- Email: [email protected]
Transcription of the fish Latent TGFβ-binding protein gene is controlled by estrogen receptor α
Toxicology in Vitro 20 (2006) 417–425 www.elsevier.com/locate/toxinvit
Transcription of the fish Latent TGFb-binding protein gene is controlled by estrogen receptor a Monika L. Andersson b
a,*
, Rik I. Eggen
b
a Department of Biosciences, Karolinska Institute, Novum, SE 14157, Huddinge, Sweden Swiss Federal Institute for Environmental Science and Technology (EAWAG), Du¨bendorf, Switzerland
Received 29 June 2005; accepted 8 August 2005 Available online 19 September 2005
Abstract In endocrine disruption a key role has been suggested for endocrine receptors, in particular the estrogen receptors (ERs), in the regulation by compounds mimicking natural hormones. The two ERs, ERa and ERb are transcription factors involved in the regulated expression of estrogen target genes and have been shown to play an essential role in mammalian ovary development. A similar role is to be expected for ERs in fish; little is, however, known in fish about genes regulated by ERs. To begin to address this, we here report the identification and characterization of a novel gene regulated by the fish ERa in response to 17b-estradiol. This gene encodes a fish orthologue of the latent transforming growth factor beta binding protein 3 (LTBP-3) and was identified through a differential display approach from a rainbow trout gonad cell line (RTG-2-ERa). We show that the rainbow trout LTBP (rtLTBP-3) is ERa dependent and is upregulated 5-fold in response to 17b-estradiol addition. The rtLTBP shows 61% amino acid similarity to human LTBP-3 and 48%, 44% and 41% to LTBP-1, LTBP-2 and LTBP-4, respectively. The highly conserved TB2 domain of rtLTBP shows 87% and 66% identity to the TB domains of human LTBP-3 and LTBP-1, respectively. LTBP plays a pivotal role in TGFb activation in mammals and the high degree of sequence similarity suggests a similar role in fish. This would represent a novel link between nuclear hormone receptors and growth factor (TGFb) mediated developmental processes, and show new aspects of the role of hormones in developmental biology and endocrine disruption. 2005 Elsevier Ltd. All rights reserved. Keywords: Transcription; Estrogen receptor; TGFb; Binding protein; Trout gonad cells
1. Introduction Endocrine disrupter (EDC) is a common denominator for substances that can interfere with and/or mimic natural hormones in animals. The persistence and accumulation of these compounds is considered as a serious problem in the aquatic environment (http://europa.eu. int/comm/research/endocrine/pdf/env4-ct98-0798.pdf). Much attention has been given in recent years to endocrine disruption by estrogenic compounds (Eggen et al., 2003) and exposure has in fish been shown to cause in*
Corresponding author. Tel.: +46 8 6089100; fax: +46 8 7745538. E-mail address: [email protected] (M.L. Andersson).
0887-2333/$ - see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.tiv.2005.08.010
creased vitellogenin production, malformations of fish gonads in males (Tyler et al., 1998), reduced fertility, inhibition of testicular differentiation (Gimeno et al., 1996) and occurrence of intersexuality in roach as a result from exposure to estrogenic sewage treatment work effluents (Jobling et al., 2002). Common for many estrogenic EDCs is their ability, despite with different affinities, to bind to estrogen receptors (ERs). ERs belong to the family of nuclear receptors, are highly conserved among species, and function as tissue specific transcription factors (for review see McDonnell and Norris, 2002). Two related ERs, ERa and ERb, have been identified in both fish and mammals (Green and Chambon, 1986; Greene et al., 1986; Kuiper et al., 1996; Pakdel
418
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
et al., 1994; Todo et al., 1996) and in two species of fish a third type of ER (ER gamma) has been reported (Hawkins et al., 2000; Sabo-Attwood et al., 2004). In rainbow trout the ERb (GenBank accession number AJ289883) and the ERa have been identified and isolated (Pakdel et al., 1990). Recently also a shorter form of ERa has been identified in rainbow trout (Menuet et al., 2001). ERs in mammals and in fish are activated by the natural ligand 17b-estradiol. The ligand-bound ER binds to upstream enhancer and promoter regions of estrogen target genes and regulates these genes through activated or repressed transcription. The ER mediating effects of the natural ligand and of EDCs have been in focus in the developing organs responsible for reproduction. The ovaries of fish and mammals express ERs (Couse et al., 1999; Nagler et al., 2000). Sub-cutaneous injections of 17b-estradiol into normal female mice showed that the uterus after three days was expressing higher levels of ERa but a reduced levels of ERb mRNA (Weihua et al., 2000). The importance of ERs in fertility has mainly been obtained by using knock out mice. The possibility of female prepubertal wild type mice to superovulate and produce eggs in response to administration of gonadotropins does not occur in the corresponding mice that lack the ERa gene. One conclusion from these studies was that the growth of the follicles of the ovaries is dependent on ERa (Dupont et al., 2000). The effects by environmental hormones in this system has not been tested. A number of responsive genes that are activated or repressed in presence of ligand have been identified in mammalian species. The natural estrogen ligand, the 17b-estradiol, bind to ERa and to ERb and each ligand bound complex have a capacity to distinguish and bind specific genes, a control influenced by the ability of ERa and ERb to select in their recruitment of co-activators and co-repressors (Moehren et al., 2004). Also ligands other than the natural estradiol alter the regulation through a structural change of the receptor bound complex (Routledge et al., 2000). ERa specific target genes have been described in mice such as the nitric oxide (NO) synthase and the cyclooxygenase genes (Geary et al., 2001) and the Y-Y(1) gene that in neural cells was regulated by ERa, but showed no transcriptional effects through ERb (Musso et al., 2000). The ER isoform specificity was also shown in aorta tissue in which estradiol induced NO through ERa but not through the beta form of ER (Darblade et al., 2002b). Yet there are other examples of ER/17b-estradiol induced target genes of which many were identified before the discovery of the ERb (Kuiper et al., 1996). A great deal is known about genes that are controlled by ligand induction of estrogen receptors in mammals, but considerable less is known in fish. In fish there are only a few estrogen target genes known and the two major groups of such genes are the vitellogenin and
the zona radiate genes encoding the egg-yolk precursor proteins and egg shell proteins, respectively (Hyllner et al., 1991; Oppen-Berntsen et al., 1992). In adult fish these proteins are activated by ERs in liver in which the ERa is the predominantly expressed isoform. It has yet to be demonstrated if transcription occurs through this receptor isoform. To obtain information on new target genes in fish is critical, in order to understand the molecular mechanisms underlying endocrine disruption and to obtain biomarkers to detect effects of various known and potential endocrine disrupters. We have isolated a gene in fish cells, the LTBP-3 orthologue of the mammalian gene, that have the potential of becoming a biomarker for EDCs in fish.
2. Material and methods 2.1. Fish cell cultures The cell line RTG-2 (Wolf and Quimby, 1962) was established from gonads of juvenile rainbow trout (Oncorhynchus mykiss). The RTG-2-ERa (Ackermann et al., 2002) is a stable transfected cell line expressing the rainbow trout estrogen receptor alpha (Pakdel et al., 1990). Cells were maintained in DulbeccoÕs Modified Eagles Medium/Nutrient Mixture F12 with Hepes buffer (Gibco-BRL, Life Technologies Basel, Switzerland) containing 5% fetal bovine serum. Cells were grown at 20 C without CO2 supplement. Before the exposure experiments the cells were kept for 3 days in Turbodoma medium without phenol red (Dr F Messi Cell Culture Technologies GmbH Zurich, Switzerland) containing 5% charcoal stripped bovine serum (Sigma Cell Culture Buchs, Switzerland). 22 · 106 cells were exposed to 100 nM 17b-estradiol or to 200 nM of the estrogen inhibitor ICI164384. 2.2. Total RNA extraction and reverse transcription Total RNA was extracted from 50 · 106 cells using Trizol reagent (Life Technologies, Switzerland). One microgram of RNA was reverse transcribed using Moloney murine leukemia virus (MMLV) reverse transcriptase in a total volume of 25 ll. A mixture of 0.5 pM of reverse primer oligo-dT1218 (Amersham-Biotech, Switzerland) or of the two-anchored poly-T reverse primers (Nordqvist and Tohonen, 1997) together with all four dNTPs (1 mM) was heated to 65 C for 5 min and 37 C for 10 min prior to addition of the reverse transcriptase and 10 U of RNAsin (Promega). Controls omitting the enzyme were included. RT reactions were incubated at 37 C for 60 min followed by inactivation at 70 C for 5 min. The first strand cDNAs were diluted 20-fold and kept at 4 C.
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
419
2.3. Differential display
2.5. SYBR Green labeling of DNA
One microliter of the first-strand cDNA synthesis reaction was taken in a total volume of 25 ll containing 10 mM tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 2 lM of dGTP, 2 lM of dCTP and 2 lM of dTTP, 12.5 lM of the 3 0 primer (T11-CA, T11-GC or T11-AG), 12.5 lM of one of the 10 different 5 0 primers named MAL1 to MAL10 which was designed according to Nordqvist and Tohonen (Nordqvist and Tohonen, 1997). 1 unit of Taq polymerase (Life Technologies, Switzerland), 2 lCi of 33P labeled dATP (3000 Ci/ mmole, Amersham) and 2 lM of non-radioactive dATP were amplified at 30 s denaturing at 94 C, 120 s annealing at 42 C, 30 s extension at 72 C, 40 cycles. A layer of light mineral oil (Sigma) was added on top of the reaction solution. A 35 cm long 6%/7 M urea acrylamide gel was pre-run for 30 min at 1670 V in 1·TBE buffer. Ten microliters of the reaction volume was mixed with 2.5 ll sample buffer and denatured for 2 min prior to loading. In control lanes corresponding samples from RTG-2 cells and from RTG-2-ERa cells treated with solvent (DMSO) or with the ligand ICI 164384 were applied. Sham controls were run in parallel. Buffer was changed and gels were run for 4 h at 1670 V. Gels were placed on 3MM paper, covered with Saran wrap and dried in a gel dryer for 1 h. To locate bands on the gel a trace amount of isotope in black ink was spotted and the gel was exposed to autoradiograph film over night. Next day bands of interest were cut out from the gel with clean razor blades. The piece of gel containing DNA was placed in an Eppendorf tube containing 100 ll of ddH2O, and allowed to rehydrate at room temperature for 2 h and DNA was separated from the acrylamide in mini spin columns (Pharmacia-Amersham). One microliter of DNA was taken as template in PCRs using the same reaction conditions as above except that 12.5 lM of non-labeled dATP was added in exchange for 33P labeled dATP. Products were separated on 2% agarose gels.
In agarose gels two stains were used in parallel. The standard ethidium bromide stain was used to estimate the size of DNA fragments in agarose gels, and the SYBR Green I nucleic acid stain (Molecular Probes, The Netherlands) was used in fluorometry to estimate the amounts of DNA. Each band of interest was cut out and the fluorescence was measured in a fluorometer supplied with a set of two filters, one filter allowing excitation at 480 nm and one filter emitting light at 535 nm. SYBR Green fluorescence was also used to determine which cycle numbers generated a linear increase of products. This was done for each primer pair.
2.4. Sub-cloning of fragment B A larger amount of DNA products from the reamplifications were separated on a 2% agarose gels, cut out and purified using mini-columns (PharmaciaAmersham) and collected in a final volume of 25 ll. One microliter (40 ng) of insert DNA was added to a 10 ll ligation reaction containing 20 ng of the plasmid vector pGEM-T-Easy (Promega). Ligations were incubated overnight at 14 C and 2 ll from the reaction was taken to 30 ll of JM109 competent cells for transformations. Transformed cells were plated on Xgal/ IPTG/ampicillin containing agar plates. Partial cDNA was sequenced using T7 and SP6 primers (AmershamBiotech, Switzerland).
2.6. Primers The rainbow trout ERa specific primers are denoted ERa979-S and the ERa1425-AS. Ten different random 5 0 primers (MAL1, MAL2 etc) and three different 3 0 anchor primers were tested in the differential display experiments. MAL1 5 0 primer and the 3 0 primer T11-AG were selected as primer pairs for the final experiments. Nested primers B402L and B402R were used in re-amplifications of fragment B. P2 and P3 primers, specific for fragment B were used in the RACE experiments. The P7, P9, P11 are forward sequencing primers and the P6 and P8 are reverse sequencing primers. MAL1:5 0 GGTACAGTGG3 0 ; MAL2:5 0 CATACGGTAC3 0 ; MAL3:5 0 GAACCTGTCG3 0 ; MAL4:5 0 CATTCGACTG3 0 ; MAL5:5 0 TCTCGATGAG3 0 ; MAL6:5 0 ATGTCGAGAG3 0 ; MAL7:5 0 GTCACTTTCG3 0 ; MAL8:5 0 GAGATTGTCC3 0 ; MAL9:5 0 GGTTCTCGAC3 0 ; MAL10:5 0 CTTGCTGTTG3 0 ; T11-AG:5 0 TTTTTTTTTTTAG3 0 ; T11-CA:5 0 TTTTTTTTTTTCA3 0 ; T11-GC:5 0 TTTTTTTTTTTGC3 0 ; b-actin up:5 0 CCTGACCCTGAAGTACCCCA3 0 ; b-actin down:5 0 CGTCATGCAGCTCATAGCTC3 0 ; ERa979-S:5 0 CAGGTGCTGTTCCTGCTG3 0 ; ERa1425-AS:5 0 ACAGAAGGAGAAGGCACCA3 0 ; B402L:5 0 GGGAAGCAACTGTGAGAGGT3 0 ; B402R:5 0 TTGGTACAGTGGCACATGAAA3 0 ; P2:5 0 CCACAGGATGGGACAGCTTCC3 0 ; P3:5 0 CCTGTTCAGCTTGCATCCATC3 0 ; P7:5 0 GCAAATCCCGCAGACAGC3 0 ; P9:5 0 AGTCTGTGTCAGCCTCAC3 0 ; P11:5 0 TGTCATGATGAGTCCCTG3 0 ; P6:5 0 TGTGGAGCCAAAGTCCTC3 0 ; P8:5 0 GTGGACAGAGACAGTGTG3 0 .
420
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
3. Results 3.1. Characterization of the rainbow trout gonad cells To decide on a fish cell line that was suitable in the search for genes that are regulated by ERa, we chose the gonad cell line RTG-2 and a recently established stable transfectant line, the RTG-2-ERa. These two lines have been evaluated in their capacity to respond to the estrogenic hormone, 17b-estradiol, in reporter-gene assays. The RTG-2 cells, that express the beta form of ER but lack the expression of ERa, did not activate luciferase when a plasmid containing an ERa specific response element was co-transfected. The cells of the stable transfectant, the RTG-2-ERa, were capable of stimulating ERa dependent transcription 5–7-fold in the presence of hormone in a similar reporter assay (Ackermann et al., 2002). To verify the presence of ERa specific nucleic acids in the RTG-2-ERa transfectant line we used ERa specific primers in PCR. The result showed that the estrogen receptor specific fragment of 446 bp was amplified from the transfectant RTG-2ERa cells, but not from the parental RTG-2 cells (Fig. 1A). The stable insertion of the ERa gene and the known transcriptional function of the receptor in the transfectant cell line allowed us to use the two cell lines in parallel in the search for ER isoform-specific target genes. 3.2. Novel gene regulated by ERa/17b-estradiol There is a limited number of available assay systems to use in the search for novel regulatory genes in fish and we chose to establish the differential display method (Liang and Pardee, 1992) for RTG-2 cells. Cells of RTG-2 and RTG-2-ERa were grown for 48 h in absence or presence of 100 nM 17b-estradiol and total RNA was isolated and used as templates for reverse transcription. In the following PCRs, which were repeated at least three times for each of the primer pairs, we used the two-anchored 3 0 poly-T-primers (Nordqvist and Tohonen, 1997) in combination with one of ten different random primers (see material and methods). Each separation of the resulting PCR products in acrylamide gels (Fig. 1B) produced approximately hundred bands per lane. The majority of these bands were common in the lanes that contained products from the estradiol induced cells of RTG-2 or RTG-2-ERa. In addition there were 10 products of nucleic acids that were exclusively derived from RTG-2-ERa cells, and 3–5 bands with content exclusive for cells of RTG-2. The approach of using the primer pair MAL1 and T11-AG in the differential display is shown in Fig. 1B. In RT-PCRs we isolated 12 products unique for the RTG-2-ERa cells. To verify the size of the PCR products we repeated the amplifications and separated the products in agarose
Fig. 1. ERa mRNA expression in the RTG-2-ERa cells and display of a target gene when cells are induced by 17b-estradiol. (A) With ERa specific primers the rainbow trout ERa specific DNA is amplified and generate a 446 bp fragment in RTG-2-ERa (T) and which is absent in control RTG-2 cells (P). Products were separated on a 2% agarose gel. (B) The differential displayed DNA fragments separated on acrylamide gels are shown (left panel). The exclusively expressed fragment B is present in the lane containing products derived from RTG-2-ERa cells that has been treated with 100 nM 17b-estradiol. Amplifications using the product of the acrylamide gel as template are separated on an agarose gel (right panel). (C) Fragment B was cut out from the agarose gel above and sub-cloned into the pGEM-T-Easy vector. Clones containing inserts were verified by PCR using T7 and SP6 primers. T, RTG-2-ERa; E2, 17b-estradiol; F, fragment B; M, DNA size marker; C, products from vector alone; I, vector containing insert of fragment B. Lower arrow indicates the size of the PCR fragment produced in the absence of insert and the upper arrow show products containing the fragment B.
gels (Fig. 1C). The sizes of the DNA fragments varied between 200 and 500 base pairs. Six partial cDNAs with lengths exceeding 300 base pairs were sub-cloned and sequenced. A search for homologies in the NCBI database did not show any homologies to known fish sequences
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
but had similarities to mammalian species for four of these DNA fragments; two of them showed low homology to EST sequences; three of the DNA fragments showed some homologies to gene products of common domains i.e. the IPT domain (Bork et al., 1999), the ATM domain (Vassilev et al., 1998) and the bromo domain (Zeng and Zhou, 2002). One of the cDNA fragments showed high homology (70%) to a functional domain of a mammalian gene product. We continued to investigate this partial cDNA of 422 base pairs (fragment B). To estimate the fold induction of expressed fragment B in absence and presence of ERa, we used SYBR green staining which in agarose gels allows an estimated appraisal of amplified product. We isolated RNA from 17b-estradiol induced parental cells and from RTG-2ERa cells. RT-PCR of a control (actin) showed similar levels of amplified product (Fig. 2, upper panel). Fragment B was amplified with two specific primers, B402L and B402R. The results showed an intense band with the expected size derived from the 17b-estradiol treated RTG-2-ERa cells (Fig. 2, lower panel, shown under T). A weak band was observed in RT-PCRs of RNA derived from hormone treated RTG-2 cells at high cycle numbers (Fig. 2, lower panel, shown under P). We show
Fig. 2. ERa controls the expression of fragment B. Actin products are expressed in 17b-estradiol exposed cells of RTG-2 and RTG-2-ERa (upper panel). In three different RT-PCRs the amount of actin fluorescence in the transfectant line varied between 0.9 and 1.4 times that of the parental cell line. Fragment B products are shown after different cycle numbers and at different concentrations of template (lower panel). Black triangle indicates lanes containing PCR products generated at high concentration of template (undiluted). Dark shaded and light shaded triangles indicate lanes containing amplified products using templates that were diluted 1:2 and 1:4, respectively. Each set of four lanes contains products generated after 24, 26, 28 or 30 cycles. P, parental (RTG-2); T, transfectant (RTG-2-ERa); RT, reverse transcriptase enzyme. This shows one of three independent RT-PCR experiments.
421
Table 1 High expression of fragment B in cells containing the ERa cDNA Cells
Fluorescence arbitrary units
RTG-2 RTG-2-ERa
134 156 24 cy
115 652 26 cy
232 1535 28 cy
158 4030 30 cy
Fragment B amplifications of templates present in RTG-2 or RTG-2ERa cells measured with fluorescence. At least 5 times higher fluorescence arbitrary units were detected in DNA agarose bands derived from the RTG-2-ERa cells at cycle numbers 24–30. The results from one of three independent experiments are shown. The number of units detected in the control RTG-2 cells varied between 110 and 240 in these experiments.
using the SYBR Green staining that amplified amounts of fragment B derived from the RTG-2-ERa cells are 5fold higher at 26 cycles when compared to the amounts retrieved from the parental RTG-2 (Table 1). We conclude from these results that the expression of the gene corresponding to the partial cDNA encoding fragment B is ERa dependent. 3.3. Evidence that the gene codes for a fish member of the TGF beta superfamily The DNA sequencing of fragment B showed that the random MAL1 primer was utilized at both ends of the fragment and would therefore possibly represent a location upstream of the immediate 3 0 end of a gene. Homology search in the GenBank showed that the deduced amino acid sequence of fragment B, with remarkable cystein repeats (8-Cys), has high homology with a socalled functional TB domain (Yuan et al., 1997). TB domains are structurally related to TGFb proteins and are common in two families of proteins, the fibrillins (FBN) and the latent transforming growth factor beta binding proteins (LTBPs). TB containing proteins are secreted and are components of the extracellular matrix (ECM). To isolate the flanking regions of fragment B with the aim to obtain the full-length gene, we isolated RNA from 17b-estradiol treated RTG-2-ERa cells and used 3 0 RACE and 5 0 RACE. Primers designed and used in the RACE are boxed in Fig. 3A. The resulting fulllength cDNA of 3784 bp was sub-cloned into the pcDNA3.1 vector (InVitrogen). A search in the GeneBank showed that this cDNA encodes a fish homologue (rtLTBP, accession number AY173044) of the human LTBP. There are four mammalian isoforms of LTBP. In the computer analysis of the full-length rtLTBP sequence in the evolutionary analysis program we showed that the rtLTBP gene is most closely related to LTBP-3 (Fig. 3B). The four mammalian gene products of LTBPs (Gleizes et al., 1996; Moren et al., 1994; Saharinen et al., 1998; Yin et al., 1995) can be distinguished from each other by the number of EGF domains (central EGF
422
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
Fig. 3. Cloning of the full-length gene and identification of a fish LTBP. (A) The full-length mRNA sequence of rainbow trout LTBP was generated using 3 0 RACE and 5 0 RACE. The sequences from which primers were designed for cloning procedures are boxed. The LTBP specific primers used in RACE were: reverse primer P8 (nucleotides 290–307); reverse primer P6 (nt:s 787–804); forward primer B402L (nt:s 1083–1102); forward primer P2 (nt:s 1104–1124); reverse primer P3 (nt:s 1402–1422); reverse primer B402R (1464–1484); forward primer P7 (nt:s 1748–1765); forward primer P9 (nt:s 2290–2307); forward primer P11 (nt:s 2788–2805). (B) Evolutionary relationship of human LTBP-1, LTBP-2, LTBP-3, LTBP-4, the Xenopus LTBP1 (xLTBP-1,) and rainbow trout LTBP (rtLTBP) constructed by Growtree Program based on the homology matrix created by Distances program from the GCG package of genetic software. The rtLTBP shows a close relation to the human LTBP-3.
repeat) located between TB1 and TB2. The central repeat of LTBP-1, -2, -3 and -4 contains 11, 13, 8 and 14 EGF domains, respectively. BLAST alignments of the
central repeat showed that the rtLTBP consists of eight EGF domains in addition to the three TB domains that are present in all LTBPs (Fig. 4A). The rtLTBP
Fig. 4. The rtLTBP is a fish homologue of the human LTBP-3. (A) A scheme of common domains in LTBPs. All LTBPs contain three TB domains and several EGF domains (white oval circles). The central repeat of human LTBP isoforms differ in the number of EGF domains and the LTBP of rainbow trout contains eight central EGF domains resembling the human LTBP-3. Potential signal cleavage and protease digestion sites are indicated. (B) Primary sequences of the TB2 domains of human LTBP-1, Xenopus LTBP-1, human LTBP-3 and rtLTBP. Boxed amino acid residues are conserved. Ten amino acid residues are identical in the TB2 domains of human LTBP-3 and rtLTBP (black dots).
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
bears an overall amino acids similarity of 61%, 48%, 44% and 41% to the human LTBP-3, LTBP-1, LTBP-2 and LTBP-4, respectively and the alignments showed that TB2 is the most conserved of the TB domains among LTBPs. The TB2 domains in mammalian species are the sites that confers interactions with the latency complex of proTGFb (Saharinen et al., 1996). Clustal alignments show that the TB2 of rtLTBP is 87%, 66% and 57% identical to the TB2 domains of human LTBP-3, human LTBP-1 and Xenopus LTBP-1 (Quarto, 2002), respectively (Fig. 4B). This is the first LTBP identified and isolated in fish, and the amino acid sequence analysis shows that the rtLTBP is structurally related to the mammalian LTBP-3.
4. Discussion In this paper we show that the rtLTBP-3 is a target gene of ERa. In mammalian species the LTBP-3 protein is one of four LTBP proteins identified. The LTBP proteins are members of the TGFb activation complex in the ECM. In mammalian species the first LTBP-3 gene was isolated in 1995 (Yin et al., 1995) and expression studies showed a high expression in heart, skeletal muscle, prostate and ovary (Penttinen et al., 2002). Knock out mice that lack the LTBP-3 or the LTBP-2 proteins show severe alterations in development. The LTBP-2 knock out mouse is lethal at an early stage (Shipley et al., 2000) and mice that lack the LTBP-3 gene survived the early development but show effects in bone including aberrant bone remodeling and growth retardation (Dabovic et al., 2002). These abnormalities are paralleled with a body weight that is half of what is found in normal adult mice. Since the LTBPs, except for the LTBP-3 described here, are not yet characterized in fish (in vertebrates the Xenopus LTBP-1 has been identified) it remains to be shown if they have a functions resembling those in the mammalian system. TGFb signaling is initiated in this complex and involves several steps including cleavage of the LTBP-3 peptide (Oklu and Hesketh, 2000), a release of TGFb from the ECM and binding of TGFb to its receptors at the cell surface of the responding cell. Inside a cell signaling of TGFb results in activation of Smad proteins that enter the nuclei where they pursue transcriptional events. Several functions in a normal adult cell and in development are regulated by TGFb (Massague, 2000). The growth factor TGFb is a molecule that influences the movements and organization of cells in early development. One interesting aspect of early development and the TGFb signaling is the implication of TGFb and its related molecule BMP to determine the left-right axis formation of vertebrates (Hackett, 2002). This raise questions on a possible roles of LTBPs in
423
development. The notion that LTBPs seems to have an important role in localizing the TGFb molecule on target cells (Annes et al., 2003) suggests that LTBP may have more than one function. This report is the first showing a link between LTBP and ERs in transcription but there are several studies showing examples of molecular events that links the TGFb signaling pathway and ERs. It was shown that the Smads, a group of molecules that mediate TGFb signaling in the cell physically has a capacity to interact with the ER molecule (Matsuda et al., 2001; Moustakas et al., 2001). Another example of linking the TGFb with ERs is the events of inflammation in which ERa has been described as a mediator of wound healing activities (Vegeto et al., 2003). This is in line with a study showing the molecular aspects of estrogens in inflammation in which 17b-estradiol application in wound healing could be correlated with concomitant increase of TGFb expression (Ashcroft et al., 1997). To find mechanisms by which ER and molecules involved in the signaling by the TGFb pathway are interacting and how these molecules co-operate in regulation leading to growth, differentiation and other cellular events remains to be elucidated. In fish, and in other aquatic vertebrates that harbor homologues of the mammalian steroid hormone receptors there is sparse information on such molecular events. In addition to ER itself (Flouriot et al., 1995) two major groups of target genes induced by 17b-estradiol, the vitellogenin and the zona radiata proteins (Hyllner et al., 1991; Oppen-Berntsen et al., 1992) have been studied in fish. In a recent report there are additional target genes identified such as choriogenin 3, choriogenin 2, aldose reductase, disulfide isomerase and aspartic protease in an array of 132 genes in Largemouth Bass (Larkin et al., 2003). All these genes were identified in liver cells. To find novel target genes in organs other than liver would elucidate the tissue specific mechanisms for ER function. The link of the ER regulatory pathway to the LTBP expression shown in this study is limited to cells in culture. It remains to be shown that estrogens (and possibly EDCs) have effects through ER transcription in gonad cells. The LTBP-3 gene, the first LTBP isolated in a fish species, could then become a first biomarker of estrogenicity in cells other than liver cells.
Acknowledgements We would like to thank M. Roos and A. Hungerbuehler for ER-isoform specific primers. We thank Intelliclone for advice concerning RACE and K. Fent for initial support. This work was part of the EU project COMPREHEND (Community Program of Research on Endocrine Disrupters and Environmental Hormones;
424
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
ENV4-CT98-0798), supported by a postdoctoral fellowship by the Swiss Federal office for Education and Science (BBW-980090).
References Ackermann, G.E., Brombacher, E., Fent, K., 2002. Development of a fish reporter gene system for the assessment of estrogenic compounds and sewage treatment plant effluents. Environ. Toxicol. Chem. 21, 1864–1875. Annes, J.P., Munger, J.S., Rifkin, D.B., 2003. Making sense of latent TGFbeta activation. J. Cell Sci. 116, 217–224. Ashcroft, G.S., Dodsworth, J., van Boxtel, E., Tarnuzzer, R.W., Horan, M.A., Schultz, G.S., Ferguson, M.W., 1997. Estrogen accelerates cutaneous wound healing associated with an increase in TGF-beta1 levels. Nat. Med. 3, 1209–1215. Bork, P., Doerks, T., Springer, T.A., Snel, B., 1999. Domains in plexins: links to integrins and transcription factors. Trends Biochem. Sci. 24, 261–263. Couse, J.F., Hewitt, S.C., Bunch, D.O., Sar, M., Walker, V.R., Davis, B.J., Korach, K.S., 1999. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science 286, 2328– 2331. Dabovic, B., Chen, Y., Colarossi, C., Obata, H., Zambuto, L., Perle, M.A., Rifkin, D.B., 2002a. Bone abnormalities in latent TGF(beta) binding protein (Ltbp-)3-null mice indicate a role for Ltbp-3 in modulating TGF-(beta) bioavailability. J. Cell Biol. 156, 227– 232. Darblade, B., Pendaries, C., Krust, A., Dupont, S., Fouque, M.J., Rami, J., Chambon, P., Bayard, F., Arnal, J.F., 2002b. Estradiol alters nitric oxide production in the mouse aorta through the alpha-, but not beta-, estrogen receptor. Circ. Res. 90, 413–419. Dupont, S., Krust, A., Gansmuller, A., Dierich, A., Chambon, P., Mark, M., 2000. Effect of single and compound knockouts of estrogen receptors alpha (ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development 127, 4277–4291. Eggen, R.I.L., Bengtsson, B.E., Bowmer, C.T., Gerritsen, A.A.M., Gibert, M., Hylland, K., Johnson, A.C., Leonards, P., Nakari, T., Norrgren, L., Sumpter, J.P., Suter, M.J.F., Svenson, A., Pickering, A.D., 2003. Search for the evidence of endocrine disruption in the aquatic environment; lessons to be learned from joint biological and chemical monitoring in the European project COMPREHEND. Pure Appl. Chem. 75, 2445–2450. Flouriot, G., Pakdel, F., Ducouret, B., Valotaire, Y., 1995. Influence of xenobiotics on rainbow trout liver estrogen receptor and vitellogenin gene expression. J. Mol. Endocrinol. 15, 143–151. Geary, G.G., McNeill, A.M., Ospina, J.A., Krause, D.N., Korach, K.S., Duckles, S.P., 2001. Selected contribution: cerebrovascular nos and cyclooxygenase are unaffected by estrogen in mice lacking estrogen receptor-alpha. J. Appl. Physiol. 91, 2391–2399. Gimeno, S., Gerritsen, A., Bowmer, T., Komen, H., 1996. Feminization of male carp. Nature 384, 221–222. Gleizes, P.E., Beavis, R.C., Mazzieri, R., Shen, B., Rifkin, D.B., 1996. Identification and characterization of an eight-cysteine repeat of the latent transforming growth factor-beta binding protein-1 that mediates bonding to the latent transforming growth factor-beta1. J. Biol. Chem. 271, 29891–29896. Green, S., Chambon, P., 1986. A superfamily of potentially oncogenic hormone receptors. Nature 324, 615–617. Greene, G.L., Gilna, P., Waterfield, M., Baker, A., Hort, Y., Shine, J., 1986. Sequence and expression of human estrogen receptor complementary DNA. Science 231, 1150–1154. Hackett, B.P., 2002. Formation and malformation of the vertebrate left-right axis. Curr. Mol. Med. 2, 39–66.
Hawkins, M.B., Thornton, J.W., Crews, D., Skipper, J.K., Dotte, A., Thomas, P., 2000. Identification of a third distinct estrogen receptor and reclassification of estrogen receptors in teleosts. Proc. Natl. Acad. Sci. USA 97, 10751–10756. Hyllner, S.J., Oppen-Berntsen, D.O., Helvik, J.V., Walther, B.T., Haux, C., 1991. Oestradiol-17 beta induces the major vitelline envelope proteins in both sexes in teleosts. J. Endocrinol. 131, 229– 236. Jobling, S., Coey, S., Whitmore, J.G., Kime, D.E., Van Look, K.J., McAllister, B.G., Beresford, N., Henshaw, A.C., Brighty, G., Tyler, C.R., Sumpter, J.P., 2002. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Reprod. 67, 515–524. Kuiper, G.G., Enmark, E., Pelto-Huikko, M., Nilsson, S., Gustafsson, J.A., 1996. Cloning of a novel receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA 93, 5925. Larkin, P., Sabo-Attwood, T., Kelso, J., Denslow, N.D., 2003. Analysis of gene expression profiles in Largemouth Bass exposed to 17-b-estradiol and to anthropogenic contaminants that behave as estrogens. Ecotoxicology 12, 463–468. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Massague, J., 2000. How cells read TGF-beta signals. Nat. Rev. Mol. Cell Biol. 1, 169–178. Matsuda, T., Yamamoto, T., Muraguchi, A., Saatcioglu, F., 2001. Cross-talk between transforming growth factor-beta and estrogen receptor signaling through Smad3. J. Biol. Chem. 276, 42908– 42914. McDonnell, D.P., Norris, J.D., 2002. Connections and regulation of the human estrogen receptor. Science 296, 1642–1644. Menuet, A., Anglade, I., Flouriot, G., Pakdel, F., Kah, O., 2001. Tissue-specific expression of two structurally different estrogen receptor alpha isoforms along the female reproductive axis of an oviparous species, the rainbow trout. Biol. Reprod. 65, 1548–1557. Moehren, U., Eckey, M., Baniahmad, A., 2004. Gene repression by nuclear hormone receptors. Essays Biochem. 40, 89–104. Moren, A., Olofsson, A., Stenman, G., Sahlin, P., Kanzaki, T., Claesson-Welsh, L., ten Dijke, P., Miyazono, K., Heldin, C.H., 1994. Identification and characterization of LTBP-2, a novel latent transforming growth factor-beta-binding protein. J. Biol. Chem. 269, 32469–32478. Moustakas, A., Souchelnytskyi, S., Heldin, C.H., 2001. Smad regulation in TGF-beta signal transduction. J. Cell Sci. 114, 4359– 4369. Musso, R., Maggi, A., Eva, C., 2000. 17 beta-estradiol stimulates mouse neuropeptide Y-Y(1) receptor gene transcription by binding to estrogen receptor alpha in neuroblastoma cells. Neuroendocrinology 72, 243–251. Nagler, J.J., Krisfalusi, M., Cyr, D.G., 2000. Quantification of rainbow trout (Oncorhynchus mykiss) estrogen receptor-alpha messenger RNA and its expression in the ovary during the reproduction cycle. J. Mol. Endocrinol. 25, 243–251. Nordqvist, K., Tohonen, V., 1997. An mRNA differential display strategy for cloning genes expressed during mouse gonad development. Int. J. Dev. Biol. 41, 627–636. Oklu, R., Hesketh, R., 2000. The latent transforming growth factor beta binding protein (LTBP) family. Biochem. J. 352, 601–610. Oppen-Berntsen, D.O., Hyllner, S.J., Haux, C., Helvik, J.V., Walther, B.T., 1992. Eggshell zona radiata-proteins from cod (Gadus morhua): extra-ovarian origin and induction by estradiol-17 beta. Int. J. Dev. Biol. 36, 247–254. Pakdel, F., LeGac, F., LeGoff, P., Valotaire, Y., 1990. Full-length sequence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol. Cell Endocrinol. 71, 195–204. Pakdel, F., Petit, F., Anglade, I., Kah, O., Delaunay, F., Bailhache, T., Valotaire, Y., 1994. Overexpression of rainbow trout estrogen receptor domains in Escherichia coli: characterization and utiliza-
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425 tion in the production of antibodies for immunoblotting and immunocytochemistry. Mol. Cell Endocrinol. 104, 81–93. Penttinen, C., Saharinen, J., Weikkolainen, K., Hyytiainen, M., KeskiOja, J., 2002. Secretion of human latent TGF-beta-binding protein3 (LTBP-3) is dependent on co-expression of TGF-beta. J. Cell Sci. 115, 3457–3468. Quarto, N., 2002. Molecular cloning and expression study of Xenopus latent TGF-beta binding protein-1 (LTBP-1). Gene 290, 53–61. Routledge, E.J., White, R., Parker, M.G., Sumpter, J.P., 2000. Differential effects of xenoestrogens on coactivator recruitment by estrogen receptor (ER) alpha and ERbeta. J. Biol. Chem. 275, 35986–35993. Sabo-Attwood, T., Kroll, K.J., Denslow, N.D., 2004. Differential expression of largemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol. Mol. Cell Endocrinol. 218, 107–118. Saharinen, J., Taipale, J., Keski-Oja, J., 1996. Association of the small latent transforming growth factor-beta with an eight cysteine repeat of its binding protein LTBP-1. EMBO J. 15, 245–253. Saharinen, J., Taipale, J., Monni, O., Keski-Oja, J., 1998. Identification and characterization of a new latent transforming growth factorbeta-binding protein, LTBP-4. J. Biol. Chem. 273, 18459–18469. Shipley, J.M., Mecham, R.P., Maus, E., Bonadio, J., Rosenblom, J., McCarthy, R.T., Baumann, M.L., Frankfater, C., Segade, F., Shapiro, S.D., 2000. Developmental expression of latent transforming growth factor beta binding protein 2 and its requirement early in mouse development. Mol. Cell Biol. 20, 4879–4887.
425
Todo, T., Adachi, S., Yamauchi, K., 1996. Molecular cloning and characterization of Japanese eel estrogen receptor cDNA. Mol. Cell Endocrinol. 119, 37–45. Tyler, C.R., Jobling, S., Sumpter, J.P., 1998. Endocrine disruption in wildlife: a critical review of the evidence. Crit. Rev. Toxicol. 28, 319–361. Vassilev, A., Yamauchi, J., Kotani, T., Prives, C., Avantaggiati, M.L., Qin, J., Nakatani, Y., 1998. The 400 kDa subunit of the PCAF histone acetylase complex belongs to the ATM superfamily. Mol. Cell 2, 869–875. Vegeto, E., Belcredito, S., Etteri, S., Ghisletti, S., Brusadelli, A., Meda, C., Krust, A., Dupont, S., Ciana, P., Chambon, P., Maggi, A., 2003. Estrogen receptor-alpha mediates the brain antiinflammatory activity of estradiol. Proc. Natl. Acad. Sci. USA 100, 9614– 9619. Weihua, Z., Saji, S., Maikinen, S., Cheng, G., Jensen, E.V., Warner, M., Gustafsson, J.A., 2000. Estrogen receptor (ER) beta, a modulator of ERalpha in the uterus. Proc. Natl. Acad. Sci. USA 97, 5936–5941. Wolf, K., Quimby, M.C., 1962. Established eurythermic line of fish cells in vitro. Science 135, 1065–1066. Yin, W., Smiley, E., Germiller, J., Mecham, R.P., Florer, J.B., Wenstrup, R.J., Bonadio, J., 1995. Isolation of a novel latent transforming growth factor-beta binding protein gene (LTBP-3). J. Biol. Chem. 270, 10147–10160. Zeng, L., Zhou, M.M., 2002. Bromodomain: an acetyl-lysine binding domain. FEBS Lett. 513, 124–128.
Transcription of the fish Latent TGFb-binding protein gene is controlled by estrogen receptor a Monika L. Andersson b
a,*
, Rik I. Eggen
b
a Department of Biosciences, Karolinska Institute, Novum, SE 14157, Huddinge, Sweden Swiss Federal Institute for Environmental Science and Technology (EAWAG), Du¨bendorf, Switzerland
Received 29 June 2005; accepted 8 August 2005 Available online 19 September 2005
Abstract In endocrine disruption a key role has been suggested for endocrine receptors, in particular the estrogen receptors (ERs), in the regulation by compounds mimicking natural hormones. The two ERs, ERa and ERb are transcription factors involved in the regulated expression of estrogen target genes and have been shown to play an essential role in mammalian ovary development. A similar role is to be expected for ERs in fish; little is, however, known in fish about genes regulated by ERs. To begin to address this, we here report the identification and characterization of a novel gene regulated by the fish ERa in response to 17b-estradiol. This gene encodes a fish orthologue of the latent transforming growth factor beta binding protein 3 (LTBP-3) and was identified through a differential display approach from a rainbow trout gonad cell line (RTG-2-ERa). We show that the rainbow trout LTBP (rtLTBP-3) is ERa dependent and is upregulated 5-fold in response to 17b-estradiol addition. The rtLTBP shows 61% amino acid similarity to human LTBP-3 and 48%, 44% and 41% to LTBP-1, LTBP-2 and LTBP-4, respectively. The highly conserved TB2 domain of rtLTBP shows 87% and 66% identity to the TB domains of human LTBP-3 and LTBP-1, respectively. LTBP plays a pivotal role in TGFb activation in mammals and the high degree of sequence similarity suggests a similar role in fish. This would represent a novel link between nuclear hormone receptors and growth factor (TGFb) mediated developmental processes, and show new aspects of the role of hormones in developmental biology and endocrine disruption. 2005 Elsevier Ltd. All rights reserved. Keywords: Transcription; Estrogen receptor; TGFb; Binding protein; Trout gonad cells
1. Introduction Endocrine disrupter (EDC) is a common denominator for substances that can interfere with and/or mimic natural hormones in animals. The persistence and accumulation of these compounds is considered as a serious problem in the aquatic environment (http://europa.eu. int/comm/research/endocrine/pdf/env4-ct98-0798.pdf). Much attention has been given in recent years to endocrine disruption by estrogenic compounds (Eggen et al., 2003) and exposure has in fish been shown to cause in*
Corresponding author. Tel.: +46 8 6089100; fax: +46 8 7745538. E-mail address: [email protected] (M.L. Andersson).
0887-2333/$ - see front matter 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.tiv.2005.08.010
creased vitellogenin production, malformations of fish gonads in males (Tyler et al., 1998), reduced fertility, inhibition of testicular differentiation (Gimeno et al., 1996) and occurrence of intersexuality in roach as a result from exposure to estrogenic sewage treatment work effluents (Jobling et al., 2002). Common for many estrogenic EDCs is their ability, despite with different affinities, to bind to estrogen receptors (ERs). ERs belong to the family of nuclear receptors, are highly conserved among species, and function as tissue specific transcription factors (for review see McDonnell and Norris, 2002). Two related ERs, ERa and ERb, have been identified in both fish and mammals (Green and Chambon, 1986; Greene et al., 1986; Kuiper et al., 1996; Pakdel
418
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
et al., 1994; Todo et al., 1996) and in two species of fish a third type of ER (ER gamma) has been reported (Hawkins et al., 2000; Sabo-Attwood et al., 2004). In rainbow trout the ERb (GenBank accession number AJ289883) and the ERa have been identified and isolated (Pakdel et al., 1990). Recently also a shorter form of ERa has been identified in rainbow trout (Menuet et al., 2001). ERs in mammals and in fish are activated by the natural ligand 17b-estradiol. The ligand-bound ER binds to upstream enhancer and promoter regions of estrogen target genes and regulates these genes through activated or repressed transcription. The ER mediating effects of the natural ligand and of EDCs have been in focus in the developing organs responsible for reproduction. The ovaries of fish and mammals express ERs (Couse et al., 1999; Nagler et al., 2000). Sub-cutaneous injections of 17b-estradiol into normal female mice showed that the uterus after three days was expressing higher levels of ERa but a reduced levels of ERb mRNA (Weihua et al., 2000). The importance of ERs in fertility has mainly been obtained by using knock out mice. The possibility of female prepubertal wild type mice to superovulate and produce eggs in response to administration of gonadotropins does not occur in the corresponding mice that lack the ERa gene. One conclusion from these studies was that the growth of the follicles of the ovaries is dependent on ERa (Dupont et al., 2000). The effects by environmental hormones in this system has not been tested. A number of responsive genes that are activated or repressed in presence of ligand have been identified in mammalian species. The natural estrogen ligand, the 17b-estradiol, bind to ERa and to ERb and each ligand bound complex have a capacity to distinguish and bind specific genes, a control influenced by the ability of ERa and ERb to select in their recruitment of co-activators and co-repressors (Moehren et al., 2004). Also ligands other than the natural estradiol alter the regulation through a structural change of the receptor bound complex (Routledge et al., 2000). ERa specific target genes have been described in mice such as the nitric oxide (NO) synthase and the cyclooxygenase genes (Geary et al., 2001) and the Y-Y(1) gene that in neural cells was regulated by ERa, but showed no transcriptional effects through ERb (Musso et al., 2000). The ER isoform specificity was also shown in aorta tissue in which estradiol induced NO through ERa but not through the beta form of ER (Darblade et al., 2002b). Yet there are other examples of ER/17b-estradiol induced target genes of which many were identified before the discovery of the ERb (Kuiper et al., 1996). A great deal is known about genes that are controlled by ligand induction of estrogen receptors in mammals, but considerable less is known in fish. In fish there are only a few estrogen target genes known and the two major groups of such genes are the vitellogenin and
the zona radiate genes encoding the egg-yolk precursor proteins and egg shell proteins, respectively (Hyllner et al., 1991; Oppen-Berntsen et al., 1992). In adult fish these proteins are activated by ERs in liver in which the ERa is the predominantly expressed isoform. It has yet to be demonstrated if transcription occurs through this receptor isoform. To obtain information on new target genes in fish is critical, in order to understand the molecular mechanisms underlying endocrine disruption and to obtain biomarkers to detect effects of various known and potential endocrine disrupters. We have isolated a gene in fish cells, the LTBP-3 orthologue of the mammalian gene, that have the potential of becoming a biomarker for EDCs in fish.
2. Material and methods 2.1. Fish cell cultures The cell line RTG-2 (Wolf and Quimby, 1962) was established from gonads of juvenile rainbow trout (Oncorhynchus mykiss). The RTG-2-ERa (Ackermann et al., 2002) is a stable transfected cell line expressing the rainbow trout estrogen receptor alpha (Pakdel et al., 1990). Cells were maintained in DulbeccoÕs Modified Eagles Medium/Nutrient Mixture F12 with Hepes buffer (Gibco-BRL, Life Technologies Basel, Switzerland) containing 5% fetal bovine serum. Cells were grown at 20 C without CO2 supplement. Before the exposure experiments the cells were kept for 3 days in Turbodoma medium without phenol red (Dr F Messi Cell Culture Technologies GmbH Zurich, Switzerland) containing 5% charcoal stripped bovine serum (Sigma Cell Culture Buchs, Switzerland). 22 · 106 cells were exposed to 100 nM 17b-estradiol or to 200 nM of the estrogen inhibitor ICI164384. 2.2. Total RNA extraction and reverse transcription Total RNA was extracted from 50 · 106 cells using Trizol reagent (Life Technologies, Switzerland). One microgram of RNA was reverse transcribed using Moloney murine leukemia virus (MMLV) reverse transcriptase in a total volume of 25 ll. A mixture of 0.5 pM of reverse primer oligo-dT1218 (Amersham-Biotech, Switzerland) or of the two-anchored poly-T reverse primers (Nordqvist and Tohonen, 1997) together with all four dNTPs (1 mM) was heated to 65 C for 5 min and 37 C for 10 min prior to addition of the reverse transcriptase and 10 U of RNAsin (Promega). Controls omitting the enzyme were included. RT reactions were incubated at 37 C for 60 min followed by inactivation at 70 C for 5 min. The first strand cDNAs were diluted 20-fold and kept at 4 C.
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
419
2.3. Differential display
2.5. SYBR Green labeling of DNA
One microliter of the first-strand cDNA synthesis reaction was taken in a total volume of 25 ll containing 10 mM tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 2 lM of dGTP, 2 lM of dCTP and 2 lM of dTTP, 12.5 lM of the 3 0 primer (T11-CA, T11-GC or T11-AG), 12.5 lM of one of the 10 different 5 0 primers named MAL1 to MAL10 which was designed according to Nordqvist and Tohonen (Nordqvist and Tohonen, 1997). 1 unit of Taq polymerase (Life Technologies, Switzerland), 2 lCi of 33P labeled dATP (3000 Ci/ mmole, Amersham) and 2 lM of non-radioactive dATP were amplified at 30 s denaturing at 94 C, 120 s annealing at 42 C, 30 s extension at 72 C, 40 cycles. A layer of light mineral oil (Sigma) was added on top of the reaction solution. A 35 cm long 6%/7 M urea acrylamide gel was pre-run for 30 min at 1670 V in 1·TBE buffer. Ten microliters of the reaction volume was mixed with 2.5 ll sample buffer and denatured for 2 min prior to loading. In control lanes corresponding samples from RTG-2 cells and from RTG-2-ERa cells treated with solvent (DMSO) or with the ligand ICI 164384 were applied. Sham controls were run in parallel. Buffer was changed and gels were run for 4 h at 1670 V. Gels were placed on 3MM paper, covered with Saran wrap and dried in a gel dryer for 1 h. To locate bands on the gel a trace amount of isotope in black ink was spotted and the gel was exposed to autoradiograph film over night. Next day bands of interest were cut out from the gel with clean razor blades. The piece of gel containing DNA was placed in an Eppendorf tube containing 100 ll of ddH2O, and allowed to rehydrate at room temperature for 2 h and DNA was separated from the acrylamide in mini spin columns (Pharmacia-Amersham). One microliter of DNA was taken as template in PCRs using the same reaction conditions as above except that 12.5 lM of non-labeled dATP was added in exchange for 33P labeled dATP. Products were separated on 2% agarose gels.
In agarose gels two stains were used in parallel. The standard ethidium bromide stain was used to estimate the size of DNA fragments in agarose gels, and the SYBR Green I nucleic acid stain (Molecular Probes, The Netherlands) was used in fluorometry to estimate the amounts of DNA. Each band of interest was cut out and the fluorescence was measured in a fluorometer supplied with a set of two filters, one filter allowing excitation at 480 nm and one filter emitting light at 535 nm. SYBR Green fluorescence was also used to determine which cycle numbers generated a linear increase of products. This was done for each primer pair.
2.4. Sub-cloning of fragment B A larger amount of DNA products from the reamplifications were separated on a 2% agarose gels, cut out and purified using mini-columns (PharmaciaAmersham) and collected in a final volume of 25 ll. One microliter (40 ng) of insert DNA was added to a 10 ll ligation reaction containing 20 ng of the plasmid vector pGEM-T-Easy (Promega). Ligations were incubated overnight at 14 C and 2 ll from the reaction was taken to 30 ll of JM109 competent cells for transformations. Transformed cells were plated on Xgal/ IPTG/ampicillin containing agar plates. Partial cDNA was sequenced using T7 and SP6 primers (AmershamBiotech, Switzerland).
2.6. Primers The rainbow trout ERa specific primers are denoted ERa979-S and the ERa1425-AS. Ten different random 5 0 primers (MAL1, MAL2 etc) and three different 3 0 anchor primers were tested in the differential display experiments. MAL1 5 0 primer and the 3 0 primer T11-AG were selected as primer pairs for the final experiments. Nested primers B402L and B402R were used in re-amplifications of fragment B. P2 and P3 primers, specific for fragment B were used in the RACE experiments. The P7, P9, P11 are forward sequencing primers and the P6 and P8 are reverse sequencing primers. MAL1:5 0 GGTACAGTGG3 0 ; MAL2:5 0 CATACGGTAC3 0 ; MAL3:5 0 GAACCTGTCG3 0 ; MAL4:5 0 CATTCGACTG3 0 ; MAL5:5 0 TCTCGATGAG3 0 ; MAL6:5 0 ATGTCGAGAG3 0 ; MAL7:5 0 GTCACTTTCG3 0 ; MAL8:5 0 GAGATTGTCC3 0 ; MAL9:5 0 GGTTCTCGAC3 0 ; MAL10:5 0 CTTGCTGTTG3 0 ; T11-AG:5 0 TTTTTTTTTTTAG3 0 ; T11-CA:5 0 TTTTTTTTTTTCA3 0 ; T11-GC:5 0 TTTTTTTTTTTGC3 0 ; b-actin up:5 0 CCTGACCCTGAAGTACCCCA3 0 ; b-actin down:5 0 CGTCATGCAGCTCATAGCTC3 0 ; ERa979-S:5 0 CAGGTGCTGTTCCTGCTG3 0 ; ERa1425-AS:5 0 ACAGAAGGAGAAGGCACCA3 0 ; B402L:5 0 GGGAAGCAACTGTGAGAGGT3 0 ; B402R:5 0 TTGGTACAGTGGCACATGAAA3 0 ; P2:5 0 CCACAGGATGGGACAGCTTCC3 0 ; P3:5 0 CCTGTTCAGCTTGCATCCATC3 0 ; P7:5 0 GCAAATCCCGCAGACAGC3 0 ; P9:5 0 AGTCTGTGTCAGCCTCAC3 0 ; P11:5 0 TGTCATGATGAGTCCCTG3 0 ; P6:5 0 TGTGGAGCCAAAGTCCTC3 0 ; P8:5 0 GTGGACAGAGACAGTGTG3 0 .
420
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
3. Results 3.1. Characterization of the rainbow trout gonad cells To decide on a fish cell line that was suitable in the search for genes that are regulated by ERa, we chose the gonad cell line RTG-2 and a recently established stable transfectant line, the RTG-2-ERa. These two lines have been evaluated in their capacity to respond to the estrogenic hormone, 17b-estradiol, in reporter-gene assays. The RTG-2 cells, that express the beta form of ER but lack the expression of ERa, did not activate luciferase when a plasmid containing an ERa specific response element was co-transfected. The cells of the stable transfectant, the RTG-2-ERa, were capable of stimulating ERa dependent transcription 5–7-fold in the presence of hormone in a similar reporter assay (Ackermann et al., 2002). To verify the presence of ERa specific nucleic acids in the RTG-2-ERa transfectant line we used ERa specific primers in PCR. The result showed that the estrogen receptor specific fragment of 446 bp was amplified from the transfectant RTG-2ERa cells, but not from the parental RTG-2 cells (Fig. 1A). The stable insertion of the ERa gene and the known transcriptional function of the receptor in the transfectant cell line allowed us to use the two cell lines in parallel in the search for ER isoform-specific target genes. 3.2. Novel gene regulated by ERa/17b-estradiol There is a limited number of available assay systems to use in the search for novel regulatory genes in fish and we chose to establish the differential display method (Liang and Pardee, 1992) for RTG-2 cells. Cells of RTG-2 and RTG-2-ERa were grown for 48 h in absence or presence of 100 nM 17b-estradiol and total RNA was isolated and used as templates for reverse transcription. In the following PCRs, which were repeated at least three times for each of the primer pairs, we used the two-anchored 3 0 poly-T-primers (Nordqvist and Tohonen, 1997) in combination with one of ten different random primers (see material and methods). Each separation of the resulting PCR products in acrylamide gels (Fig. 1B) produced approximately hundred bands per lane. The majority of these bands were common in the lanes that contained products from the estradiol induced cells of RTG-2 or RTG-2-ERa. In addition there were 10 products of nucleic acids that were exclusively derived from RTG-2-ERa cells, and 3–5 bands with content exclusive for cells of RTG-2. The approach of using the primer pair MAL1 and T11-AG in the differential display is shown in Fig. 1B. In RT-PCRs we isolated 12 products unique for the RTG-2-ERa cells. To verify the size of the PCR products we repeated the amplifications and separated the products in agarose
Fig. 1. ERa mRNA expression in the RTG-2-ERa cells and display of a target gene when cells are induced by 17b-estradiol. (A) With ERa specific primers the rainbow trout ERa specific DNA is amplified and generate a 446 bp fragment in RTG-2-ERa (T) and which is absent in control RTG-2 cells (P). Products were separated on a 2% agarose gel. (B) The differential displayed DNA fragments separated on acrylamide gels are shown (left panel). The exclusively expressed fragment B is present in the lane containing products derived from RTG-2-ERa cells that has been treated with 100 nM 17b-estradiol. Amplifications using the product of the acrylamide gel as template are separated on an agarose gel (right panel). (C) Fragment B was cut out from the agarose gel above and sub-cloned into the pGEM-T-Easy vector. Clones containing inserts were verified by PCR using T7 and SP6 primers. T, RTG-2-ERa; E2, 17b-estradiol; F, fragment B; M, DNA size marker; C, products from vector alone; I, vector containing insert of fragment B. Lower arrow indicates the size of the PCR fragment produced in the absence of insert and the upper arrow show products containing the fragment B.
gels (Fig. 1C). The sizes of the DNA fragments varied between 200 and 500 base pairs. Six partial cDNAs with lengths exceeding 300 base pairs were sub-cloned and sequenced. A search for homologies in the NCBI database did not show any homologies to known fish sequences
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
but had similarities to mammalian species for four of these DNA fragments; two of them showed low homology to EST sequences; three of the DNA fragments showed some homologies to gene products of common domains i.e. the IPT domain (Bork et al., 1999), the ATM domain (Vassilev et al., 1998) and the bromo domain (Zeng and Zhou, 2002). One of the cDNA fragments showed high homology (70%) to a functional domain of a mammalian gene product. We continued to investigate this partial cDNA of 422 base pairs (fragment B). To estimate the fold induction of expressed fragment B in absence and presence of ERa, we used SYBR green staining which in agarose gels allows an estimated appraisal of amplified product. We isolated RNA from 17b-estradiol induced parental cells and from RTG-2ERa cells. RT-PCR of a control (actin) showed similar levels of amplified product (Fig. 2, upper panel). Fragment B was amplified with two specific primers, B402L and B402R. The results showed an intense band with the expected size derived from the 17b-estradiol treated RTG-2-ERa cells (Fig. 2, lower panel, shown under T). A weak band was observed in RT-PCRs of RNA derived from hormone treated RTG-2 cells at high cycle numbers (Fig. 2, lower panel, shown under P). We show
Fig. 2. ERa controls the expression of fragment B. Actin products are expressed in 17b-estradiol exposed cells of RTG-2 and RTG-2-ERa (upper panel). In three different RT-PCRs the amount of actin fluorescence in the transfectant line varied between 0.9 and 1.4 times that of the parental cell line. Fragment B products are shown after different cycle numbers and at different concentrations of template (lower panel). Black triangle indicates lanes containing PCR products generated at high concentration of template (undiluted). Dark shaded and light shaded triangles indicate lanes containing amplified products using templates that were diluted 1:2 and 1:4, respectively. Each set of four lanes contains products generated after 24, 26, 28 or 30 cycles. P, parental (RTG-2); T, transfectant (RTG-2-ERa); RT, reverse transcriptase enzyme. This shows one of three independent RT-PCR experiments.
421
Table 1 High expression of fragment B in cells containing the ERa cDNA Cells
Fluorescence arbitrary units
RTG-2 RTG-2-ERa
134 156 24 cy
115 652 26 cy
232 1535 28 cy
158 4030 30 cy
Fragment B amplifications of templates present in RTG-2 or RTG-2ERa cells measured with fluorescence. At least 5 times higher fluorescence arbitrary units were detected in DNA agarose bands derived from the RTG-2-ERa cells at cycle numbers 24–30. The results from one of three independent experiments are shown. The number of units detected in the control RTG-2 cells varied between 110 and 240 in these experiments.
using the SYBR Green staining that amplified amounts of fragment B derived from the RTG-2-ERa cells are 5fold higher at 26 cycles when compared to the amounts retrieved from the parental RTG-2 (Table 1). We conclude from these results that the expression of the gene corresponding to the partial cDNA encoding fragment B is ERa dependent. 3.3. Evidence that the gene codes for a fish member of the TGF beta superfamily The DNA sequencing of fragment B showed that the random MAL1 primer was utilized at both ends of the fragment and would therefore possibly represent a location upstream of the immediate 3 0 end of a gene. Homology search in the GenBank showed that the deduced amino acid sequence of fragment B, with remarkable cystein repeats (8-Cys), has high homology with a socalled functional TB domain (Yuan et al., 1997). TB domains are structurally related to TGFb proteins and are common in two families of proteins, the fibrillins (FBN) and the latent transforming growth factor beta binding proteins (LTBPs). TB containing proteins are secreted and are components of the extracellular matrix (ECM). To isolate the flanking regions of fragment B with the aim to obtain the full-length gene, we isolated RNA from 17b-estradiol treated RTG-2-ERa cells and used 3 0 RACE and 5 0 RACE. Primers designed and used in the RACE are boxed in Fig. 3A. The resulting fulllength cDNA of 3784 bp was sub-cloned into the pcDNA3.1 vector (InVitrogen). A search in the GeneBank showed that this cDNA encodes a fish homologue (rtLTBP, accession number AY173044) of the human LTBP. There are four mammalian isoforms of LTBP. In the computer analysis of the full-length rtLTBP sequence in the evolutionary analysis program we showed that the rtLTBP gene is most closely related to LTBP-3 (Fig. 3B). The four mammalian gene products of LTBPs (Gleizes et al., 1996; Moren et al., 1994; Saharinen et al., 1998; Yin et al., 1995) can be distinguished from each other by the number of EGF domains (central EGF
422
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
Fig. 3. Cloning of the full-length gene and identification of a fish LTBP. (A) The full-length mRNA sequence of rainbow trout LTBP was generated using 3 0 RACE and 5 0 RACE. The sequences from which primers were designed for cloning procedures are boxed. The LTBP specific primers used in RACE were: reverse primer P8 (nucleotides 290–307); reverse primer P6 (nt:s 787–804); forward primer B402L (nt:s 1083–1102); forward primer P2 (nt:s 1104–1124); reverse primer P3 (nt:s 1402–1422); reverse primer B402R (1464–1484); forward primer P7 (nt:s 1748–1765); forward primer P9 (nt:s 2290–2307); forward primer P11 (nt:s 2788–2805). (B) Evolutionary relationship of human LTBP-1, LTBP-2, LTBP-3, LTBP-4, the Xenopus LTBP1 (xLTBP-1,) and rainbow trout LTBP (rtLTBP) constructed by Growtree Program based on the homology matrix created by Distances program from the GCG package of genetic software. The rtLTBP shows a close relation to the human LTBP-3.
repeat) located between TB1 and TB2. The central repeat of LTBP-1, -2, -3 and -4 contains 11, 13, 8 and 14 EGF domains, respectively. BLAST alignments of the
central repeat showed that the rtLTBP consists of eight EGF domains in addition to the three TB domains that are present in all LTBPs (Fig. 4A). The rtLTBP
Fig. 4. The rtLTBP is a fish homologue of the human LTBP-3. (A) A scheme of common domains in LTBPs. All LTBPs contain three TB domains and several EGF domains (white oval circles). The central repeat of human LTBP isoforms differ in the number of EGF domains and the LTBP of rainbow trout contains eight central EGF domains resembling the human LTBP-3. Potential signal cleavage and protease digestion sites are indicated. (B) Primary sequences of the TB2 domains of human LTBP-1, Xenopus LTBP-1, human LTBP-3 and rtLTBP. Boxed amino acid residues are conserved. Ten amino acid residues are identical in the TB2 domains of human LTBP-3 and rtLTBP (black dots).
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
bears an overall amino acids similarity of 61%, 48%, 44% and 41% to the human LTBP-3, LTBP-1, LTBP-2 and LTBP-4, respectively and the alignments showed that TB2 is the most conserved of the TB domains among LTBPs. The TB2 domains in mammalian species are the sites that confers interactions with the latency complex of proTGFb (Saharinen et al., 1996). Clustal alignments show that the TB2 of rtLTBP is 87%, 66% and 57% identical to the TB2 domains of human LTBP-3, human LTBP-1 and Xenopus LTBP-1 (Quarto, 2002), respectively (Fig. 4B). This is the first LTBP identified and isolated in fish, and the amino acid sequence analysis shows that the rtLTBP is structurally related to the mammalian LTBP-3.
4. Discussion In this paper we show that the rtLTBP-3 is a target gene of ERa. In mammalian species the LTBP-3 protein is one of four LTBP proteins identified. The LTBP proteins are members of the TGFb activation complex in the ECM. In mammalian species the first LTBP-3 gene was isolated in 1995 (Yin et al., 1995) and expression studies showed a high expression in heart, skeletal muscle, prostate and ovary (Penttinen et al., 2002). Knock out mice that lack the LTBP-3 or the LTBP-2 proteins show severe alterations in development. The LTBP-2 knock out mouse is lethal at an early stage (Shipley et al., 2000) and mice that lack the LTBP-3 gene survived the early development but show effects in bone including aberrant bone remodeling and growth retardation (Dabovic et al., 2002). These abnormalities are paralleled with a body weight that is half of what is found in normal adult mice. Since the LTBPs, except for the LTBP-3 described here, are not yet characterized in fish (in vertebrates the Xenopus LTBP-1 has been identified) it remains to be shown if they have a functions resembling those in the mammalian system. TGFb signaling is initiated in this complex and involves several steps including cleavage of the LTBP-3 peptide (Oklu and Hesketh, 2000), a release of TGFb from the ECM and binding of TGFb to its receptors at the cell surface of the responding cell. Inside a cell signaling of TGFb results in activation of Smad proteins that enter the nuclei where they pursue transcriptional events. Several functions in a normal adult cell and in development are regulated by TGFb (Massague, 2000). The growth factor TGFb is a molecule that influences the movements and organization of cells in early development. One interesting aspect of early development and the TGFb signaling is the implication of TGFb and its related molecule BMP to determine the left-right axis formation of vertebrates (Hackett, 2002). This raise questions on a possible roles of LTBPs in
423
development. The notion that LTBPs seems to have an important role in localizing the TGFb molecule on target cells (Annes et al., 2003) suggests that LTBP may have more than one function. This report is the first showing a link between LTBP and ERs in transcription but there are several studies showing examples of molecular events that links the TGFb signaling pathway and ERs. It was shown that the Smads, a group of molecules that mediate TGFb signaling in the cell physically has a capacity to interact with the ER molecule (Matsuda et al., 2001; Moustakas et al., 2001). Another example of linking the TGFb with ERs is the events of inflammation in which ERa has been described as a mediator of wound healing activities (Vegeto et al., 2003). This is in line with a study showing the molecular aspects of estrogens in inflammation in which 17b-estradiol application in wound healing could be correlated with concomitant increase of TGFb expression (Ashcroft et al., 1997). To find mechanisms by which ER and molecules involved in the signaling by the TGFb pathway are interacting and how these molecules co-operate in regulation leading to growth, differentiation and other cellular events remains to be elucidated. In fish, and in other aquatic vertebrates that harbor homologues of the mammalian steroid hormone receptors there is sparse information on such molecular events. In addition to ER itself (Flouriot et al., 1995) two major groups of target genes induced by 17b-estradiol, the vitellogenin and the zona radiata proteins (Hyllner et al., 1991; Oppen-Berntsen et al., 1992) have been studied in fish. In a recent report there are additional target genes identified such as choriogenin 3, choriogenin 2, aldose reductase, disulfide isomerase and aspartic protease in an array of 132 genes in Largemouth Bass (Larkin et al., 2003). All these genes were identified in liver cells. To find novel target genes in organs other than liver would elucidate the tissue specific mechanisms for ER function. The link of the ER regulatory pathway to the LTBP expression shown in this study is limited to cells in culture. It remains to be shown that estrogens (and possibly EDCs) have effects through ER transcription in gonad cells. The LTBP-3 gene, the first LTBP isolated in a fish species, could then become a first biomarker of estrogenicity in cells other than liver cells.
Acknowledgements We would like to thank M. Roos and A. Hungerbuehler for ER-isoform specific primers. We thank Intelliclone for advice concerning RACE and K. Fent for initial support. This work was part of the EU project COMPREHEND (Community Program of Research on Endocrine Disrupters and Environmental Hormones;
424
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425
ENV4-CT98-0798), supported by a postdoctoral fellowship by the Swiss Federal office for Education and Science (BBW-980090).
References Ackermann, G.E., Brombacher, E., Fent, K., 2002. Development of a fish reporter gene system for the assessment of estrogenic compounds and sewage treatment plant effluents. Environ. Toxicol. Chem. 21, 1864–1875. Annes, J.P., Munger, J.S., Rifkin, D.B., 2003. Making sense of latent TGFbeta activation. J. Cell Sci. 116, 217–224. Ashcroft, G.S., Dodsworth, J., van Boxtel, E., Tarnuzzer, R.W., Horan, M.A., Schultz, G.S., Ferguson, M.W., 1997. Estrogen accelerates cutaneous wound healing associated with an increase in TGF-beta1 levels. Nat. Med. 3, 1209–1215. Bork, P., Doerks, T., Springer, T.A., Snel, B., 1999. Domains in plexins: links to integrins and transcription factors. Trends Biochem. Sci. 24, 261–263. Couse, J.F., Hewitt, S.C., Bunch, D.O., Sar, M., Walker, V.R., Davis, B.J., Korach, K.S., 1999. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science 286, 2328– 2331. Dabovic, B., Chen, Y., Colarossi, C., Obata, H., Zambuto, L., Perle, M.A., Rifkin, D.B., 2002a. Bone abnormalities in latent TGF(beta) binding protein (Ltbp-)3-null mice indicate a role for Ltbp-3 in modulating TGF-(beta) bioavailability. J. Cell Biol. 156, 227– 232. Darblade, B., Pendaries, C., Krust, A., Dupont, S., Fouque, M.J., Rami, J., Chambon, P., Bayard, F., Arnal, J.F., 2002b. Estradiol alters nitric oxide production in the mouse aorta through the alpha-, but not beta-, estrogen receptor. Circ. Res. 90, 413–419. Dupont, S., Krust, A., Gansmuller, A., Dierich, A., Chambon, P., Mark, M., 2000. Effect of single and compound knockouts of estrogen receptors alpha (ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development 127, 4277–4291. Eggen, R.I.L., Bengtsson, B.E., Bowmer, C.T., Gerritsen, A.A.M., Gibert, M., Hylland, K., Johnson, A.C., Leonards, P., Nakari, T., Norrgren, L., Sumpter, J.P., Suter, M.J.F., Svenson, A., Pickering, A.D., 2003. Search for the evidence of endocrine disruption in the aquatic environment; lessons to be learned from joint biological and chemical monitoring in the European project COMPREHEND. Pure Appl. Chem. 75, 2445–2450. Flouriot, G., Pakdel, F., Ducouret, B., Valotaire, Y., 1995. Influence of xenobiotics on rainbow trout liver estrogen receptor and vitellogenin gene expression. J. Mol. Endocrinol. 15, 143–151. Geary, G.G., McNeill, A.M., Ospina, J.A., Krause, D.N., Korach, K.S., Duckles, S.P., 2001. Selected contribution: cerebrovascular nos and cyclooxygenase are unaffected by estrogen in mice lacking estrogen receptor-alpha. J. Appl. Physiol. 91, 2391–2399. Gimeno, S., Gerritsen, A., Bowmer, T., Komen, H., 1996. Feminization of male carp. Nature 384, 221–222. Gleizes, P.E., Beavis, R.C., Mazzieri, R., Shen, B., Rifkin, D.B., 1996. Identification and characterization of an eight-cysteine repeat of the latent transforming growth factor-beta binding protein-1 that mediates bonding to the latent transforming growth factor-beta1. J. Biol. Chem. 271, 29891–29896. Green, S., Chambon, P., 1986. A superfamily of potentially oncogenic hormone receptors. Nature 324, 615–617. Greene, G.L., Gilna, P., Waterfield, M., Baker, A., Hort, Y., Shine, J., 1986. Sequence and expression of human estrogen receptor complementary DNA. Science 231, 1150–1154. Hackett, B.P., 2002. Formation and malformation of the vertebrate left-right axis. Curr. Mol. Med. 2, 39–66.
Hawkins, M.B., Thornton, J.W., Crews, D., Skipper, J.K., Dotte, A., Thomas, P., 2000. Identification of a third distinct estrogen receptor and reclassification of estrogen receptors in teleosts. Proc. Natl. Acad. Sci. USA 97, 10751–10756. Hyllner, S.J., Oppen-Berntsen, D.O., Helvik, J.V., Walther, B.T., Haux, C., 1991. Oestradiol-17 beta induces the major vitelline envelope proteins in both sexes in teleosts. J. Endocrinol. 131, 229– 236. Jobling, S., Coey, S., Whitmore, J.G., Kime, D.E., Van Look, K.J., McAllister, B.G., Beresford, N., Henshaw, A.C., Brighty, G., Tyler, C.R., Sumpter, J.P., 2002. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Reprod. 67, 515–524. Kuiper, G.G., Enmark, E., Pelto-Huikko, M., Nilsson, S., Gustafsson, J.A., 1996. Cloning of a novel receptor expressed in rat prostate and ovary. Proc. Natl. Acad. Sci. USA 93, 5925. Larkin, P., Sabo-Attwood, T., Kelso, J., Denslow, N.D., 2003. Analysis of gene expression profiles in Largemouth Bass exposed to 17-b-estradiol and to anthropogenic contaminants that behave as estrogens. Ecotoxicology 12, 463–468. Liang, P., Pardee, A.B., 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971. Massague, J., 2000. How cells read TGF-beta signals. Nat. Rev. Mol. Cell Biol. 1, 169–178. Matsuda, T., Yamamoto, T., Muraguchi, A., Saatcioglu, F., 2001. Cross-talk between transforming growth factor-beta and estrogen receptor signaling through Smad3. J. Biol. Chem. 276, 42908– 42914. McDonnell, D.P., Norris, J.D., 2002. Connections and regulation of the human estrogen receptor. Science 296, 1642–1644. Menuet, A., Anglade, I., Flouriot, G., Pakdel, F., Kah, O., 2001. Tissue-specific expression of two structurally different estrogen receptor alpha isoforms along the female reproductive axis of an oviparous species, the rainbow trout. Biol. Reprod. 65, 1548–1557. Moehren, U., Eckey, M., Baniahmad, A., 2004. Gene repression by nuclear hormone receptors. Essays Biochem. 40, 89–104. Moren, A., Olofsson, A., Stenman, G., Sahlin, P., Kanzaki, T., Claesson-Welsh, L., ten Dijke, P., Miyazono, K., Heldin, C.H., 1994. Identification and characterization of LTBP-2, a novel latent transforming growth factor-beta-binding protein. J. Biol. Chem. 269, 32469–32478. Moustakas, A., Souchelnytskyi, S., Heldin, C.H., 2001. Smad regulation in TGF-beta signal transduction. J. Cell Sci. 114, 4359– 4369. Musso, R., Maggi, A., Eva, C., 2000. 17 beta-estradiol stimulates mouse neuropeptide Y-Y(1) receptor gene transcription by binding to estrogen receptor alpha in neuroblastoma cells. Neuroendocrinology 72, 243–251. Nagler, J.J., Krisfalusi, M., Cyr, D.G., 2000. Quantification of rainbow trout (Oncorhynchus mykiss) estrogen receptor-alpha messenger RNA and its expression in the ovary during the reproduction cycle. J. Mol. Endocrinol. 25, 243–251. Nordqvist, K., Tohonen, V., 1997. An mRNA differential display strategy for cloning genes expressed during mouse gonad development. Int. J. Dev. Biol. 41, 627–636. Oklu, R., Hesketh, R., 2000. The latent transforming growth factor beta binding protein (LTBP) family. Biochem. J. 352, 601–610. Oppen-Berntsen, D.O., Hyllner, S.J., Haux, C., Helvik, J.V., Walther, B.T., 1992. Eggshell zona radiata-proteins from cod (Gadus morhua): extra-ovarian origin and induction by estradiol-17 beta. Int. J. Dev. Biol. 36, 247–254. Pakdel, F., LeGac, F., LeGoff, P., Valotaire, Y., 1990. Full-length sequence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol. Cell Endocrinol. 71, 195–204. Pakdel, F., Petit, F., Anglade, I., Kah, O., Delaunay, F., Bailhache, T., Valotaire, Y., 1994. Overexpression of rainbow trout estrogen receptor domains in Escherichia coli: characterization and utiliza-
M.L. Andersson, R.I. Eggen / Toxicology in Vitro 20 (2006) 417–425 tion in the production of antibodies for immunoblotting and immunocytochemistry. Mol. Cell Endocrinol. 104, 81–93. Penttinen, C., Saharinen, J., Weikkolainen, K., Hyytiainen, M., KeskiOja, J., 2002. Secretion of human latent TGF-beta-binding protein3 (LTBP-3) is dependent on co-expression of TGF-beta. J. Cell Sci. 115, 3457–3468. Quarto, N., 2002. Molecular cloning and expression study of Xenopus latent TGF-beta binding protein-1 (LTBP-1). Gene 290, 53–61. Routledge, E.J., White, R., Parker, M.G., Sumpter, J.P., 2000. Differential effects of xenoestrogens on coactivator recruitment by estrogen receptor (ER) alpha and ERbeta. J. Biol. Chem. 275, 35986–35993. Sabo-Attwood, T., Kroll, K.J., Denslow, N.D., 2004. Differential expression of largemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol. Mol. Cell Endocrinol. 218, 107–118. Saharinen, J., Taipale, J., Keski-Oja, J., 1996. Association of the small latent transforming growth factor-beta with an eight cysteine repeat of its binding protein LTBP-1. EMBO J. 15, 245–253. Saharinen, J., Taipale, J., Monni, O., Keski-Oja, J., 1998. Identification and characterization of a new latent transforming growth factorbeta-binding protein, LTBP-4. J. Biol. Chem. 273, 18459–18469. Shipley, J.M., Mecham, R.P., Maus, E., Bonadio, J., Rosenblom, J., McCarthy, R.T., Baumann, M.L., Frankfater, C., Segade, F., Shapiro, S.D., 2000. Developmental expression of latent transforming growth factor beta binding protein 2 and its requirement early in mouse development. Mol. Cell Biol. 20, 4879–4887.
425
Todo, T., Adachi, S., Yamauchi, K., 1996. Molecular cloning and characterization of Japanese eel estrogen receptor cDNA. Mol. Cell Endocrinol. 119, 37–45. Tyler, C.R., Jobling, S., Sumpter, J.P., 1998. Endocrine disruption in wildlife: a critical review of the evidence. Crit. Rev. Toxicol. 28, 319–361. Vassilev, A., Yamauchi, J., Kotani, T., Prives, C., Avantaggiati, M.L., Qin, J., Nakatani, Y., 1998. The 400 kDa subunit of the PCAF histone acetylase complex belongs to the ATM superfamily. Mol. Cell 2, 869–875. Vegeto, E., Belcredito, S., Etteri, S., Ghisletti, S., Brusadelli, A., Meda, C., Krust, A., Dupont, S., Ciana, P., Chambon, P., Maggi, A., 2003. Estrogen receptor-alpha mediates the brain antiinflammatory activity of estradiol. Proc. Natl. Acad. Sci. USA 100, 9614– 9619. Weihua, Z., Saji, S., Maikinen, S., Cheng, G., Jensen, E.V., Warner, M., Gustafsson, J.A., 2000. Estrogen receptor (ER) beta, a modulator of ERalpha in the uterus. Proc. Natl. Acad. Sci. USA 97, 5936–5941. Wolf, K., Quimby, M.C., 1962. Established eurythermic line of fish cells in vitro. Science 135, 1065–1066. Yin, W., Smiley, E., Germiller, J., Mecham, R.P., Florer, J.B., Wenstrup, R.J., Bonadio, J., 1995. Isolation of a novel latent transforming growth factor-beta binding protein gene (LTBP-3). J. Biol. Chem. 270, 10147–10160. Zeng, L., Zhou, M.M., 2002. Bromodomain: an acetyl-lysine binding domain. FEBS Lett. 513, 124–128.