since AP2 may be involved in regulating the transcription of the Very-Long-Chain Acyl-CoA dehydrogenase gene in cardiomyocytes [45]. Interestingly, since the sequence of the ( 80) and ( 50) AP2 elements is very highly conserved evolutionarily (e.g. human and rat [13], mouse [46], chicken [47]), this would suggest that the cAMP/ AP2 pathway plays a major role in regulating CKB transcription.

Acknowledgments We thank the following individuals for providing the indicated reagents: Dr. Trevor Williams (University of Colorado Medical Center) for antibodies to AP2a (5E4), AP2h (h94), AP2g (g96) and AP2y and expression plasmid for DN-AP2DN278; Dr. Reinhard Buettner (Institute for Pathology, Bonn, Germany) for expression plasmids for AP2a and AP2aB; Dr. Roberto Mantovani (University of Modena, Modena, Italy) for the NF-Y expression plasmids and mAb to NF-YA and NF-YB; Dr. Ann Louise Olson (University of Oklahoma) for the plasmid used to generate the CAT riboprobe. We thank Dr. Eldo Kuzhikandathil (UMDNJ New Jersey Medical School) for a critical review of an early version of the manuscript and Margie Barret for the preparation of the figures. This research was initiated with a grant from the National Multiple Sclerosis Society (PP0868) and the American Heart Association (9951419U).

32

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

References [1] T. Wallimann, M. Wyss, D. Brdiczka, K. Nicolay, H.M. Eppenberger, Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the dphosphocreatine circuitT for cellular energy homeostasis, Biochem. J. 281 (1992) 21 – 40. [2] L. Chen, R. Roberts, D.L. Friedman, Expression of brain-type creatine kinase and ubiquitous mitochondrial creatine kinase in the fetal rat brain: evidence for a nuclear energy shuttle, J. Comp. Neurol. 363 (1995) 389 – 401. [3] D.L. Friedman, R. Roberts, Compartmentation of brain-type creatine kinase and ubiquitous mitochondrial creatine kinase in neurons: evidence for a creatine phosphate energy shuttle in adult rat brain, J. Comp. Neurol. 343 (1994) 500 – 511. [4] P. Manos, G.K. Bryan, J. Edmond, Creatine kinase activity in postnatal rat brain development and in cultured neurons, astrocytes, and oligodendrocytes, J. Neurochem. 56 (1991) 2101 – 2107. [5] V.B. Mahajan, K.S. Pai, A. Lau, D.D. Cunningham, Creatine kinase, an ATP-generating enzyme, is required for thrombin receptor signaling to the cytoskeleton, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 12062 – 12067. [6] T. Wallimann, D. Walzthony, G. Wegmann, H. Moser, H.M. Eppenberger, F.J. Barrantes, Subcellular localization of creatine kinase in Torpedo electrocytes: association with acetylcholine receptor-rich membranes, J. Cell Biol. 100 (1985) 1063 – 1072. [7] P. Urdal, K. Urdal, J.H. Stromme, Cytoplasmic creatine kinase isoenzymes quantitated in tissue specimens obtained at surgery, Clin. Chem. 29 (1983) 310 – 313. [8] G.R. Molloy, C.D. Wilson, P. Benfield, J. de Vellis, S. Kumar, Rat brain creatine kinase messenger RNA levels are high in primary cultures of brain astrocytes and oligodendrocytes and low in neurons, J. Neurochem. 59 (1992) 1925 – 1932. [9] P. Morell, A.H. Ousley, Metabolic turnover of myelin glycerophospholipids, Neurochem. Res. 19 (1994) 967 – 974. [10] P.J. Magistretti, L. Pellerin, D.L. Rothman, R.G. Shulman, Energy on demand, Science 283 (1999) 496 – 497. [11] S.H. Oliet, R. Piet, D.A. Poulain, Control of glutamate clearance and synaptic efficacy by glial coverage of neurons, Science 292 (2001) 923 – 926. [12] K.S. Pai, V.B. Mahajan, A. Lau, D.D. Cunningham, Thrombin receptor signaling to cytoskeleton requires Hsp90, J. Biol. Chem. 276 (2001) 32642 – 32647. [13] G.M. Hobson, M.T. Mitchell, G.R. Molloy, M.L. Pearson, P.A. Benfield, Identification of a novel TA-rich DNA binding protein that recognizes a TATA sequence within the brain creatine kinase promoter, Nucleic Acids Res. 16 (1988) 8925 – 8944. [14] M.T. Mitchell, P.A. Benfield, Two different RNA polymerase II initiation complexes can assemble on the rat brain creatine kinase promoter, J. Biol. Chem. 265 (1990) 8259 – 8267. [15] D.W. Raible, F.A. McMorris, Induction of oligodendrocyte differentiation by activators of adenylate cyclase, J. Neurosci. Res. 27 (1990) 43 – 46. [16] J. Philipp, P.J. Mitchell, U. Malipiero, A. Fontana, Cell type-specific regulation of expression of transcription factor AP-2 in neuroectodermal cells, Dev. Biol. 165 (1994) 602 – 614. [17] J. Padmanabhan, D. Clayton, M.L. Shelanski, Dibutyryl cyclic AMP-induced process formation in astrocytes is associated with a decrease in tyrosine phosphorylation of focal adhesion kinase and paxillin, J. Neurobiol. 39 (1999) 407 – 422. [18] M.A. Garcia, J. Vazquez, C. Gimenez, F. Valdivieso, F. Zafra, Transcription factor AP-2 regulates human apolipoprotein E gene expression in astrocytoma cells, J. Neurosci. 16 (1996) 7550 – 7556. [19] E.V. Kuzhikandathil, G.R. Molloy, Transcription of the brain creatine kinase gene in glial cells is modulated by cyclic AMP-dependent protein kinase, J. Neurosci. Res. 39 (1994) 70 – 82.

[20] E.V. Kuzhikandathil, G.R. Molloy, Prostaglandin E1, E2, and cholera toxin increase transcription of the brain creatine kinase gene in human U87 glioblastoma cells, Glia 15 (1995) 471 – 479. [21] E.V. Kuzhikandathil, G.R. Molloy, Proximal promoter of the rat brain creatine kinase gene lacks a consensus CRE element but is essential for the cAMP-mediated increased transcription in glioblastoma cells, J. Neurosci. Res. 56 (1999) 371 – 385. [22] R. Buettner, P. Kannan, A. Imhof, R. Bauer, S.O. Yim, R. Glockshuber, M.W. Van Dyke, M.A. Tainsky, An alternatively spliced mRNA from the AP-2 gene encodes a negative regulator of transcriptional activation by AP-2, Mol. Cell. Biol. 13 (1993) 4174 – 4185. [23] T. Williams, R. Tjian, Analysis of the DNA-binding and activation properties of the human transcription factor AP-2, Genes Dev. 5 (1991) 670 – 682. [24] C.D. Wilson, B. Parameswaran, G.R. Molloy, Expression of the rat brain creatine kinase gene in C6 glioma cells, J. Neurosci. Res. 35 (1993) 92 – 102. [25] J. Zhao, F.I. Schmieg, N. Logsdon, D. Freedman, D.T. Simmons, G.R. Molloy, p53 binds to a novel recognition sequence in the proximal promoter of the rat muscle creatine kinase gene and activates its transcription, Oncogene 13 (1996) 293 – 302. [26] W. Shen, D. Willis, Y. Zhang, U. Schlattner, T. Wallimann, G.R. Molloy, Expression of creatine kinase isoenzyme genes during postnatal development of rat brain cerebellum: evidence for transcriptional regulation, Biochem. J. 367 (2002) 369 – 380. [27] R. Mantovani, A survey of 178 NF-Y binding CCAAT boxes, Nucleic Acids Res. 26 (1998) 1135 – 1143. [28] J.M. Bosher, N.F. Totty, J.J. Hsuan, T. Williams, H.C. Hurst, A family of AP-2 proteins regulates c-erbB-2 expression in mammary carcinoma, Oncogene 13 (1996) 1701 – 1707. [29] M.V. Thai, S. Guruswamy, K.T. Cao, J.E. Pessin, A.L. Olson, Myocyte enhancer factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice. Regulation of MEF2 DNA binding activity in insulin-deficient diabetes, J. Biol. Chem. 273 (1998) 14285 – 14292. [30] G.M. Hobson, G.R. Molloy, P.A. Benfield, Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene, Mol. Cell. Biol. 10 (1990) 6533 – 6543. [31] B. Bond-Matthews, N. Davidson, Transcription from each of the Drosophila act5C leader exons is driven by a separate functional promoter, Gene 62 (1988) 289 – 300. [32] J.M. Bosher, T. Williams, H.C. Hurst, The developmentally regulated transcription factor AP-2 is involved in c-erbB-2 overexpression in human mammary carcinoma, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 744 – 747. [33] C. LiCalsi, S. Christophe, D.J. Steger, M. Buescher, W. Fischer, P.L. Mellon, AP-2 family members regulate basal and cAMP-induced expression of human chorionic gonadotropin, Nucleic Acids Res. 28 (2000) 1036 – 1043. [34] H.S. Kim, S.J. Hong, M.S. LeDoux, K.S. Kim, Regulation of the tyrosine hydroxylase and dopamine beta-hydroxylase genes by the transcription factor AP-2, J. Neurochem. 76 (2001) 280 – 294. [35] S. Naderi, K.B. Gutzkow, J. Christoffersen, E.B. Smeland, H.K. Blomhoff, cAMP-mediated growth inhibition of lymphoid cells in G1: rapid down- regulation of cyclin D3 at the level of translation, Eur. J. Immunol. 30 (2000) 1757 – 1768. [36] H. Allgayer, H. Wang, Y. Wang, M.M. Heiss, R. Bauer, O. Nyormoi, D. Boyd, Transactivation of the urokinase-type plasminogen activator receptor gene through a novel promoter motif bound with an activator protein-2alpha-related factor, J. Biol. Chem. 274 (1999) 4702 – 4714. [37] B.S. Lee, I. Krits, M.K. Crane-Zelkovic, S.L. Gluck, A novel transcription factor regulates expression of the vacuolar H+-ATPase B2 subunit through AP-2 sites during monocytic differentiation, J. Biol. Chem. 272 (1997) 174 – 181. [38] N. Mohibullah, A. Donner, J.A. Ippolito, T. Williams, SELEX and missing phosphate contact analyses reveal flexibility within the AP-

D. Willis et al. / Biochimica et Biophysica Acta 1728 (2005) 18–33

[39]

[40] [41]

[42]

[43]

2[alpha] protein: DNA binding complex, Nucleic Acids Res. 27 (1999) 2760 – 2769. A. Nepveu, Role of the multifunctional CDP/Cut/Cux homeodomain transcription factor in regulating differentiation, cell growth and development, Gene 270 (2001) 1 – 15. R.M. Gronostajski, Roles of the NFI/CTF gene family in transcription and development, Gene 249 (2000) 31 – 45. Q.S. Zhu, B. Qian, D. Levy, CCAAT/enhancer-binding protein alpha (C/EBPalpha) activates transcription of the human microsomal epoxide hydrolase gene (EPHX1) through the interaction with DNA-bound NF-Y, J. Biol. Chem. 279 (2004) 29902 – 29910. F. Zhao, M. Satoda, J.D. Licht, Y. Hayashizaki, B.D. Gelb, Cloning and characterization of a novel mouse AP-2 transcription factor, AP-2delta, with unique DNA binding and transactivation properties, J. Biol. Chem. 276 (2001) 40755 – 40760. P.J. Mitchell, P.M. Timmons, J.M. Hebert, P.W. Rigby, R. Tjian, Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis, Genes Dev. 5 (1991) 105 – 119.

33

[44] J. Zhang, S. Hagopian-Donaldson, G. Serbedzija, J. Elsemore, D. Plehn-Dujowich, A.P. McMahon, R.A. Flavell, T. Williams, Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2, Nature 381 (1996) 238 – 241. [45] Y. Zhou, D.P. Kelly, A.W. Strauss, H. Sims, Z. Zhang, Characterization of the human very-long-chain acyl-CoA dehydrogenase gene promoter region: a role for activator protein 2, Mol. Genet. Metab. 68 (1999) 481 – 487. [46] J. van Deursen, J. Schepens, W. Peters, D. Meijer, G. Grosveld, W. Hendriks, B. Wieringa, Genetic variability of the murine creatine kinase B gene locus and related pseudogenes in different inbred strains of mice, Genomics 12 (1992) 340 – 349. [47] T. Wirz, U. Brandle, T. Soldati, J.P. Hossle, J.C. Perriard, A unique chicken B-creatine kinase gene gives rise to two B-creatine kinase isoproteins with distinct N termini by alternative splicing, J. Biol. Chem. 265 (1990) 11656 – 11666.