- Email: [email protected]
Transcription of the Rat Angiotensin II Type 2 Receptor Gene
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
222, 566–571 (1996)
0784
Transcription of the Rat Angiotensin II Type 2 Receptor Gene Toshihiro Ichiki,1 Yoshikazu Kambayashi, and Tadashi Inagami2 Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee 37232 Received April 8, 1996 The promoter region of the rat angiotensin II type 2 receptor gene was cloned and the nucleotide sequences were determined. A computer homology search for a 1.2 Kb promoter region showed that there are several consensus cis DNA elements such as C/EBP, NF-IL6, GRE and AP1 in this region. Primer extension experiments showed that there is one transcription initiation site 15 bp-downstream of the TATA box. Deletion mutants of this 1.2 Kb segment were prepared and fused to a luciferase reporter gene. These type 2 receptor promoterluciferase constructs were introduced into PC12W cells, a pheochromocytoma cell line expressing the type 2 receptor, and luciferase activity was measured. It showed that (1) a DNA segment between −1208 bp and −749 bp suppresses the promoter activity of type 2 receptor gene, (2) a positive regulatory element is present in a DNA segment between −749 bp and −216 bp; and (3) a DNA segment between −44 bp and +58 bp is important for the basal promoter activity of the type 2 receptor gene. © 1996 Academic Press, Inc.
Angiotensin (ANG) II plays an important role in not only blood pressure regulation, fluid homeostasis and drinking behavior but cell growth and proliferation (1, 2). The physiological effects of ANG II are mediated by ANG II receptors on target cells such as vascular smooth muscle cells, adrenal cortex cells and renal mesangeal cells (1, 2). The isoform specific antagonists have shown that at least two isoforms of ANG II receptor are present (3, 4). The type 1 receptor (AT1) belongs to a family of seven transmembrane domain type receptor (5, 6) and has proven to mediate practically all known biological effects of ANG II such as vasoconstriction, aldosterone release and the facilitation of adrenergic nerve activity (1, 2). The type 2 receptor (AT2) was also shown to have the putative seven transmembrane domain structure (7, 8). However definitive signaling mechanisms mediated by this receptor have not been established (9–12). Binding studies using 125I-labeled ANG II and isoform specific antagonists showed that the AT2 receptor is highly expressed in rat fetal tissues, most conspicuously in mesenchymal tissues (13) and various brain nuclei (14). This expression is decreased or shut off rapidly after birth. In adult rat, the AT2 receptor shows a unique tissue distribution. It is expressed in some brain nuclei (15), heart (16, 17), myometrium (3), adrenal medulla (4) and ovarian granulosa cells (18). In vitro binding studies using cell lines which express the AT2 receptor such as R3T3 cells (19) and PC12W cells (20) showed that the expression of the AT2 receptor is suppressed by growth factors. The expression of the AT2 receptor in R3T3 cells is down regulated by fibroblast growth factor and serum (19). Nerve growth factor suppressed the AT2 receptor expression in PC12W cells (20). These in vivo and in vitro binding studies suggest that expression of the AT2 receptor is tightly controlled and closely related to its biological roles. To clarify this unique tissue specific and ontogeny-dependent expression, we have undertaken cloning of the promoter region of the rat AT2 gene and examined its promoter function in PC12W cells. MATERIALS AND METHODS Reagent. A luciferase assay kit was purchased from Promega (Madison, WI). Fetal calf serum and Dulbecco’s modified Eagles medium (DMEM) were obtained from GIBCO BRL (Gaithersburg, MA) and other tissue culture supplies were from 1
Present address: Research Institute of Angiocardiology and Cardiovascular Clinic, Kyushu University School of Medicine, 3-1-1 Maidashi, Higashi-ku, 812 Fukuoka, Japan. 2 Corresponding author. Fax +1-615-322-3201. 566 0006-291X/96 $18.00 Copyright © 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Sigma (St. Louis, MO). DNA cloning and nucleotide sequencing. A genomic DNA library of SD rat was purchased from Stratagene (La Jolla, CA). Five hundred thousand phages were screened by a conventional plaque hybridization method (21) using 32P-labeled Apa I-Xba I fragment of the rat AT2 receptor cDNA (7) as a probe. Eco RI-Hind III segment which contains the first exon of the rat AT2 gene in its 39 region was subcloned into pBluescript (Stratagene). Deletion mutants of the inserted Eco RI-Hind III fragment were prepared by using an Erase-A-Base kit (Promega). Nucleotide sequences were determined by a dideoxy chain termination method using a Sequenase kit (United States Biochemicals, Cleveland, OH) both in the sense and antisense directions. Primer extension experiment. A 20-mer primer specific for the first exon of the AT2 gene (Fig. 2, 59GCTTTCAATTCTGTGCTCGC39, antisense strand) was end-labeled with 32P-g-ATP and T4 polynucleotide kinase, then purified by an ammonium acetate-ethanol precipitation. Poly (A)+ RNA was prepared from PC12 W cells using a Fast Track kit (In Vitrogen, San Diego, CA). One mg of poly (A)+ RNA was reverse transcribed using the 32P-labeled primer and moloney murine leukemia virus reverse transcriptase (NEB, Beverly, MA). The resultant product was phenol extracted, ethanolprecipitated and resuspended in 4 ml of a loading buffer (95 % formamide, 20 mmol/L EDTA), electrophoresed in 6 % acrylamide-8mol/L urea gel after heat denaturation. Sequencing ladders were obtained by the same primer using a Sequenase kit (United States Biochemicals). Preparation of AT2 promoter-luciferase construct. Six deletion fragments of the promoter region of the AT2 receptor gene were prepared by digestion with restriction endonuclease (D1–D3) or by an Erase-A-Base deletion mutant kit (D4–D6) (Promega). These fragments were cloned into the pGL2B (Promega) luciferase reporter vector. Plasmid DNA were prepared using a Qiagen plasmid kit (Qiagen Inc., Chatsworth, CA). Cell culture and transfection to PC12W cells. PC12W cells were maintained in DMEM supplemented with 10% fetal calf serum and 50 mg/ml gentamycin. Cells were cultured in the presence of 5 % CO2 at 37°C. The day before transfection, 5 × 105 of PC12W cells were prepared in a 6 cm tissue culture dish. On the day of transfection the medium was changed to fresh medium and incubated for 1 hour at 37°C. Then the cells were transfected with 5 mg of AT2 promoter-luciferase construct and 2 mg of pSVb-galactosidase (Promega). The transfection was performed using the DOTAP (N-[1-(2, 3-Dioleoyloxy) propyl]-N, N, N-trimethyl-ammoniummethylsulfate) liposome transfection agent according to manufacture’s instruction (Boehringer-Mannheim, Indianapolis, IN). Cells were incubated with the AT2 promoter-luciferase and pSVbgalactosidase DNAs and DOTAP for 24 hours, then with the fresh medium alone for additional 24 hours. The cells were washed twice with Hank’s balanced salt solution and lysed in 200 ml of lysis buffer (25 mmol/L Tris, pH 7.8, 2 mmol/L EDTA, 2 mmol/L DTT, 10 % glycerol and 1 % Triton X-100). Fifty ml of lysate was used for luciferase activity assay in an Opticomp I luminometer (MGM Instruments Inc., Hamden, CT). The assay was started by adding 100 ml of 470 mmol/L luciferin to cell lysate and integrated peak luminescence was determined over a 45-sec window after a 5 sec delay. The b-galactosidase activity in the same sample was measured spectrophotometrically according to Sambrook et al. (22) and used to normalize the luciferase activity. Statistics. Data are given as means ± SEM. Statistical analysis was performed using analysis of variance and Duncan’s test. Values of P<.05 were considered statistically significant.
RESULTS AND DISCUSSION A 1.2 Kb Eco RI-Hind III segment that contains the 59 end of the rat AT2 cDNA was subcloned from the genomic DNA clone. Nucleotide sequence of this upstream region was determined (Fig. 1). Search for consensus cis DNA elements using data bank TFD 7.3 revealed the presence of potential cis DNA elements for NF-IL6, AP-1, insulin response sequence (IRS), cyclic AMP response element (CRE) and glucocorticoid response element (GRE) as shown in Fig. 1 and Fig. 3. To determine the transcription initiation site of the rat AT2 gene, primer extension experiments were performed. One mg of poly (A)+ RNA from PC12W cells (lane 1) or 50 mg of tRNA (lane 2) were reverse transcribed using a 32P-labeled 20-mer oligonucleotide specific for the first exon of the mouse AT2 gene (Fig. 1, nucleotide +37 to +56). Resultant products were electrophoresed in acrylamide-urea gel. A single band was observed as shown in Fig. 2, lane 1. This initiation site is indicated by an arrow in Fig. 1 (+1 bp). No bands were observed when tRNA was reverse transcribed (Fig. 2, lane 2). We examined the promoter activity of the 1.2 Kb Eco RI-Hind III fragment and its deletion mutants. Six DNA fragments were prepared and fused to a luciferase reporter gene (Fig. 3B). These AT2 promoter-luciferase constructs were introduced into PC12W cells, which express the AT2 receptor (9). The luciferase activity was normalized in reference to b-galactosidase activity expressed by co-transfected pSVb-galactosidase DNA. Results are shown in Fig. 3B. The luciferase 567
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Nucleotide sequences of the promoter region of the rat AT2 gene. Nucleotide sequences of the Eco RI-Hind III fragment were determined by a dideoxy chain termination method using a Sequenase kit (USB) in both the sense and antisense directions. Consensus cis DNA elements and the location of primer used in primer extension experiments (Fig. 2) are indicated by underlines and a box, respectively. The transcription initiation site determined by primer extension experiment is indicated by an arrow. EMBL accession number D50835.
activity of the D1 construct was set to 100 % and this activity is approximately 5% of the promoter activity of SV40. Deletion of the DNA segment between −1208 bp and −749 bp increased relative luciferase activity by about 50 %. The relative luciferase activity of the shortest deletion mutant (D6: −44 bp to +58 bp) showed approximately 40 % of that of the D1 construct. The tissue specific and ontogeny-dependent expression of the AT2 receptor gene suggest possible developmental, neurological and reproductive roles of ANG II via the AT2 receptor and that the biological roles of this receptor is closely related to its unique expression pattern. Because the expression pattern of the AT2 receptor in fetal and adult tissues are different and most of the AT2 568
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The transcription initiation site of the rat AT2 gene. Poly (A)+RNA from PC12W cells (lane 1) and tRNA (lane 2) were reverse transcribed using a 32P-labeled primer specific for the first exon of the AT2 gene (Fig. 1, box). The products were electrophoresed in 6% acrylamide-8 M urea gel. The nucleotide sequences were obtained using the same primer used for the determination of transcription initiation site. The same results were obtained in two independent additional experiments.
FIG. 3. Schematic representation of the promoter region of the rat AT2 gene and promoter activity of its deletion mutants. (A) The white box indicates the first exon of the rat AT2 gene (7). The arrow shown below the first exon indicates the transcription initiation site. Relative location of some restriction sites and putative cis DNA elements are shown. (B) The design of deletion mutant constructs of the promoter region of the rat AT2 gene and their promoter activity are shown. DNA fragments −1210 bp through +58 bp, −749bp through +58 bp, −417 bp through +58 bp, −216 bp through +58 bp, −149 bp through +58 and −144 bp +58 bp were fused to a luciferase gene and designated as D1, D2, D3, D4, D5 and D6, respectively. Relative luciferase activity of the deletion mutants in PC12W cells obtained by 5 mg of the AT2 promoterluciferase constructs is shown in the right panel. The luciferase activity is standardized to b-galactosidase activity obtained by 2 mg of co-transfected pSVb-galactosidase construct. The luciferase activity in D1 construct was set to 100%. A mock transfection was performed using the same amount of a promoter-less luciferase gene. Data are mean ± SEM of four independent experiments. * and ** P<.05 vs. D1. 569
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
sites expressed in the fetus are decreased rapidly after birth, the regulatory mechanism of the AT2 receptor gene expression could be different between the adult and fetal tissues. To clarify the mechanism of this unique tissue specific and ontogeny-dependent AT2 receptor expression, we have undertaken molecular cloning of the promoter region of the rat AT2 gene. The nucleotide sequence of a 1.2 Kb Eco RI-Hind III fragment showed that there are several consensus cis DNA elements in this region. Roles of these cis DNA elements as in the promoter of the AT2 gene, however, have not been determined yet. The DNA segment (−1208 bp to −749 bp) may negatively regulate the promoter activity of the AT2 gene by cis DNA elements such as NF-IL6 or AP-1. The deletion of the DNA segment between −749 bp and −216 bp reduced the relative luciferase activity to 50 % of D1 construct. Therefore this region may be a positive regulatory region. The shortest deletion mutant (D6) still showed significant relative luciferase activity. This region may be important for basal transcription of the rat AT2 gene in PC12W cells. In this DNA segment, there is a TATA box consensus sequence (Fig. 1 and 3). Although this is the second paper describing the nucleotide sequence of the rat AT2 gene promoter (23), we demonstrated the functional significance of the several segments of the rat AT2 gene promoter for the first time. Recently, the importance of interferon regulatory factor (IRF) for the expression of the mouse AT2 receptor in growing and quiecent fibroblasts is reported (24). It is not determined whether the IRF plays role in PC12W cells. PC12W cells, a rat pheochromocytoma cell line, have been reported to constitutively express the AT2 receptor (20). They were derived from the adrenal medulla which expresses AT2 sites in the adult rat. Therefore, the results of deletion analysis of the promoter region of the AT2 receptor gene in the present study probably reflect the transcriptional control mechanism of this gene in the adult tissue and may be different from that of the fetal tissue. Comparison of the results of deletion analysis of the promoter region of the AT2 receptor gene in PC12W cells with that of fetus-derived cells expressing AT2 sites may clarify the mechanisms of the differential regulation of AT2 receptor expression between the fetal and adult tissues. ACKNOWLEDGEMENTS This work was supported in part by Research Grants from United State Public Health Service HL-14192 and HL-35323 from the National Institutes of Health. We especially thank Trinita Fitzgerald for excellent technical assistance in cell culture.
REFERENCES 1. Bottari, S. P., de Gasparo, M., Steckelings, U. M., and Levens, N. R. (1993) Frontiers in Neuroendocrinol. 14, 123–171. 2. Timmermans, P. B. M. W. M., Wong, P. C., Chiu, A. T., Herblin, W. F., Benfield, P., Carini, D. J., Lee, R. J., Wexler, R. R., Saye, J. A. M., and Smith, R. D. (1993) Pharmacolo. Rev. 45, 205–251. 3. Whitebread, S., Mele, M., Kamber, B., and de Gasparo, M. (1989) Biochem. Biophys. Res. Commun. 163, 284–291. 4. Chiu, A. T., Herblin, W. F., McCall, D. E., Ardecky, R. J., Carini, D. J., Dunica, J. V., Pease, L. J., Wong, P. C., Wexler, R. R., Johnson, A. L., and Timmermans, P. B. M. W. M. (1989) Biochem. Biophys. Res. Commun. 165, 196–203. 5. Sasaki, K., Yamano, Y., Bardhan, S., Iwai, N., Murray, J. J., Hasegawa, M., Matsuda, Y., and Inagami, T. (1991) Nature 351, 230–233. 6. Murphy, T. J., Alexander, R. W., Griendling, K. K., Runge, M. S., and Bernstein, K. E. (1991) Nature 351, 233–236. 7. Kambayashi, Y., Bardhan, S., Takahashi, K., Tsuzuki, S., Inui, H., Hamkubo, T., and Inagami, T. (1993) J. Biol. Chem. 268, 24543–24546. 8. Mukoyama, M., Nakajima, M., Horiuchi, M., Sasamura, H., Pratt, R. E., and Dzau, V. J. (1993) J. Biol. Chem. 268, 24539–24542. 9. Webb, M. L., Liu, E. C.-K., Cohen, R. B., Hedberg, A., Bogosian, E. A., Monshizadegan, H., Molloy, C., Serafino, R., Moreland, S., Murphy, T. J., and Dickinson, K. E. J. (1992) Peptides 13, 499–508. 10. Takahashi, K., Bardhan, S., Kambayashi, Y., Shirai, H., and Inagami, T. (1994) Biochem. Biophys. Res. Commun. 198, 60–66. 11. Sumners, C., Tang, W., Zelezna, B., and Raizada, M. K. (1991) Proc. Natl. Acad. Sci. USA 88, 7567–7571. 570
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
12. Bottari, S. P., King, I. N., Reichlin, S., Dahlstroem, I., Lydon, N., and de Gasparo, M. (1992) Biochem. Biophys. Res. Commun. 183, 206–211. 13. Grady, E. F., Sechi, L. A., Griffin, C. A., Schambelan, M., and Kalinyak, J. E. (1991) J. Clin. Invest. 88, 921–933. 14. Tsutsumi, K., Viswanathan, M., Stromberg, C., and Saavedra, J. M. (1991) Eur. J. Pharmacol. 198, 89–92. 15. Tsutsumi, K., and Saavedra, J. M. (1991) Am. J. Physiol. 261, R209–R216. 16. Sechi, L., Griffin, C. A., Grady, E. F., Kalinyak, J. E., and Schambelan, M. (1992) Circ. Res. 71, 1482–1489. 17. Suzuki, J., Matsubara, H., Urakami, M., and Inada, M. (1993) Circ. Res. 73, 439–447. 18. Pucell, A. G., Hodges, J. C., Sen, I., Bumpus, F. M., and Husain, A. (1991) Endocrinol. 128, 1947–1958. 19. Dudley, D. T., and Summerfelt, R. M. (1993) Regul. Peptides. 44, 199–206. 20. Leung, K. H., Roscoe, W. A., Smith, R. D., Timmermans, P. B. M. W. M., and Chiu, A. T. (1992) Eur. J. Pharmacol. 227, 63–70. 21. Sambrook, J., Fritsch, E. F, and Maniatis, T. (1989) Molecular Cloning, pp. 2.108–2.121, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning, pp. 16.66–16.67, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 23. Kobayashi, S., Ohnishi, J., Nibu, Y., Nishimatsu, S., Umemura, S., Ishii, M., Murakami, K., and Miyazaki, H. (1995) Biochim. Biophys. Acta 1262, 155–158. 24. Horiuchi, M., Koike, G., Yamada, T., Mukoyama, M., Nakajima, M., and Dzau, V. J. (1995) J. Biol. Chem. 270, 20225–20230.
571
222, 566–571 (1996)
0784
Transcription of the Rat Angiotensin II Type 2 Receptor Gene Toshihiro Ichiki,1 Yoshikazu Kambayashi, and Tadashi Inagami2 Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee 37232 Received April 8, 1996 The promoter region of the rat angiotensin II type 2 receptor gene was cloned and the nucleotide sequences were determined. A computer homology search for a 1.2 Kb promoter region showed that there are several consensus cis DNA elements such as C/EBP, NF-IL6, GRE and AP1 in this region. Primer extension experiments showed that there is one transcription initiation site 15 bp-downstream of the TATA box. Deletion mutants of this 1.2 Kb segment were prepared and fused to a luciferase reporter gene. These type 2 receptor promoterluciferase constructs were introduced into PC12W cells, a pheochromocytoma cell line expressing the type 2 receptor, and luciferase activity was measured. It showed that (1) a DNA segment between −1208 bp and −749 bp suppresses the promoter activity of type 2 receptor gene, (2) a positive regulatory element is present in a DNA segment between −749 bp and −216 bp; and (3) a DNA segment between −44 bp and +58 bp is important for the basal promoter activity of the type 2 receptor gene. © 1996 Academic Press, Inc.
Angiotensin (ANG) II plays an important role in not only blood pressure regulation, fluid homeostasis and drinking behavior but cell growth and proliferation (1, 2). The physiological effects of ANG II are mediated by ANG II receptors on target cells such as vascular smooth muscle cells, adrenal cortex cells and renal mesangeal cells (1, 2). The isoform specific antagonists have shown that at least two isoforms of ANG II receptor are present (3, 4). The type 1 receptor (AT1) belongs to a family of seven transmembrane domain type receptor (5, 6) and has proven to mediate practically all known biological effects of ANG II such as vasoconstriction, aldosterone release and the facilitation of adrenergic nerve activity (1, 2). The type 2 receptor (AT2) was also shown to have the putative seven transmembrane domain structure (7, 8). However definitive signaling mechanisms mediated by this receptor have not been established (9–12). Binding studies using 125I-labeled ANG II and isoform specific antagonists showed that the AT2 receptor is highly expressed in rat fetal tissues, most conspicuously in mesenchymal tissues (13) and various brain nuclei (14). This expression is decreased or shut off rapidly after birth. In adult rat, the AT2 receptor shows a unique tissue distribution. It is expressed in some brain nuclei (15), heart (16, 17), myometrium (3), adrenal medulla (4) and ovarian granulosa cells (18). In vitro binding studies using cell lines which express the AT2 receptor such as R3T3 cells (19) and PC12W cells (20) showed that the expression of the AT2 receptor is suppressed by growth factors. The expression of the AT2 receptor in R3T3 cells is down regulated by fibroblast growth factor and serum (19). Nerve growth factor suppressed the AT2 receptor expression in PC12W cells (20). These in vivo and in vitro binding studies suggest that expression of the AT2 receptor is tightly controlled and closely related to its biological roles. To clarify this unique tissue specific and ontogeny-dependent expression, we have undertaken cloning of the promoter region of the rat AT2 gene and examined its promoter function in PC12W cells. MATERIALS AND METHODS Reagent. A luciferase assay kit was purchased from Promega (Madison, WI). Fetal calf serum and Dulbecco’s modified Eagles medium (DMEM) were obtained from GIBCO BRL (Gaithersburg, MA) and other tissue culture supplies were from 1
Present address: Research Institute of Angiocardiology and Cardiovascular Clinic, Kyushu University School of Medicine, 3-1-1 Maidashi, Higashi-ku, 812 Fukuoka, Japan. 2 Corresponding author. Fax +1-615-322-3201. 566 0006-291X/96 $18.00 Copyright © 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Sigma (St. Louis, MO). DNA cloning and nucleotide sequencing. A genomic DNA library of SD rat was purchased from Stratagene (La Jolla, CA). Five hundred thousand phages were screened by a conventional plaque hybridization method (21) using 32P-labeled Apa I-Xba I fragment of the rat AT2 receptor cDNA (7) as a probe. Eco RI-Hind III segment which contains the first exon of the rat AT2 gene in its 39 region was subcloned into pBluescript (Stratagene). Deletion mutants of the inserted Eco RI-Hind III fragment were prepared by using an Erase-A-Base kit (Promega). Nucleotide sequences were determined by a dideoxy chain termination method using a Sequenase kit (United States Biochemicals, Cleveland, OH) both in the sense and antisense directions. Primer extension experiment. A 20-mer primer specific for the first exon of the AT2 gene (Fig. 2, 59GCTTTCAATTCTGTGCTCGC39, antisense strand) was end-labeled with 32P-g-ATP and T4 polynucleotide kinase, then purified by an ammonium acetate-ethanol precipitation. Poly (A)+ RNA was prepared from PC12 W cells using a Fast Track kit (In Vitrogen, San Diego, CA). One mg of poly (A)+ RNA was reverse transcribed using the 32P-labeled primer and moloney murine leukemia virus reverse transcriptase (NEB, Beverly, MA). The resultant product was phenol extracted, ethanolprecipitated and resuspended in 4 ml of a loading buffer (95 % formamide, 20 mmol/L EDTA), electrophoresed in 6 % acrylamide-8mol/L urea gel after heat denaturation. Sequencing ladders were obtained by the same primer using a Sequenase kit (United States Biochemicals). Preparation of AT2 promoter-luciferase construct. Six deletion fragments of the promoter region of the AT2 receptor gene were prepared by digestion with restriction endonuclease (D1–D3) or by an Erase-A-Base deletion mutant kit (D4–D6) (Promega). These fragments were cloned into the pGL2B (Promega) luciferase reporter vector. Plasmid DNA were prepared using a Qiagen plasmid kit (Qiagen Inc., Chatsworth, CA). Cell culture and transfection to PC12W cells. PC12W cells were maintained in DMEM supplemented with 10% fetal calf serum and 50 mg/ml gentamycin. Cells were cultured in the presence of 5 % CO2 at 37°C. The day before transfection, 5 × 105 of PC12W cells were prepared in a 6 cm tissue culture dish. On the day of transfection the medium was changed to fresh medium and incubated for 1 hour at 37°C. Then the cells were transfected with 5 mg of AT2 promoter-luciferase construct and 2 mg of pSVb-galactosidase (Promega). The transfection was performed using the DOTAP (N-[1-(2, 3-Dioleoyloxy) propyl]-N, N, N-trimethyl-ammoniummethylsulfate) liposome transfection agent according to manufacture’s instruction (Boehringer-Mannheim, Indianapolis, IN). Cells were incubated with the AT2 promoter-luciferase and pSVbgalactosidase DNAs and DOTAP for 24 hours, then with the fresh medium alone for additional 24 hours. The cells were washed twice with Hank’s balanced salt solution and lysed in 200 ml of lysis buffer (25 mmol/L Tris, pH 7.8, 2 mmol/L EDTA, 2 mmol/L DTT, 10 % glycerol and 1 % Triton X-100). Fifty ml of lysate was used for luciferase activity assay in an Opticomp I luminometer (MGM Instruments Inc., Hamden, CT). The assay was started by adding 100 ml of 470 mmol/L luciferin to cell lysate and integrated peak luminescence was determined over a 45-sec window after a 5 sec delay. The b-galactosidase activity in the same sample was measured spectrophotometrically according to Sambrook et al. (22) and used to normalize the luciferase activity. Statistics. Data are given as means ± SEM. Statistical analysis was performed using analysis of variance and Duncan’s test. Values of P<.05 were considered statistically significant.
RESULTS AND DISCUSSION A 1.2 Kb Eco RI-Hind III segment that contains the 59 end of the rat AT2 cDNA was subcloned from the genomic DNA clone. Nucleotide sequence of this upstream region was determined (Fig. 1). Search for consensus cis DNA elements using data bank TFD 7.3 revealed the presence of potential cis DNA elements for NF-IL6, AP-1, insulin response sequence (IRS), cyclic AMP response element (CRE) and glucocorticoid response element (GRE) as shown in Fig. 1 and Fig. 3. To determine the transcription initiation site of the rat AT2 gene, primer extension experiments were performed. One mg of poly (A)+ RNA from PC12W cells (lane 1) or 50 mg of tRNA (lane 2) were reverse transcribed using a 32P-labeled 20-mer oligonucleotide specific for the first exon of the mouse AT2 gene (Fig. 1, nucleotide +37 to +56). Resultant products were electrophoresed in acrylamide-urea gel. A single band was observed as shown in Fig. 2, lane 1. This initiation site is indicated by an arrow in Fig. 1 (+1 bp). No bands were observed when tRNA was reverse transcribed (Fig. 2, lane 2). We examined the promoter activity of the 1.2 Kb Eco RI-Hind III fragment and its deletion mutants. Six DNA fragments were prepared and fused to a luciferase reporter gene (Fig. 3B). These AT2 promoter-luciferase constructs were introduced into PC12W cells, which express the AT2 receptor (9). The luciferase activity was normalized in reference to b-galactosidase activity expressed by co-transfected pSVb-galactosidase DNA. Results are shown in Fig. 3B. The luciferase 567
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Nucleotide sequences of the promoter region of the rat AT2 gene. Nucleotide sequences of the Eco RI-Hind III fragment were determined by a dideoxy chain termination method using a Sequenase kit (USB) in both the sense and antisense directions. Consensus cis DNA elements and the location of primer used in primer extension experiments (Fig. 2) are indicated by underlines and a box, respectively. The transcription initiation site determined by primer extension experiment is indicated by an arrow. EMBL accession number D50835.
activity of the D1 construct was set to 100 % and this activity is approximately 5% of the promoter activity of SV40. Deletion of the DNA segment between −1208 bp and −749 bp increased relative luciferase activity by about 50 %. The relative luciferase activity of the shortest deletion mutant (D6: −44 bp to +58 bp) showed approximately 40 % of that of the D1 construct. The tissue specific and ontogeny-dependent expression of the AT2 receptor gene suggest possible developmental, neurological and reproductive roles of ANG II via the AT2 receptor and that the biological roles of this receptor is closely related to its unique expression pattern. Because the expression pattern of the AT2 receptor in fetal and adult tissues are different and most of the AT2 568
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The transcription initiation site of the rat AT2 gene. Poly (A)+RNA from PC12W cells (lane 1) and tRNA (lane 2) were reverse transcribed using a 32P-labeled primer specific for the first exon of the AT2 gene (Fig. 1, box). The products were electrophoresed in 6% acrylamide-8 M urea gel. The nucleotide sequences were obtained using the same primer used for the determination of transcription initiation site. The same results were obtained in two independent additional experiments.
FIG. 3. Schematic representation of the promoter region of the rat AT2 gene and promoter activity of its deletion mutants. (A) The white box indicates the first exon of the rat AT2 gene (7). The arrow shown below the first exon indicates the transcription initiation site. Relative location of some restriction sites and putative cis DNA elements are shown. (B) The design of deletion mutant constructs of the promoter region of the rat AT2 gene and their promoter activity are shown. DNA fragments −1210 bp through +58 bp, −749bp through +58 bp, −417 bp through +58 bp, −216 bp through +58 bp, −149 bp through +58 and −144 bp +58 bp were fused to a luciferase gene and designated as D1, D2, D3, D4, D5 and D6, respectively. Relative luciferase activity of the deletion mutants in PC12W cells obtained by 5 mg of the AT2 promoterluciferase constructs is shown in the right panel. The luciferase activity is standardized to b-galactosidase activity obtained by 2 mg of co-transfected pSVb-galactosidase construct. The luciferase activity in D1 construct was set to 100%. A mock transfection was performed using the same amount of a promoter-less luciferase gene. Data are mean ± SEM of four independent experiments. * and ** P<.05 vs. D1. 569
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
sites expressed in the fetus are decreased rapidly after birth, the regulatory mechanism of the AT2 receptor gene expression could be different between the adult and fetal tissues. To clarify the mechanism of this unique tissue specific and ontogeny-dependent AT2 receptor expression, we have undertaken molecular cloning of the promoter region of the rat AT2 gene. The nucleotide sequence of a 1.2 Kb Eco RI-Hind III fragment showed that there are several consensus cis DNA elements in this region. Roles of these cis DNA elements as in the promoter of the AT2 gene, however, have not been determined yet. The DNA segment (−1208 bp to −749 bp) may negatively regulate the promoter activity of the AT2 gene by cis DNA elements such as NF-IL6 or AP-1. The deletion of the DNA segment between −749 bp and −216 bp reduced the relative luciferase activity to 50 % of D1 construct. Therefore this region may be a positive regulatory region. The shortest deletion mutant (D6) still showed significant relative luciferase activity. This region may be important for basal transcription of the rat AT2 gene in PC12W cells. In this DNA segment, there is a TATA box consensus sequence (Fig. 1 and 3). Although this is the second paper describing the nucleotide sequence of the rat AT2 gene promoter (23), we demonstrated the functional significance of the several segments of the rat AT2 gene promoter for the first time. Recently, the importance of interferon regulatory factor (IRF) for the expression of the mouse AT2 receptor in growing and quiecent fibroblasts is reported (24). It is not determined whether the IRF plays role in PC12W cells. PC12W cells, a rat pheochromocytoma cell line, have been reported to constitutively express the AT2 receptor (20). They were derived from the adrenal medulla which expresses AT2 sites in the adult rat. Therefore, the results of deletion analysis of the promoter region of the AT2 receptor gene in the present study probably reflect the transcriptional control mechanism of this gene in the adult tissue and may be different from that of the fetal tissue. Comparison of the results of deletion analysis of the promoter region of the AT2 receptor gene in PC12W cells with that of fetus-derived cells expressing AT2 sites may clarify the mechanisms of the differential regulation of AT2 receptor expression between the fetal and adult tissues. ACKNOWLEDGEMENTS This work was supported in part by Research Grants from United State Public Health Service HL-14192 and HL-35323 from the National Institutes of Health. We especially thank Trinita Fitzgerald for excellent technical assistance in cell culture.
REFERENCES 1. Bottari, S. P., de Gasparo, M., Steckelings, U. M., and Levens, N. R. (1993) Frontiers in Neuroendocrinol. 14, 123–171. 2. Timmermans, P. B. M. W. M., Wong, P. C., Chiu, A. T., Herblin, W. F., Benfield, P., Carini, D. J., Lee, R. J., Wexler, R. R., Saye, J. A. M., and Smith, R. D. (1993) Pharmacolo. Rev. 45, 205–251. 3. Whitebread, S., Mele, M., Kamber, B., and de Gasparo, M. (1989) Biochem. Biophys. Res. Commun. 163, 284–291. 4. Chiu, A. T., Herblin, W. F., McCall, D. E., Ardecky, R. J., Carini, D. J., Dunica, J. V., Pease, L. J., Wong, P. C., Wexler, R. R., Johnson, A. L., and Timmermans, P. B. M. W. M. (1989) Biochem. Biophys. Res. Commun. 165, 196–203. 5. Sasaki, K., Yamano, Y., Bardhan, S., Iwai, N., Murray, J. J., Hasegawa, M., Matsuda, Y., and Inagami, T. (1991) Nature 351, 230–233. 6. Murphy, T. J., Alexander, R. W., Griendling, K. K., Runge, M. S., and Bernstein, K. E. (1991) Nature 351, 233–236. 7. Kambayashi, Y., Bardhan, S., Takahashi, K., Tsuzuki, S., Inui, H., Hamkubo, T., and Inagami, T. (1993) J. Biol. Chem. 268, 24543–24546. 8. Mukoyama, M., Nakajima, M., Horiuchi, M., Sasamura, H., Pratt, R. E., and Dzau, V. J. (1993) J. Biol. Chem. 268, 24539–24542. 9. Webb, M. L., Liu, E. C.-K., Cohen, R. B., Hedberg, A., Bogosian, E. A., Monshizadegan, H., Molloy, C., Serafino, R., Moreland, S., Murphy, T. J., and Dickinson, K. E. J. (1992) Peptides 13, 499–508. 10. Takahashi, K., Bardhan, S., Kambayashi, Y., Shirai, H., and Inagami, T. (1994) Biochem. Biophys. Res. Commun. 198, 60–66. 11. Sumners, C., Tang, W., Zelezna, B., and Raizada, M. K. (1991) Proc. Natl. Acad. Sci. USA 88, 7567–7571. 570
Vol. 222, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
12. Bottari, S. P., King, I. N., Reichlin, S., Dahlstroem, I., Lydon, N., and de Gasparo, M. (1992) Biochem. Biophys. Res. Commun. 183, 206–211. 13. Grady, E. F., Sechi, L. A., Griffin, C. A., Schambelan, M., and Kalinyak, J. E. (1991) J. Clin. Invest. 88, 921–933. 14. Tsutsumi, K., Viswanathan, M., Stromberg, C., and Saavedra, J. M. (1991) Eur. J. Pharmacol. 198, 89–92. 15. Tsutsumi, K., and Saavedra, J. M. (1991) Am. J. Physiol. 261, R209–R216. 16. Sechi, L., Griffin, C. A., Grady, E. F., Kalinyak, J. E., and Schambelan, M. (1992) Circ. Res. 71, 1482–1489. 17. Suzuki, J., Matsubara, H., Urakami, M., and Inada, M. (1993) Circ. Res. 73, 439–447. 18. Pucell, A. G., Hodges, J. C., Sen, I., Bumpus, F. M., and Husain, A. (1991) Endocrinol. 128, 1947–1958. 19. Dudley, D. T., and Summerfelt, R. M. (1993) Regul. Peptides. 44, 199–206. 20. Leung, K. H., Roscoe, W. A., Smith, R. D., Timmermans, P. B. M. W. M., and Chiu, A. T. (1992) Eur. J. Pharmacol. 227, 63–70. 21. Sambrook, J., Fritsch, E. F, and Maniatis, T. (1989) Molecular Cloning, pp. 2.108–2.121, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning, pp. 16.66–16.67, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 23. Kobayashi, S., Ohnishi, J., Nibu, Y., Nishimatsu, S., Umemura, S., Ishii, M., Murakami, K., and Miyazaki, H. (1995) Biochim. Biophys. Acta 1262, 155–158. 24. Horiuchi, M., Koike, G., Yamada, T., Mukoyama, M., Nakajima, M., and Dzau, V. J. (1995) J. Biol. Chem. 270, 20225–20230.
571