- Email: [email protected]
Transcription start site and induction kinetics of the araC regulatory gene in Escherichia coli K-12
J. Mol. Biol. (1983) 170, 1049-1053
Transcription Start Site and Induction Kinetics of the araC Regulatory Gene in Escherichia coli K-12 The in vivo transcription start site of the araC message was determined by S1 nuclease mapping of hybrids formed between labeled DNA, and RNA extracted from cells grown under a variety of pl~ysiological conditions, including the interval of transient derepression following arabinose addition. Under all conditions tested, transcription initiated from the same nucleotide position at - 148.
The araC protein of Escherichia coli plays a central role in regulating expression of the metabolic operon, araBAD, and the two arabinose transport operons, araE and araFG (Englesberg et al., 1965; Schleif, 1969; Greenblatt & Schleif, 1971; Brown & Hogg, 1972; Lee et al., 1974; Kolodrubetz & Schleif, 1981). The synthesis of araC protein itself is also regulated. Transcription of the araC gene is reduced in the absence of cAMP receptor protein (CRP) or cAMP, and is derepressed about fivefold in the absence of active araC protein (Casadaban, 1976). Furthermore, the addition of arabinose to cells induces transcription of araC about fivefold for about 20 minutes, after which it falls back to its preinduction rate (Haggerty, 1977; Ogden et al., 1980; Hahn & Schleif, 1983). One of the objectives of the work presented here was to characterize more fully this unexpected and unexplained transient induction. A second reason for this investigation is derived from questions about the actual initiation site or sites utilized for transcription of araC. Based on the DNA sequence of the a r a C B A D regulatory region (Smith & Schleif, 1978; Greenfield et al., 1978), in vitro transcription and electron microscopy (Hirsh & Schleif, 1977), the location of the transcription start site for the araC message was predicted to lie at position - 167 as shown in Figure 1 (numbering from the + 1 araB transcription start site) (Smith & Schleif, 1978). However, RNA sequencing of the E. coli B/r araC message synthesized either in vivo, apparently under steady-state conditions in the absence of arabinose, or in vitro (Wallace et al., 1981 ) showed that the araC transcription starts at position - 148 instead of at the predicted - 1 6 7 position. The - 1 4 8 initiation site has four of the six highly conserved bases found in a consensus of RNA polymerase initiation sites (Hawley & McCture, 1983) plus an additional four of the ten less highly conserved bases. In contrast, the postulated - 1 6 7 initiation site possesses four of the six highly conserved and six of the ten less-conserved bases (Fig. 1). Therefore, we examined the possibility that some or all araC transcription originates from the - 1 6 7 site under different physiological conditions, such as during the transient derepression interval after arabinose addition to cells, or in cells grown in the presence of antiinducer D-fucose. The start site in a Acya strain was also examined in order to 1049 0022-2836/83/321049-o5 $03.00/0 © 1983 AcademicPress Inc. (London)Ltd.
1050 -48 -i00
C. M. STONER AND R. F. S C H L E I F -38 -ii0
-28 -120
-18 -130
-8 -140
+i -148
+i0 -158
+20 -168
(Start Pc=l) (Start PBAD=I)
AATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTACGCGTTTTTGTCATGGCTTTGGTCCCGCTT tcTTGaca tg TAtaaT G ~ Actual Start tcTTGaca tg TAtaaT G ~ Predicted
Start
RNA Polymerase Consensus Sequence -35 Region -I0 Region +I tcTTGaca .............. tg TAtaaT ...... G
Fio. 1. Nucleotide sequence of the Pc promoter region. Two numberings of the region are shown, one in which + l is the first nucleotide of the Pc transcript and the other in which + 1 is the first nucleotide of the PBADtranscript. The consensus RNA polymerase binding sequence aligned with the predicted and actual transcription start points of Pc is also shown. Hyphens have been omitted from the sequence for clarity.
look for a second p r o m o t e r a d j a c e n t to t h e first, one which m i g h t be m o r e easily o b s e r v e d in t h e a b s e n c e of c A M P r e c e p t o r p r o t e i n , a n a l o g o u s to the gal o p e r o n (Aiba et al., 1981). A n e n d - l a b e l e d a r a C D N A r e s t r i c t i o n f r a g m e n t , which i n c l u d e s t h e t r a n s c r i p t i o n s t a r t site of t h e Pc p r o m o t e r , was d e n a t u r e d a n d h y b r i d i z e d to u n l a b e l e d t o t a l cellular R N A isolated from cells g r o w n in e i t h e r t h e a b s e n c e or t h e presence of a r a b i n o s e for v a r y i n g l e n g t h s of t i m e , or g r o w n in t h e p r e s e n c e of a n t i i n d u c e r D-fucose. D N A was also h y b r i d i z e d t o R N A i s o l a t e d f r o m a A c y a s t r a i n d e l e t e d of its a d e n y l cyclase gene. T h e R N A - D N A h y b r i d was d i g e s t e d w i t h $1 n u c l e a s e to r e m o v e u n p a i r e d regions before d e n a t u r i n g a n d e l e c t r o p h o r e s i s on D N A s e q u e n c i n g gels. B a s e d o n t h e m o b i l i t y of t h e R N A - p r o t e c t e d D N A f r a g m e n t r e l a t i v e to D N A from a " G " s e q u e n c i n g r e a c t i o n a n d c o r r e c t i n g for t h e 1-5-base size difference b e t w e e n t h e S l - d i g e s t e d p r o d u c t versus t h e s e q u e n c i n g p r o d u c t ( H e n t s c h e l et al., 1980), all d e t e c t a b l e t r a n s c r i p t i o n of the a r a C gene, > 9 5 ~ o , i n i t i a t e d from - 1 4 8 + 3 base-pairs, u n d e r all cell g r o w t h c o n d i t i o n s (Fig. 2).
Fro. 2. S 1 nuelease mapping DNA-RNA hybrids of the araC message. Total cellular RNA was isolated from cells according to the procedure described by Salser et al. (1967) with modifications described by Stoner & Schleif (1983). S 1 nuclease mapping of DNA-RNA hybrids was performed according to the procedure described by Berk & Sharp (1977), Barry et al. (1980), and Fukumaki et al. (1982); with modifications as described by Stoner & Schleif (1983). The optimum hybridization temperature was 52°C, optimum incubation time for hybrid formation was 3 to 6 h, and the optimum S 1 nuclease digestion conditions were 4 units S l per 35()-/~l reaction at 45°C for 30 min. The samples were electrophoresed on thin (0.40 mm) 8~/o polyacrylamide/urea denaturing gels as described by Sanger & Coulson (1978). A "G" sequencing reaction of the same fragment, prepared according to Maxam & Gilbert (1980) was run concurrently as a size standard. The gels were autoradiographed with preflashed Kodak X-Omat AR film and an intensifying screen at -70°C. Lane l, G sequencing reaction size standard. Lane 2, RNA isolated from AaraC cells. Lane 3, RNA from cells with araC hyperproducing plasmid pRFSI3 grown in the absence of arabinose. Lane 4, RNA from Ara(CBAD)+ cells grown in absence of arabinose. Lane 5, RNA from Ara(CBAD)+ cells grown in absence of arabinose but as a control arabinose was present in the ice/sodium azide/chloramphenicol mixture in the first step of RNA isolation procedure. Lanes 6 to 10, RNA from Ara(CBAD)+ cells, grown in the presence of arabinose for 2, 6, 18, 50 and 150 min. Lane ll, RNA from ACya Ara(CBAD)+ cells, -arabinose. Lane 12, RNA from ACya Ara(CBAD)+ cells, and induced with arabinose for 6 min. Lane 13, RNA from Ara(CBAD)+ cells, and incubated with fucose for 6 min. Lane 14, RNA from a different isolation from Ara(CBAD)+ cells, and induced with arabinose for 5 rain. Lane 15, RNA alone control. Lane 16, DNA alone control.
1051
LETTERS TO THE EDITOR
The $1 nuclease mapping technology permits quantitation of relative messenger levels. Therefore, the induction kinetics of araC message could easily be measured following addition of arabinose, araC message is induced within two minutes of the addition of arabinose, increases to four times its basal level by six minutes, and then declines back to its basal level (Figs 2 and 3). The basal level of araC transcription is repressed by the addition of anti-inducer D-fucose. This is I
2
3
4
5
6
7
8
9
I0
II
12
13
14
15
16
&
t -50
•
8
& I
°
am
Ogo
o
o
o
50~o O
O G,
i 60 • O
90-
Fzo. 2
-a
OfO C
1052
C. M. STONER AND R. F. SCHLEIF .
% x
3
2 :7 E Z 0 .c
I
~L~ cyo 0
I0
30
50
70
90
110
130
150
Time cells grown in orobinose (rain)
Fro. 3. Kinetics of Pc promoter activity. Cells were harvested and RNA was extracted at various times after arabinose addition. RNA-DNA hybrids were formed, digested with S1 nuclease, denatured, and separated by electrophoresis. Amount of radioactivity protected in the araC [32P]DNA-RNA hybrid was determined as the densitometry of an autoradiogram.
consistent with the result of H a g g e r t y (1977) who found t h a t Pc is 2-5-fold more strongly repressed in vivo when D-fUcose is added to cells. The basal level of transcription is fourfold lower in the ACya strain than in the Cya + strain and it only induces very slightly if at all in the first six minutes after arabinose addition. The controls for these experiments were: (l) denatured araC DNA incubated with RNA isolated from a AAraC strain yielded no hybrid; (2) DNA hybridized to RNA isolated from a strain containing an araC hyperproducing plasmid (Schteif & Favreau, 1982), grown in the absence of arabinose, yielded a higher basal level of araC message; (3) araC message was not induced in cells grown in the absence of arabinose and harvested by pouring them into a bottle containing arabinose in addition to the ice, sodium azide and chloramphenicol, which shows t h a t transcription is terminated immediately in the first step of the RNA preparation; (4) the RNA alone control showed no hybrid formation; and (5) the DNA alone control showed only the undenatured or renatured DNA probe. In this letter we report determination of the in vivo transcription s t a r t point of the araC messenger in E. coli cells growing under a variety of physiological conditions. All detectable transcription initiated from the same nucleotide position at - 1 4 8 . This is the position originally determined under one physiological condition, by Wallace et al. (1981), and not the position predicted on the basis of the DNA sequence in the region (Smith & Schleif, 1978). Even though we find t h a t the addition of arabinose transiently derepresses the Pc promoter at least fourfold, all this additional transcription also initiates from the same site. Since the - 1 4 8 site utilizes a p r o m o t e r sequence with poorer homology to the - 3 5 and - 1 0 RNA polymerase consensus sequences than the unused - 1 6 7 site,
LETTERS TO THE EDITOR
1053
it is clear t h a t homology to these sequences alone does not provide a reliable indication of p r o m o t e r activity. This work was supported by United States Public Health Service research grant 18277, and training grant GM212 from the National Institutes of Health. Department of Biochemistry Brandeis University Waltham, Mass. 02254, U.S.A.
CAROL M. STONER ROBERT F. SCHLEIF
Received 3 May 1983
REFERENCES Aiba, H., Adhya, S. & deCrombrugghe, B. (1981). J. Biol. Chem. 256, ll905-11910. Barry, G., Squires, C. & Squires, C. L. (1980). Proc. Nat. Acad. Sci., U.S.A. 77, 3331-3335. Berk, A. J. & Sharp, P. A. (1977). Cell, 12, 721-732. Brown, C. E. & Hogg, R. W. (1972). J. Bacteriol. 111,606-613. Casadaban, M. (1976). J. Mol. Biol. 104, 557-566. Englesberg, E., In, J., Power, J. & Lee, N. (1965). J. Bacteriol. 90, 946-957. Fukumaki, Y., Ghosh, P. K., Benz, Jr., Reddy, V. B., Lebowitz, P., Forget, B. G. & Weissman, S. M. (1982). Cell, 28, 585-591. Greenblatt, J. & Schleif, R. (1971). Nature New Biol. 233, 166-170. Greenfield, L., Boone, T. & Wilcox, G. (1978). Proc. Nat. Acad. Sci., U.S.A, 75, 4724-4728. Haggerty, D. (1977). Ph.D. thesis, Brandeis University. Hahn, S. & Schleif, R. (1983). J. Bacteriol. 155, 593-600. Hawley, D. & McClure, W. (1983). Nucl. Acids Res. in the press, Hentschel, C., Irminger, J., Bucher, P. & Birnstiel, M. L. (1980). Nature (London), 285, 147-151. Hirsh, J. & Schlief, R. (1977). Cell, 11,545-566. Kolodrubetz, D. & Schleif, R. (1981). J. Mol. Biol. 151,215-227. Lee, N., Wilcox, G., Gielow, W., Arnold, L., Cleary, P. & Englesberg, E. (1974). Proc. Nat. Acad. Sci., U.S.A. 71,634-638. Maxam. A. & Gilbert, W. (1980). In Methods in Enzymology (Grossman, L. & Moldave, K., eds), vol. 65, pp. 499-560, Academic Press, New York. Ogden, S., Haggerty, D., Stoner, C. M., Kolodrubitz, D. & Schleif, R. (1980). Proc. Nat. Acad. Sci., U.S.A. 77, 3346-3350. Salser, W., Gesteland, R. F. & Bolle, A. (1967). Nature New Biol. 215, 588-591. Sanger, F. & Coulson, A. R. (1978). F E B S Letters, 87, 107-110. Schleif, R. (1969). J. Mol. Biol. 46, 185-196. Schleif, R. & Favreau, M. A. (1982). Biochemistry, 21,778-782. Smith, B. R. & Schleif, R. (1978). J. Biol. Chem. 253, 6931-6933. Stoner, C. M. & Schleif, R. (1983). J. Mol. Biol. In the press. Wallace, R. G., Lee, N. & Fowler, A. V. (1981). Gene, 12, 179-190. Edited by S. Brenner
Transcription Start Site and Induction Kinetics of the araC Regulatory Gene in Escherichia coli K-12 The in vivo transcription start site of the araC message was determined by S1 nuclease mapping of hybrids formed between labeled DNA, and RNA extracted from cells grown under a variety of pl~ysiological conditions, including the interval of transient derepression following arabinose addition. Under all conditions tested, transcription initiated from the same nucleotide position at - 148.
The araC protein of Escherichia coli plays a central role in regulating expression of the metabolic operon, araBAD, and the two arabinose transport operons, araE and araFG (Englesberg et al., 1965; Schleif, 1969; Greenblatt & Schleif, 1971; Brown & Hogg, 1972; Lee et al., 1974; Kolodrubetz & Schleif, 1981). The synthesis of araC protein itself is also regulated. Transcription of the araC gene is reduced in the absence of cAMP receptor protein (CRP) or cAMP, and is derepressed about fivefold in the absence of active araC protein (Casadaban, 1976). Furthermore, the addition of arabinose to cells induces transcription of araC about fivefold for about 20 minutes, after which it falls back to its preinduction rate (Haggerty, 1977; Ogden et al., 1980; Hahn & Schleif, 1983). One of the objectives of the work presented here was to characterize more fully this unexpected and unexplained transient induction. A second reason for this investigation is derived from questions about the actual initiation site or sites utilized for transcription of araC. Based on the DNA sequence of the a r a C B A D regulatory region (Smith & Schleif, 1978; Greenfield et al., 1978), in vitro transcription and electron microscopy (Hirsh & Schleif, 1977), the location of the transcription start site for the araC message was predicted to lie at position - 167 as shown in Figure 1 (numbering from the + 1 araB transcription start site) (Smith & Schleif, 1978). However, RNA sequencing of the E. coli B/r araC message synthesized either in vivo, apparently under steady-state conditions in the absence of arabinose, or in vitro (Wallace et al., 1981 ) showed that the araC transcription starts at position - 148 instead of at the predicted - 1 6 7 position. The - 1 4 8 initiation site has four of the six highly conserved bases found in a consensus of RNA polymerase initiation sites (Hawley & McCture, 1983) plus an additional four of the ten less highly conserved bases. In contrast, the postulated - 1 6 7 initiation site possesses four of the six highly conserved and six of the ten less-conserved bases (Fig. 1). Therefore, we examined the possibility that some or all araC transcription originates from the - 1 6 7 site under different physiological conditions, such as during the transient derepression interval after arabinose addition to cells, or in cells grown in the presence of antiinducer D-fucose. The start site in a Acya strain was also examined in order to 1049 0022-2836/83/321049-o5 $03.00/0 © 1983 AcademicPress Inc. (London)Ltd.
1050 -48 -i00
C. M. STONER AND R. F. S C H L E I F -38 -ii0
-28 -120
-18 -130
-8 -140
+i -148
+i0 -158
+20 -168
(Start Pc=l) (Start PBAD=I)
AATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTACGCGTTTTTGTCATGGCTTTGGTCCCGCTT tcTTGaca tg TAtaaT G ~ Actual Start tcTTGaca tg TAtaaT G ~ Predicted
Start
RNA Polymerase Consensus Sequence -35 Region -I0 Region +I tcTTGaca .............. tg TAtaaT ...... G
Fio. 1. Nucleotide sequence of the Pc promoter region. Two numberings of the region are shown, one in which + l is the first nucleotide of the Pc transcript and the other in which + 1 is the first nucleotide of the PBADtranscript. The consensus RNA polymerase binding sequence aligned with the predicted and actual transcription start points of Pc is also shown. Hyphens have been omitted from the sequence for clarity.
look for a second p r o m o t e r a d j a c e n t to t h e first, one which m i g h t be m o r e easily o b s e r v e d in t h e a b s e n c e of c A M P r e c e p t o r p r o t e i n , a n a l o g o u s to the gal o p e r o n (Aiba et al., 1981). A n e n d - l a b e l e d a r a C D N A r e s t r i c t i o n f r a g m e n t , which i n c l u d e s t h e t r a n s c r i p t i o n s t a r t site of t h e Pc p r o m o t e r , was d e n a t u r e d a n d h y b r i d i z e d to u n l a b e l e d t o t a l cellular R N A isolated from cells g r o w n in e i t h e r t h e a b s e n c e or t h e presence of a r a b i n o s e for v a r y i n g l e n g t h s of t i m e , or g r o w n in t h e p r e s e n c e of a n t i i n d u c e r D-fucose. D N A was also h y b r i d i z e d t o R N A i s o l a t e d f r o m a A c y a s t r a i n d e l e t e d of its a d e n y l cyclase gene. T h e R N A - D N A h y b r i d was d i g e s t e d w i t h $1 n u c l e a s e to r e m o v e u n p a i r e d regions before d e n a t u r i n g a n d e l e c t r o p h o r e s i s on D N A s e q u e n c i n g gels. B a s e d o n t h e m o b i l i t y of t h e R N A - p r o t e c t e d D N A f r a g m e n t r e l a t i v e to D N A from a " G " s e q u e n c i n g r e a c t i o n a n d c o r r e c t i n g for t h e 1-5-base size difference b e t w e e n t h e S l - d i g e s t e d p r o d u c t versus t h e s e q u e n c i n g p r o d u c t ( H e n t s c h e l et al., 1980), all d e t e c t a b l e t r a n s c r i p t i o n of the a r a C gene, > 9 5 ~ o , i n i t i a t e d from - 1 4 8 + 3 base-pairs, u n d e r all cell g r o w t h c o n d i t i o n s (Fig. 2).
Fro. 2. S 1 nuelease mapping DNA-RNA hybrids of the araC message. Total cellular RNA was isolated from cells according to the procedure described by Salser et al. (1967) with modifications described by Stoner & Schleif (1983). S 1 nuclease mapping of DNA-RNA hybrids was performed according to the procedure described by Berk & Sharp (1977), Barry et al. (1980), and Fukumaki et al. (1982); with modifications as described by Stoner & Schleif (1983). The optimum hybridization temperature was 52°C, optimum incubation time for hybrid formation was 3 to 6 h, and the optimum S 1 nuclease digestion conditions were 4 units S l per 35()-/~l reaction at 45°C for 30 min. The samples were electrophoresed on thin (0.40 mm) 8~/o polyacrylamide/urea denaturing gels as described by Sanger & Coulson (1978). A "G" sequencing reaction of the same fragment, prepared according to Maxam & Gilbert (1980) was run concurrently as a size standard. The gels were autoradiographed with preflashed Kodak X-Omat AR film and an intensifying screen at -70°C. Lane l, G sequencing reaction size standard. Lane 2, RNA isolated from AaraC cells. Lane 3, RNA from cells with araC hyperproducing plasmid pRFSI3 grown in the absence of arabinose. Lane 4, RNA from Ara(CBAD)+ cells grown in absence of arabinose. Lane 5, RNA from Ara(CBAD)+ cells grown in absence of arabinose but as a control arabinose was present in the ice/sodium azide/chloramphenicol mixture in the first step of RNA isolation procedure. Lanes 6 to 10, RNA from Ara(CBAD)+ cells, grown in the presence of arabinose for 2, 6, 18, 50 and 150 min. Lane ll, RNA from ACya Ara(CBAD)+ cells, -arabinose. Lane 12, RNA from ACya Ara(CBAD)+ cells, and induced with arabinose for 6 min. Lane 13, RNA from Ara(CBAD)+ cells, and incubated with fucose for 6 min. Lane 14, RNA from a different isolation from Ara(CBAD)+ cells, and induced with arabinose for 5 rain. Lane 15, RNA alone control. Lane 16, DNA alone control.
1051
LETTERS TO THE EDITOR
The $1 nuclease mapping technology permits quantitation of relative messenger levels. Therefore, the induction kinetics of araC message could easily be measured following addition of arabinose, araC message is induced within two minutes of the addition of arabinose, increases to four times its basal level by six minutes, and then declines back to its basal level (Figs 2 and 3). The basal level of araC transcription is repressed by the addition of anti-inducer D-fucose. This is I
2
3
4
5
6
7
8
9
I0
II
12
13
14
15
16
&
t -50
•
8
& I
°
am
Ogo
o
o
o
50~o O
O G,
i 60 • O
90-
Fzo. 2
-a
OfO C
1052
C. M. STONER AND R. F. SCHLEIF .
% x
3
2 :7 E Z 0 .c
I
~L~ cyo 0
I0
30
50
70
90
110
130
150
Time cells grown in orobinose (rain)
Fro. 3. Kinetics of Pc promoter activity. Cells were harvested and RNA was extracted at various times after arabinose addition. RNA-DNA hybrids were formed, digested with S1 nuclease, denatured, and separated by electrophoresis. Amount of radioactivity protected in the araC [32P]DNA-RNA hybrid was determined as the densitometry of an autoradiogram.
consistent with the result of H a g g e r t y (1977) who found t h a t Pc is 2-5-fold more strongly repressed in vivo when D-fUcose is added to cells. The basal level of transcription is fourfold lower in the ACya strain than in the Cya + strain and it only induces very slightly if at all in the first six minutes after arabinose addition. The controls for these experiments were: (l) denatured araC DNA incubated with RNA isolated from a AAraC strain yielded no hybrid; (2) DNA hybridized to RNA isolated from a strain containing an araC hyperproducing plasmid (Schteif & Favreau, 1982), grown in the absence of arabinose, yielded a higher basal level of araC message; (3) araC message was not induced in cells grown in the absence of arabinose and harvested by pouring them into a bottle containing arabinose in addition to the ice, sodium azide and chloramphenicol, which shows t h a t transcription is terminated immediately in the first step of the RNA preparation; (4) the RNA alone control showed no hybrid formation; and (5) the DNA alone control showed only the undenatured or renatured DNA probe. In this letter we report determination of the in vivo transcription s t a r t point of the araC messenger in E. coli cells growing under a variety of physiological conditions. All detectable transcription initiated from the same nucleotide position at - 1 4 8 . This is the position originally determined under one physiological condition, by Wallace et al. (1981), and not the position predicted on the basis of the DNA sequence in the region (Smith & Schleif, 1978). Even though we find t h a t the addition of arabinose transiently derepresses the Pc promoter at least fourfold, all this additional transcription also initiates from the same site. Since the - 1 4 8 site utilizes a p r o m o t e r sequence with poorer homology to the - 3 5 and - 1 0 RNA polymerase consensus sequences than the unused - 1 6 7 site,
LETTERS TO THE EDITOR
1053
it is clear t h a t homology to these sequences alone does not provide a reliable indication of p r o m o t e r activity. This work was supported by United States Public Health Service research grant 18277, and training grant GM212 from the National Institutes of Health. Department of Biochemistry Brandeis University Waltham, Mass. 02254, U.S.A.
CAROL M. STONER ROBERT F. SCHLEIF
Received 3 May 1983
REFERENCES Aiba, H., Adhya, S. & deCrombrugghe, B. (1981). J. Biol. Chem. 256, ll905-11910. Barry, G., Squires, C. & Squires, C. L. (1980). Proc. Nat. Acad. Sci., U.S.A. 77, 3331-3335. Berk, A. J. & Sharp, P. A. (1977). Cell, 12, 721-732. Brown, C. E. & Hogg, R. W. (1972). J. Bacteriol. 111,606-613. Casadaban, M. (1976). J. Mol. Biol. 104, 557-566. Englesberg, E., In, J., Power, J. & Lee, N. (1965). J. Bacteriol. 90, 946-957. Fukumaki, Y., Ghosh, P. K., Benz, Jr., Reddy, V. B., Lebowitz, P., Forget, B. G. & Weissman, S. M. (1982). Cell, 28, 585-591. Greenblatt, J. & Schleif, R. (1971). Nature New Biol. 233, 166-170. Greenfield, L., Boone, T. & Wilcox, G. (1978). Proc. Nat. Acad. Sci., U.S.A, 75, 4724-4728. Haggerty, D. (1977). Ph.D. thesis, Brandeis University. Hahn, S. & Schleif, R. (1983). J. Bacteriol. 155, 593-600. Hawley, D. & McClure, W. (1983). Nucl. Acids Res. in the press, Hentschel, C., Irminger, J., Bucher, P. & Birnstiel, M. L. (1980). Nature (London), 285, 147-151. Hirsh, J. & Schlief, R. (1977). Cell, 11,545-566. Kolodrubetz, D. & Schleif, R. (1981). J. Mol. Biol. 151,215-227. Lee, N., Wilcox, G., Gielow, W., Arnold, L., Cleary, P. & Englesberg, E. (1974). Proc. Nat. Acad. Sci., U.S.A. 71,634-638. Maxam. A. & Gilbert, W. (1980). In Methods in Enzymology (Grossman, L. & Moldave, K., eds), vol. 65, pp. 499-560, Academic Press, New York. Ogden, S., Haggerty, D., Stoner, C. M., Kolodrubitz, D. & Schleif, R. (1980). Proc. Nat. Acad. Sci., U.S.A. 77, 3346-3350. Salser, W., Gesteland, R. F. & Bolle, A. (1967). Nature New Biol. 215, 588-591. Sanger, F. & Coulson, A. R. (1978). F E B S Letters, 87, 107-110. Schleif, R. (1969). J. Mol. Biol. 46, 185-196. Schleif, R. & Favreau, M. A. (1982). Biochemistry, 21,778-782. Smith, B. R. & Schleif, R. (1978). J. Biol. Chem. 253, 6931-6933. Stoner, C. M. & Schleif, R. (1983). J. Mol. Biol. In the press. Wallace, R. G., Lee, N. & Fowler, A. V. (1981). Gene, 12, 179-190. Edited by S. Brenner