Transcriptional Pausing in Vivo: A Nascent RNA Hairpin Restricts Lateral Movements of RNA Polymerase in Both Forward and Reverse Directions

doi:10.1016/j.jmb.2005.05.052

J. Mol. Biol. (2005) 351, 39–51

Transcriptional Pausing in Vivo: A Nascent RNA Hairpin Restricts Lateral Movements of RNA Polymerase in Both Forward and Reverse Directions Francine Toulme´1, Christine Mosrin-Huaman1, Irina Artsimovitch2 and A. Rachid Rahmouni1* 1

Centre de Biophysique Mole´culaire, UPR 4301 du CNRS, rue Charles Sadron 45071 Orle´ans ce´dex 2, France 2 Department of Microbiology The Ohio State University 484 West 12th Avenue Columbus, OH 43210, USA

Transcriptional pausing by RNA polymerase has been the subject of extensive investigations in vitro, yet little is known about its occurrence and significance in vivo. The transient nature of the pausing events makes them difficult to observe inside the cell, whereas their studies in vitro by classical biochemical methods are usually conducted under non-physiological conditions that increase the pause duration. Here, we have used an Escherichia coli system in which several RNA polymerase molecules transcribing in tandem traverse a pausing sequence while approaching a protein roadblock. The in vivo DNA footprinting and RNA 3 0 end mapping of the elongation complexes are consistent with a dynamic view of the pausing event, during which RNA polymerase first loses its lateral stability and slides backward, and is subsequently rescued from extended backtracking and stabilized at the pause site by a nascent RNA hairpin. Our results show also that the folding of the hairpin provides an assisting force that promotes forward translocation of a trailing polymerase under a strained configuration by balancing the opposing force created by a steric clash with a leading elongation complex. q 2005 Elsevier Ltd. All rights reserved.

*Corresponding author

Keywords: transcriptional pausing; transcription regulation; RNA polymerase backtracking; hairpin-dependent pausing; initially transcribed sequence

Introduction In all living organisms, transcription constitutes the first and arguably the most elaborately controlled step in gene expression. Many different regulators that act during initiation, elongation, and termination affect RNA polymerase (RNAP) activity and ultimately determine the patterns of gene expression.1,2 In recent years, numerous structural and biochemical studies yielded important insights into the basic catalytic mechanism and the regulation of transcription. Transcription elongation complex (TC) composed minimally of the RNAP, the DNA template, and the nascent RNA transcript is characterized by high stability and processivity: RNAP must remain associated with Abbreviations used: RNAP, RNA polymerase; TC, transcription elongation complex; CAA, chloroacetaldehyde. E-mail address of the corresponding author: [email protected]

each nascent RNA chain until termination, and thus catalyzes many thousands (in Bacteria) or millions (in Eucarya) of successive nucleotide addition steps. The remarkable stability of the TC has been attributed to a network of protein–nucleic acids interactions, particularly those between the socalled downstream clamp and the duplex DNA in front of the active site, as well as the extensive RNAP contacts with the 8–9 bp long RNA:DNA hybrid formed between the 3 0 proximal segment of the transcript and the template DNA strand within the transcription bubble.3 Studies of transcription elongation demonstrated that the RNA chain extension does not proceed at a constant rate. Some intrinsic signals halt transcription, either transiently (at pause sites) or indefinitely (at arrest sites), or induce the release of the nascent RNA (at terminators), whereas others switch RNAP into a state that is resistant to these signals.2,4–6 Recognition of these regulatory sites is affected by, and sometimes depends on, accessory protein factors and small molecular mass

0022-2836/$ - see front matter q 2005 Elsevier Ltd. All rights reserved.

40 effectors.7–10 However, most of these data have been collected in vitro, frequently under artificial conditions that aid in biochemical characterization of TCs (such as substrate deprivation) and in the absence of accessory factors. In contrast, only cursory information is available from the in vivo analysis of actively transcribing complexes, the actual regulatory targets. Transcriptional pause signals that punctuate rapid RNA chain extension are encoded by the template DNA and by the nascent RNA structures. Studies of Escherichia coli RNAP pausing in vitro have defined two major classes of pause signals.7 Pausing at class I signals is associated with the formation of a nascent hairpin structure located 10–12 nt upstream from the RNA 3 0 end. The temporary delay of nucleotide addition at the pause site is believed to result from interactions between the RNA hairpin and RNAP that allosterically affect the catalytic architecture of the enzyme’s active center.11,12 Hairpin-dependent pause sites are thought to control attenuation of the amino acid biosynthetic operons in response to the availability of the cognate amino acids by synchronizing RNAP translocation with the movement of the translation machinery.13 In this mode of regulation, the availability of a specific charged tRNA determines the outcome (termination or readthrough) at a downstream position. Pausing at a class I site was previously detected in E. coli by indirect methods.14 The delay of nucleotide addition at class II pause signals has been attributed to the formation of a backtracked TC, in which RNAP slides backward along the RNA and DNA chains, threading the nascent RNA through, and blocking the active site. The relative stabilities of the RNA:DNA hybrids in the active and backtracked states correlate with the propensity of RNAP to slide backwards.15 Incorporation of nucleotide analogs such as IMP or thioUMP that decrease the hybrid stability or misincorporation lead to backtracking.16,17 Apparently, backtracking mediates various regulatory decisions in bacteria and is also supposed to be the major mode of RNAP pausing in eukaryotes. In bacteria, backtracking has been shown to occur at sites that mediate recruitment of regulatory factors18,19 during approach to an intrinsic terminator where pausing may allow time for formation of a terminator hairpin,20,21 and during arrest which is accompanied by an extensive retreat of RNAP.22 Arrest is irreversible and requires an endonucleolytic cleavage of the extruded 3 0 RNA segment that positions a newly created 3 0 end in the active site.22 Transcript cleavage factors GreA and GreB in E. coli stimulate the RNAP endonuclease activity and thus rescue arrested complexes.23 Two lines of evidence suggest that backtracking may regulate transcription similarly in vitro and inside the cell. First, pausing at a class II site has been detected at the same position both in vivo and in vitro.19,24 Second, Gre factors that target backtracked TCs affect RNAP processivity in vitro and in vivo.18,25

Transcriptional Pausing in Vivo

Despite the widely accepted role of RNAP pausing in gene regulation, detailed assessment of its occurrence and significance in vivo has not been performed, chiefly because the transient nature of the pausing events makes them difficult to observe directly. Moreover, most of our knowledge on the mechanisms of RNAP backtracking stems from biochemical studies of TCs halted at specific template positions by NTP deprivation16,26,27 raising the question whether extended backward motions of RNAP that lead to pausing and arrest do occur under physiological conditions. Recently, single-molecule transcription experiments have shown that, at least for individually transcribing RNAP molecules, pausing does occur during continuous elongation and at physiological concentrations of NTPs. High resolution observations of the transcribing molecules suggested that most long-lived pauses result from RNAP backtracking. However, both the frequency and the duration of the backtracking events seem to be dependent on the mechanical force applied to RNAP: an opposing force increases backtracking, whereas an assisting force reduces it.28–30 Conceivably, RNAP transcribing in the cellular context could also be subjected to mechanical forces due to physical obstacles. These impediments may include protein roadblocks, which are inherent to the condensed structure of chromosomal DNA and site-specific DNA-binding proteins and could exert an opposing force, thus favoring backward movements. Also, leading and trailing RNAP molecules moving in tandem along highly transcribed DNA segments, such as rrn operons, could assist or hinder one another.31,32 In the present work, we used a combination of DNA and RNA footprinting experiments to analyze the structural rearrangements experienced by a TC at a transcriptional pause site in vivo. Our results provide a dynamic view of RNAP backtracking within the pausing sequence and its lateral stabilization by a nascent RNA hairpin. We show that the folding of the nascent transcript constitutes yet another source of mechanical force that rescues the TC from an extended retreat and assists RNAP in the forward motion at template locations where its lateral stability (i.e. its resistance to backtracking) is impaired.

Results Detection of a transcriptional pausing event in vivo We have previously reported the design of an experimental system that allows for studies of the structure and dynamics of TC directly inside E. coli cells.25,33 In this system, RNAP that initiates transcription from the constitutive hisR promoter on a plasmid traverses the initially transcribed 40 bp long region and then becomes temporarily halted at a distal position by the lac repressor bound to its 22 bp operator site (Figure 1(a)). The distance

Transcriptional Pausing in Vivo

41

Figure 1. (a) Schematic representation of the relevant part of the plasmid constructs used in the in vivo footprinting. The 40 bp sequence of the initially transcribed region is enlarged and shows the restriction sites used for the mapping experiments. (b) Primer extension analyses of the in situ CAA modifications on the non-template strands of pATC17 and pATC20. The positions of the lac operator (Op) and the (ATC/TAG) repeats are represented by the vertical lines. The locations of TC1, TC2, and TC3 are indicated on the side. The arrows show the reactive sites within the initiation complex (In).

between the transcription start point and the repressor roadblock can be modulated by varying the length of a trinucleotide (ATC/TAG) repeat, which in turn would determine the number of tandem RNAP molecules bound to the transcribed DNA segment. The cat gene positioned downstream from the lac operator site allows for the in vivo measurements of the efficiency at which RNAP can transcribe past the roadblock. The dynamic features of the roadblocked TCs were investigated by a combination of in situ footprinting with the single-strand-specific probe chloroacetaldehyde (CAA), which reacts with unpaired C and A bases on the non-template strand, and thus reveals the location of the transcription bubble, and by S1 nuclease mapping experiments that identify the position of the 3 0 nucleotide in the nascent RNA. Comparison of the CAA footprinting results obtained with two representative constructs, pATC17 and pATC20, that harbor (ATC/TAG)17 and (ATC/TAG)20 repeats, respectively, revealed similar reactivity patterns (Figure 1(b)): one RNAP molecule was stalled at

the promoter during initiation (In) whereas three other RNAPs (numbered TC1, TC2 and TC3) were transcribing in tandem in the region between the promoter and the repressor binding site. The dynamic features of TC1, which is located within the (ATC/TAG) repeat in close apposition to the lac repressor, have been described in detail.25,33 In this complex, the roadblocked RNAP slides back and forth on the template between two positions, 3 bp apart, with concomitant Gre-mediated transcript cleavage and re-synthesis. These lateral oscillations lead to an apparent increase in the size of the CAA footprint (as compared to a stably positioned complex33) and produce a cluster of RNA 3 0 ends distributed between two major positions located 6 and 9 bp from the upstream edge of the operator motif (see below). If the position of the trailing TCs (TC2 and TC3) were dictated primarily by the steric occlusion created by the roadblocked TC1, one would expect the distances between the tandem TCs to remain constant regardless of the (ATC/TAG) repeat length. Analysis of the CAA patterns, however,

42 indicates that whereas the TC2 complexes are located at virtually the same position within the two plasmids, TC3 appears to be shifted upstream in pATC20 (Figure 1(b), compare lanes 1 and 3). Given the 9 bp difference in the length between the two constructs, RNAP is apparently experiencing a temporary delay (pause) during elongation within the end of the initially transcribed region. The CAA footprints observed in the presence of the inducer (IPTG), which removes the repressor roadblock and thereby restores a continuous flow of transcription, are consistent with this hypothesis: in addition to the strong reactivity within the promoter, reminiscent of a slow-start initiation complex,34 weak but significant reactivities were detected within the suspected pausing region in both plasmids (Figure 1(b), lanes 2 and 4). The mere detection of such reactivities in the absence of a roadblock is a clear indication that RNAP decelerates dramatically within this region. To determine the location of the trailing TC more precisely, we constructed a series of plasmids with shorter (ATC/TAG) repeats that should accommodate only two TCs between the promoter and the repressor roadblock. This prediction was indeed confirmed by the in situ CAA footprints (Figure 2(a)). In accord with the results obtained with longer transcribed regions (Figure 1(b)), in all the constructs the position of the leading RNAP (TC1) was dictated by the location of the repressor roadblock, whereas the trailing RNAP (TC2) appeared to occupy the same position relative to the promoter with a corresponding increase in the distance from the lac repressor. Notably, the distance between the apparent footprint of TC2 and the repressor site increases by 6 bp when comparing pATC8 with pATC10 and by an additional 4 bp between pATC10 and pATC10-S (filling-in of the SalI restriction site in pATC10; see Materials and Methods). Again, these results demonstrate that the trailing RNAP is temporarily halted within the end of the initially transcribed region (see the summary of the footprints in Figure 2(b)). The CAA footprint of the complex within the putative pause site was better resolved in these new constructs and revealed 10–12 bp of unwound DNA between positions C25 and C35 relative to the transcription start point. The lateral stability of the TC is impaired within the pausing sequence To further characterize the dynamic features of the paused complexes, we performed S1 nuclease protection experiments to map their RNA 3 0 ends. We focused our analyses on the templates that contained only two elongating RNAPs upstream from the roadblock. Cellular RNAs extracted from cells harboring the constructs were hybridized to 3 0 end-labeled single-stranded DNA probes and digested with S1 nuclease. The template strand of the BlpI-PstI DNA fragment (Figure 1(a)) was isolated from each plasmid and used as a probe.

Transcriptional Pausing in Vivo

In these experiments, we increased the amount of the labeled DNA strand sixfold (as compared to our previous work25) to circumvent a titration of the probe by the longer transcripts (read-through transcripts and TC1 transcripts), which could compromise the detection of shorter transcripts from TC2. In the absence of inducer, two clusters of RNA 3 0 ends were detected with the transcripts extracted from cells bearing the pATC8 construct (Figure 3(a), lane 1). One cluster defines the transcripts that have been elongated by the leading TC1 complex to positions C55 and C58. We previously reported that these two positions, formerly referred to as K6 and K9 with respect to the upstream border of the operator motif, reflect the back and forth oscillations of RNAP in front of the lac repressor roadblock with concomitant Gre-mediated transcript trimming and re-elongation.25,33 It is important to note that the 55 and 58-mer transcripts are apparently present in the cell in approximately equal amounts, indicating the state of equilibrium between the cleavage and re-start processes. The second cluster corresponds to the 3 0 ends of transcripts that have been elongated by the trailing TC2 complex to positions C32, C33 and C34, with the major 3 0 end at C34. Transcripts produced under roadblocking conditions by the three other plasmids (pATC9, pATC10 and pATC10-S) also exhibited two major clusters of RNA 3 0 ends (Figure 3(a), lanes 3, 5 and 7). The first cluster was moving in concert with the position of the lac repressor, apparently reflecting the fact that TC1 is halted, in each case, in close apposition to the repressor roadblock. In contrast, the majority of the 3 0 ends originated from TC2 transcripts on pATC9 and a fraction of those on pATC10 and pATC10-S were clustered around positions C34 and C35. If the advancement of the trailing RNAP along the template was dictated solely by steric occlusion imposed by the leading complex, the TC2 3 0 ends would be moving forward in concert with the stretching of the repeat to maintain a constant distance between the two transcribing enzymes. Thus, in agreement with the CAA footprinting data, these results indicate that at least a fraction of transcribing RNAPs dwell for a significant length of time around positions C34 and C35. This apparent location of TC2 complexes could reflect either a primary pausing event, in which nucleotide addition beyond positions C34 and C35 is delayed, or Gre-mediated cleavage of longer transcripts following RNAP backtracking. To distinguish between these two possibilities, we performed S1 mapping experiments with E. coli mutants that lack functional Gre factors. Comparison of the S1 nuclease mapping patterns of the transcripts extracted from wild-type or GreA/GreB double mutant strains transformed with the plasmids pATC8, pATC9 and pATC10 (Figure 3(b)) indicates that the 3 0 ends in TC1 display a signature of the “cleavage-and-restart” process promoted by Gre

Transcriptional Pausing in Vivo

43

Figure 2. (a) Primer extension analyses of the CAA modifications on the non-template strand of the plasmids having shorter (ATC/TAG) repeats. The positions of the leading and the trailing complexes (TC1 and TC2) are indicated by the vertical bars. The downward pointing arrows show the sites of transcription initiation on each template. (b) Summary of the CAA footprints showing the locations of the leading and the trailing complexes. The filled boxes above the sequences of the non-template strands indicate the approximate size of the footprints. Open arrows point to the positions of the RNA 3 0 ends for the leading and the trailing complexes as mapped in Figure 3(a).

factors within the oscillating complex regardless of the distance from the transcription start site to the roadblock: the equal distribution of 3 0 ends between two positions in the wild-type strain (such as C55 and C58 in pATC8) is shifted downstream in the absence of Gre factors (to C58 in pATC8) when transcript trimming would be impaired.25

Analysis of the 3 0 ends emanating from TC2 in pATC9 and pATC10 showed that the trailing complexes underwent initial backtracking followed by transcript trimming (Figure 3(b), lanes 3–6). On pATC9 template, most of the trailing complexes apparently elongated the transcript to positions C37 and C38 (lane 4) and then backtracked to

44

Transcriptional Pausing in Vivo

Figure 3. (a) S1 mapping of the 3 0 ends of the transcripts produced in vivo by the leading and the trailing complexes in different plasmid constructs. The numbers on the left indicate the positions of the 3 0 ends relative to the transcription start point for the plasmid pATC8. M designates a molecular size marker that was obtained by cleaving the labeled probe (in the double stranded form) with BamHI. (b) Comparative S1 mapping of the transcripts produced either in a wild-type or a GreA/GreB double mutant strain. The positions are numbered relative to the transcription start site as in (a).

positions C34 and C35 (lane 3) where the nascent RNA became susceptible to Gre-mediated cleavage. A similar backward sliding was observed on pATC10 where the transcripts were initially extended down to positions C40 and C41 (lane 6) and subsequently retreated to positions C34/C35 or C37/C38 (lane 5). For the construct with the shortest repeat (pATC8), however, the extent of backward movement was relatively modest, since only a minor fraction of the trailing complexes that had extended RNA to position C35 (lane 2) trimmed their transcript back to positions C33 and C32 (lane 1). In contrast to TC1 complexes, the RNA 3 0 end mapping profiles for the trailing TC2 complexes cannot be explained by a “cleavage-andrestart” process where RNAP oscillates repeatedly between two laterally translocated positions. In effect, the lateral oscillation between the two positions, similar to the case of the TC1 complex, would have resulted in an equal distribution between the corresponding RNA 3 0 ends in the presence of Gre factors. These results suggest that the lateral stability of the TC2 complex is altered during elongation within the pausing sequence and that, upon backtracking and transcript trimming, forward translocation of RNAP beyond positions C34 and C35 is kinetically disfavored.

Elongation within the initially transcribed sequence is delayed at multiple sites in vitro The loss of lateral stability of the TC at the downstream edge of the initially transcribed sequence inferred from the in vivo footprinting analyses could result from either the intrinsic propensity of RNAP to backtrack at unfavorable sequences that are characterized by the low relative stability of the RNA:DNA hybrid or be induced by accessory factors present in the cell. To distinguish between these possibilities, we monitored RNAP progression through this region during singleround transcription in a purified in vitro system. To this end, we have generated a linear DNA template that contained the strong T7A1 promoter followed by a U-less transcribed region in front of the relevant sequence of pATC8 from C1 to C121 (Figure 4, top). On this template, initially halted radiolabeled complexes (with a 19-mer transcript) can be generated when transcription is initiated with ApU dinucleotide in the absence of UTP (see Materials and Methods). Upon the addition of UTP, halted RNAPs resumed elongation and continued transcription until they reach the end of the template (run-off). However, their progression was non-uniform as RNAP apparently experienced delays in NMP addition at four sites that correspond

45

Transcriptional Pausing in Vivo

Figure 4. Transcription elongation in vitro. (Top) Transcript generated from the T7A1 promoter on a linear DNA template; the positions of transcription start site (1), transcript end (run-off, 142) and of the pause sites correspond to those of the pATC8 plasmid template to facilitate comparison. (Bottom) Initially halted TCs were incubated with 50 nM NusG, 300 nM GreA, or in the absence of factors, and challenged with heparin at 50 mg/ml and 10 mM CTP, 100 mM ATP, GTP, UTP. Aliquots were withdrawn at 5, 10, 20, 30, 45, 60, 90, 180, 240, and 360 seconds and quenched. Positions of the halted, paused, and run-off transcripts are indicated with arrows on the left. These positions were mapped during transcription elongation of the labeled RNA with 15 mM of each 3 0 -OMe-NTP (Tri-Link Biotechnologies) and 25 mM of the rNTPs used to generate the sequencing ladder shown on the right.

to positions C22, C32, C35 and C39 (Figure 4, left); the pause positions were mapped using chain termination reactions with the 3 0 O-methyl NTPs. To find out if these delays result from a backtracking process, we tested whether the transcription elongation factor NusG, which has been proposed to inhibit backtracking,7,10 would affect pausing within this region. Addition of NusG nearly eliminated RNAP pausing at positions C22, C32, C35 and C39 and increased the rate of the run-off RNA synthesis, suggesting that pausing within the initially transcribed region is indeed mediated by backtracking (Figure 4, center). Pausing was also affected by GreA (Figure 4, right), but to a lesser extent. In agreement with previous observations,18 these data suggest that GreA might also possess anti-pausing activity, presumably stemming from its ability to induce transcript cleavage and thus provide a fresh start for the kinetically trapped complexes. Addition of GreA also facilitated the escape of the initial halted complexes, likely by a similar mechanism. These

results indicate that RNAP decelerates in the region between C32 and C39 both in a purified system and in the cell and that this deceleration could be accompanied by a decrease in the lateral stability of the TC. A nascent RNA hairpin rescues RNAP from extended backtracking The RNA mapping data (Figure 3) revealed that, prior to backtracking, the RNA 3 0 ends in trailing and leading RNAP molecules can be separated by as few as 23 to 24 bp. For instance, when TC1 was roadblocked at the C64 position in pATC10, the corresponding TC2 complex extended its transcript to positions C40 or C41. Similarly, when TC1 was localized at C61 in pATC9, TC2 could progress to C37 or C38. This minimal distance is significantly smaller than could be predicted from the estimated 30–35 bp footprint of an elongating RNAP on the DNA template,2,5 and it is also inconsistent with the 30 bp interval between the RNA 3 0 ends of the two

46 tandem TCs localized within the (ATC/TAG) repeat on pATC17 and pATC20 (TC1 and TC2 in Figure 1(b), and results not shown). We conclude that the closer spacing corresponds to the point where the two RNAPs come into a steric clash that would create an opposing force for the trailing complex, thereby promoting its backward motion. Strikingly, the majority of TC2 complexes on pATC8 were positioned at C34, and thus at the minimal distance imposed by the leading RNAP, yet they did not undergo significant backtracking. This observation, together with the fact that in the other constructs the backtracking movement most frequently positioned the trailing TC at the same location, and at different distances from the leading RNAP, suggested that a specific transcript feature may stabilize the complex at positions C34 and C35 and “balance” the opposing force created by a clash with TC1. For example, a stable RNA secondary structure could hinder RNAP backtracking both by the direct occlusion of the singlestranded RNA upstream from the enzyme,22,26,27 and by binding to RNAP.11,12 Mfold RNA simulations35 suggested that a rather stable hairpin (DGZK8.1 kcal/mol) could form 12 nt upstream from position C34 (Figure 5(a)). This spacing is characteristic of the hairpin-dependent pause sites,

Transcriptional Pausing in Vivo

where a direct and specific interaction between the hairpin and the b flap domain is thought to stabilize the paused conformation of the TC.11,12,36 To explore the effect of this putative RNA structure on transcriptional behavior of the TC within the pausing sequence, we constructed plasmid mutants bearing multiple substitutions in the left arm of the stem (Figure 5(a)). These substitutions are expected to decrease considerably the folding potential of the hairpin, but are located too far away (between positions C6 and C9) from the pause location (C34) to directly affect the transcriptional behavior of TC2 (e.g. via changes in its backtracking propensity). Side-by-side comparison of the CAA footprinting patterns obtained with the plasmids harboring either the wild-type (Wt) or the mutated hairpin sequence (Ms) clearly indicates that the hairpin structure plays an important role in stabilizing RNAP at the pause location (Figure 5(b)). When the putative hairpin was destabilized by the multiple substitutions, a large part of the TC2 complexes formed on pATC8 and pATC9 backtracked over a relatively long distance (compare lanes 1 and 3 with lanes 2 and 4 and the rough estimations of the amount of backtracked complexes in Figure 5(b)). This is revealed by the appearance of new CAA reactivities between

Figure 5. (a) Sequence of the initially transcribed region showing the inverted repeat that specifies the RNA hairpin in the wild-type (Wt) version of the constructs. The mutations introduced into the multi-substituted (Ms) version of the templates are shown underneath. The positions of the two laterally translocated complexes (paused and backtracked) detected for TC2 in (b) are shaded. The transcript region between C1 and C34 is depicted in the folded form with the substitutions (marked by arrows) that are expected to destabilize the hairpin structure. (b) Side-by-side comparison of the CAA footprints of the plasmid-series that have either the wild-type (C hairpin) or the multi-substituted (-hairpin) upstream sequence. A rough estimate of the fraction of TC2 complexes that underwent an extended backtracking (shown below the gel) was obtained by calculating the ratio of the reactivities in the region between positions C15 and C23 to that of the total reactivity attributed to TC2.

Transcriptional Pausing in Vivo

47

positions C15 and C23, indicating that TC2 retreated over 12 bp. This upstream TC location corresponds to the pause site detected in vitro at C22 (Figure 4). Upon retreat to C22, the TC would occupy the position characterized by an extremely stable RNA:DNA hybrid (seven GC pairs out of eight) and would become thermodynamically trapped, making forward motion unfavorable. This might explain why upon extended backtracking in the hairpin-less constructs the TCs do not return efficiently to the C34 position. For the pATC10 derivative, the extended backward motion in the absence of the hairpin was still significant, whereas in the case of the pATC10-S variant only a minor fraction of the complexes backtracked farther upstream (Figure 5(b), lanes 6 and 8). The dynamic role of the nascent RNA hairpin Previous studies utilizing the same in vivo experimental system have shown that elongating RNAPs could help each other to overcome transcriptional roadblocks.32 In this cooperation mechanism, the actively transcribing trailing RNAP exerts an assisting force on the leading TC and thus increases the transcriptional readthrough arising from the roadblock displacement. This assisting force is expected to increase as the distance between the two tandem TCs decreases and would also depend on the catalytic competence of the trailing TC. To test this prediction and to evaluate the role of the RNA hairpin in the dynamic interactions between the leading and trailing TCs, we compared the efficiency of lac repressor readthrough in the different constructs (wild-type and mutated hairpin sequence) by measuring the amount of downstream cat mRNA produced in vivo by primer extension with reverse transcriptase. The plasmid-encoded b-lactamase transcript was also measured for normalization. Figure 6(a) illustrates the results obtained with the two plasmid-series that have the biggest difference in the spacing between the two TCs (pATC8 and pATC10-S). The pATC9 and pATC10 variants exhibited intermediate behaviors (data not shown). Several conclusions can be drawn from this analysis. First, a 50% greater efficiency in transcriptional readthrough was observed on pATC8, where the two tandem TCs abut each other, as compared to pATC10-S (compare the wild-type constructs in Figure 6(a)). Thus, the trailing complex can impose a physical constraint on the leading TC. Second, this effect was absolutely dependent on the presence of the nascent RNA hairpin, since substitutions in the hairpin stem eliminated this difference (compare the mutated hairpin sequence constructs in Figure 6(a)), implying that the hairpin formation is necessary for the steric clash between the two TCs. Third, the putative RNA hairpin apparently plays an opposite role on templates that specify the different spacing between the two tandem TCs. The hairpin increases the readthrough on pATC8 template, presumably by favoring forward

Figure 6. (a) The readthrough efficiencies across the lac repressor roadblock within the two plasmid-series that have either the wild-type (Wt) or the multi-substituted (Ms) upstream sequence were determined by the downstream cat expression under repressing conditions, following normalization to the plasmid-encoded bla transcripts (internal control), using the following formula: [(cat/bla transcripts)-IPTG/(cat/bla transcripts)CIPTG]! 100. The error bars reflect the standard deviations from the mean of three independent experiments. (b) Schematic representation of the dynamic interplay between the successive TCs and the effects of the nascent RNA hairpin on the lateral movements of the trailing TC.

translocation of the trailing RNAP under a strained configuration and, consequently, the lac repressor displacement by the leading RNAP (see the illustration in Figure 6(b)). In contrast, under conditions where the steric clash between the two TCs is alleviated due to the increased spacing (pATC10-S variants), the hairpin apparently stabilizes the trailing TC and thus decreases its ability to mediate the readthrough by 25% (Figure 6(b)). Thus, although the CAA footprint of TC2 is virtually the same in the two pATC10-S variants (Figure 5(b), lanes 7 and 8), the catalytic competence of the two trailing complexes is different: one RNAP is trapped by the RNA hairpin (in the wild-type construct) whereas the other (in the mutated hairpin sequence construct) is simply in a relaxed

48 configuration free to move forward (Figure 6(b)). These results are in agreement with the conclusion that an RNA hairpin can stabilize a paused TC and thus slow down its escape into processive elongation in vitro.36

Discussion Our understanding of the mechanism of hairpin effects on transcription is largely derived from the in vitro characterization of the pause and termination signals in simplified model systems. In the cell, however, the exact role of an RNA hairpin at a given site would be dictated by a combination of factors, such as the chromosomal framework, the rate of elongation, the density of transcribing RNAPs, and the binding of accessory proteins or small molecular weight effectors to the nucleic acid chains or RNAP. Although in vitro studies provide invaluable insights into the molecular mechanism of transcript elongation, they are somewhat compromised by deviations from the physiological conditions, the incomplete (at best) set of auxiliary factors, as well as by the need for formation of homogenous population of TCs that are amenable to functional analysis, but may be prone to become trapped in inactive states as a result of stalling by substrate deprivation.22 It is thus of particular importance to correlate the detailed in vitro studies with in vivo investigations. The in vivo analysis presented here provides the first experimental support for the regulatory roles played by hairpins during elongation in the cell. In effect, a nascent RNA hairpin appears to restrict the lateral movements of RNAP in both forward and reverse directions, and thus may delimit a dynamic range of regulation of RNAP translocation depending on the nucleic acids context and the presence of accessory factors. The role of hairpins in preventing extensive backtracking of RNAP is highlighted by the observation that the TC retreats over a relatively long distance (12 bp) when the hairpin is destabilized by multiple substitutions (Figure 5(b)). Long distance backtracking, which has been observed only in few instances in vitro and upon an extended phase of NTP starvation, is typically considered as an off-pathway process that traps RNAP in an inactive arrested state.22 The arrested complexes are unable to restart spontaneously and, unless rescued by Gre-mediated RNA cleavage, would constitute a roadblock for all trailing RNAPs. The present results reveal that long distance backward motions of RNAP could also occur in the cellular context and emphasize the importance of transcript cleavage factors in gene regulation. Moreover, our experiments with the hairpin-less pATC8 and pATC9 constructs indicate that, upon extended retreat, the trailing TC does not return efficiently to the downstream position even in the presence of Gre factors. Apparently, backtracked TC could become thermodynamically trapped at promoter-proximal regions that are characterized by a high GC contents

Transcriptional Pausing in Vivo

of the RNA:DNA hybrid and where the TC does not benefit from a “pushing” effect of a trailing RNAP. Such thermodynamic trapping of backtracked TCs within initially transcribed sequences could downregulate or even silence genes by antagonizing initiation. A similar mechanism was previously suggested for stress-inducible genes in eukaryotes, where the TC is halted at promoter-proximal regions under repressing conditions.37 In addition to restricting reverse translocation, the folding of the hairpin provides also an assisting force that promotes forward translocation of a trailing TC in a strained configuration by balancing the opposing force due to the steric clash with a leading complex. The collision between tandem RNAPs causes a significant (50%; Figure 6) increase in transcriptional readthrough of the lac repressor roadblock by the leading complex. During processive elongation, hairpin formation just behind the RNAP could serve as an assisting force in removal of a natural roadblock. At a terminator, the folding of the hairpin may facilitate forward translocation without RNA synthesis and lead to RNA release by a pull-out mechanism as previously proposed.38 The general idea that the transcript may regulate its own elongation through its secondary structure was also suggested from in vitro analyses of RNA polymerase II transcription complexes.39 These studies have shown that the TCs become arrested when halted within a particular initially transcribed sequence with a 23–32 nt long transcript. TCs halted within the same sequence at a promoter-distal location are catalytically competent but become arrested if the 5 0 portion of the transcript is truncated or hybridized with oligonucleotides, suggesting that an interference with RNA secondary structure could modulate the elongation competence of the complex. Alternatively, when the distance between the tandem TCs was increased, the hairpin apparently stabilized the trailing TC at the pause site and thus decreases its ability to stimulate the readthrough by 25% (Figure 6). These results parallel the in vitro data that implicate a multipartite interaction between the hairpin and RNAP in regulation of escape from a pause site. The multipartite interaction is highly specific, it relies on a combination of non-polar and ionic contacts, and requires a defined spacing between the hairpin and the RNA 3 0 end:11,12,36 the hairpin would stabilize the paused intermediate only if it forms 10–12 nt upstream from the pause site, which is consistent with the TC paused at the C34 position in our system. The detailed molecular mechanisms by which actively transcribing RNAPs recognize the pause signals and decelerate elongation before entering the paused state remain obscure. However, based on kinetic studies, it was suggested that both class I and class II pause signals may share a common feature of triggering the formation of a slow intermediate that would convert, depending on the sequence context, into a hairpin-stabilized or a backtracked TC.7,15 The slow intermediate would

49

Transcriptional Pausing in Vivo

form when transcribing RNAP encounters a template region where crucial interactions within the TC (clamp/DNA and RNA:DNA hybrid) are lost or become destabilized. The view of RNAP translocation along the pausing sequence, which emerges from the combination of our data, supports this common intermediate hypothesis. Apparently, the lateral stability of the TC is altered during its progression through the template region immediately downstream from the hairpin where nucleotide addition is delayed at multiple sites (C32, C36 and C39). Hairpin folding behind the polymerase first provides an assisting force that opposes the TC backtracking and thus drives its forward motion. Upon complete folding of the hairpin, its specific interaction with RNAP stabilizes the TC in the paused configuration and delays escape from the pause site (Figure 6(b)). Taken together, the present data highlight the surprisingly dynamic interplay between the successive TCs, whose progression along the transcribed unit is affected by the frequency of transcription initiation (and thus the density of the RNAPs along the template), the various regulatory signals that can slow down or halt RNAP, and the nascent RNA structures that can not only constitute such pause signals but are also able to impose an assisting force that can help RNAP to overcome roadblocks. Although our experimental set-up is clearly artificial, the conclusions we draw are likely to apply to the progression of RNAPs along natural transcription units within the chromosome where numerous physical impediments and regulatory events would hinder smooth translocation of the TCs. It is worth noting that the pausing sequence used in this study originates from the highly regulated hisR locus of Salmonella typhimurium, which contains a cluster of four tRNA genes transcribed from one promoter. 40,41 This sequence lies in a region between the promoter and the first tRNA gene in the array (tRNA-Arg), suggesting a possible involvement of the pausing event described here in the authentic operon regulation.

Materials and Methods Enzymes, chemicals and oligonucleotides Restriction enzymes and T4 polynucleotide kinase were obtained from New England Biolabs. Exonucleasefree Klenow fragment of DNA polymerase I was purchased from Amersham. Superscript RNase HReverse Transcriptase from M-MLV, S1 nuclease and T4 DNA ligase were from Life Technologies. All chemicals including antibiotics were from Sigma except CAA, which was obtained from Fluka Chemie and double distilled (boiling point 78–80 8C) then stored at K80 8C. Unlabeled dNTPs were bought from Promega, whereas rNTPs, [a- 32P]dATP and [g-32P]ATP were from Amersham or NEN. Oligonucleotides were synthesized by MWG-biotech or IDT.

Plasmids and bacteria The construction of pATC plasmids with the short repeats (pATC8, pATC9, pATC10) from a parental vector (a derivative of pKK232-8) in which the cat gene is driven by the constitutive hisR promoter was described.33 Briefly, double-stranded (ATC/TAG)n oligonucleotides were first ligated to a 22-mer self-complementary lac operator oligonucleotide, then the desired ligation product was purified on a 12% (w/v) polyacrylamide gel and inserted into the filled-in SalI site of the vector (position C40 relative to the transcription start site). The correct constructs were selected by dideoxy sequencing. This cloning procedure regenerates a SalI site at the upstream border of the repeat which was filled-in in pATC10 to make pATC10-S. The construction of the plasmids with longer repeats (pATC17 and pATC20) was described in a previous study.42 They were made by using (ATC/TAG)n polymers (obtained by enzymatic synthesis) instead of oligonucleotides which did not generate a SalI site at the upstream border of the repeat. The pATC derivatives, having multiple substitutions in the putative hairpin, were made by replacing, in each plasmid, the DNA region between the BamHI and HpaI (located within the transcription start site) restriction sites with double-stranded oligonucleotides having the desired sequence. As for their construction, the plasmids were maintained in E. coli strain SU1675. To have a high yield of intracellular lac repressor for the in vivo experiments, the cells harboring the plasmids were co-transformed with a pACYC177 derivative (pAC177IQ) in which a 1100 bp IQ gene was inserted between the BamHI and BanI sites. The two plasmids were maintained within the cell by a double selection (ampicillin 100 mg/ml and kanamycin 30 mg/ml). In general, the isolation of the DNA fragments by gel electrophoresis, the ligation reactions and the transformations into the E. coli cells were performed according to standard procedures.43 The E. coli strain (AD8775) lacking functional GreA and GreB factors was described; it carries the greATKanR and the DgreBTCamR double mutations.25 The strain was usually grown in the presence of the appropriate antibiotics at the following concentrations: kanamycin, 18 mg/ml; chloramphenicol, 15 mg/ml. To overproduce lac repressor in this strain for the co-transformation experiments, the IQ gene was sub-cloned into the pACYC184 vector (between PvuII and StyI sites) and the plasmid maintained in the cell by selecting with tetracycline (15 mg/ml). In situ DNA footprinting and RNA analyses In situ DNA probing with CAA and the subsequent analyses of the modifications by primer extension with Klenow fragment of DNA polymerase I were carried out as described.33 RNA extractions, the preparation of the single-stranded DNA probe (template strand of the BlpIPstI fragment) and the 3 0 end mapping with S1 nuclease protection experiments were also performed exactly as described.25,33 Quantitative analyses of the cat and bla transcripts by reverse transcriptase were carried out simultaneously with two 32P end-labeled primers that anneal between positions 4850 and 4868 for the bla gene and between positions 248 and 265 for the cat gene (the positions are those of the parental vector pKK232-8). The reverse transcription reaction, as well as the quantification by PhosphorImager and data processing with ImageQuant software, were as described.25

50

Transcriptional Pausing in Vivo

Single-round in vitro transcription RNAP, GreA, and NusG were purified as described.7 The template for transcription reactions was generated by a two-step PCR amplification. In the first round, oligonucleotides 317, GATTTGTCCTACTCAAGCTT, and 344, ATACTTACAGCCATCGAGAGGGACACGC CAGTTAACAACGGCGCT, were used to amplify the transcribed region from pATC8 plasmid. In the second step, the mega-primer 343, TTAATTTAAAATTTATC AAAAAGAGTATTGACTTAAAGTCTAACCTATAGGA TACTTACAGCCATCGAGA, which encodes the strong T7A1 promoter, was used together with oligonucleotide 317 to generate a linear template, in which the pATC8 transcribed region (positions K2 to C142) is positioned downstream from the T7A1 promoter and a 19 nt U-less transcribed region. To form halted TCs, linear DNA template (40 nM), RNAP holoenzyme (50 nM), ApU (100 mM), and starting NTPs (2.5 mM ATP and CTP, 1 mM GTP, 10 mCi of [a32P]GTP (3000 Ci/mmol)) were mixed on ice in 50 ml of TGA buffer (20 mM Tris–acetate, 20 mM sodium acetate, 10 mM magnesium acetate, 5% (v/v) glycerol, 14 mM 2-mercaptoethanol, 0.1 mM EDTA (pH 8.0)), and incubated at 37 8C for 15 minutes to form initially halted complexes. Elongation factors were added to the halted TC on ice, followed by pre-incubation at 37 8C for three minutes. Transcription was restarted by addition of all four NTPs and heparin to 50 mg/ml, samples were removed at times listed in the legend to Figures and quenched by the addition of an equal volume of STOP buffer (10 M urea, 20 mM EDTA, 45 mM Tris– borate (pH 8.3)). Samples were heated for two minutes at 90 8C and separated by electrophoresis in denaturing 10% polyacrylamide (19:1) gels (7 M urea, 0.5X TBE). RNA products were visualized using a Molecular Dynamics Phosphorimaging System and ImageQuant Software.

7.

8.

9.

10.

11. 12.

13.

14. 15.

16.

Acknowledgements We are highly grateful to Marc Boudvillain for helpful discussions and for reading the manuscript. This work was supported in part by l’Association de la Recherche sur le Cancer (contrat 3639), la Ligue contre le Cancer (comite´ Re´gion Centre), Biotechnocentre, l’ANRS and NIH grant GM067153 (to I.A.).

References 1. Uptain, S. M., Kane, C. M. & Chamberlin, M. J. (1997). Basic mechanisms of transcript elongation and its regulation. Annu. Rev. Biochem. 66, 117–172. 2. Mooney, R. A., Artsimovitch, I. & Landick, R. (1998). Information processing by RNA polymerase: recognition of regulatory signals during RNA chain elongation. J. Bacteriol. 180, 3265–3275. 3. Korzheva, N. & Mustaev, A. (2001). Transcription elongation complex: structure and function. Curr. Opin. Microbiol. 4, 119–125. 4. Landick, R. (1999). Shifting RNA polymerase into overdrive. Science, 284, 598–599. 5. Landick, R. (2001). RNA polymerase clamps down. Cell, 105, 567–570. 6. Richardson, J. P. & Greenblatt, J. (1996). Control of

17. 18. 19.

20. 21.

22.

23.

RNA chain elongation and termination. In Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C. et al., eds), pp. 822–848, American Society for Microbiology, Washington, DC. Artsimovitch, I. & Landick, R. (2000). Pausing by bacterial RNA polymerase is mediated by mechanistically distinct classes of signals. Proc. Natl Acad. Sci. USA, 97, 7090–7095. Burns, C. M., Richardson, L. V. & Richardson, J. P. (1998). Combinatorial effects of NusA and NusG on transcription elongation and Rho-dependent termination in Escherichia coli. J. Mol. Biol. 278, 307–316. Erie, D. A. (2002). The many conformational states of RNA polymerase elongation complexes and their roles in the regulation of transcription. Biochim. Biophys. Acta, 1577, 224–239. Pasman, Z. & von Hippel, P. H. (2000). Regulation of rho-dependent transcription termination by NusG is specific to the Escherichia coli elongation complex. Biochemistry, 39, 5573–5585. Toulokhonov, I., Artsimovitch, I. & Landick, R. (2001). Allosteric control of RNA polymerase by a site that contacts nascent RNA hairpins. Science, 292, 730–733. Toulokhonov, I. & Landick, R. (2003). The flap domain is required for pause RNA hairpin inhibition of catalysis by RNA polymerase and can modulate intrinsic termination. Mol. Cell, 12, 1125–1136. Landick, R., Turnbough, C. J. & Yanofsky, C. (1996). Transcription attenuation. In Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C., ed.), pp. 1263–1286, American Society for Microbiology, Washington, DC. Landick, R., Carey, J. & Yanofsky, C. (1987). Detection of transcription-pausing in vivo in the trp operon leader region. Proc. Natl Acad. Sci. USA, 84, 1507–1511. Palangat, M. & Landick, R. (2001). Roles of RNA:DNA hybrid stability, RNA structure, and active site conformation in pausing by human RNA polymerase II. J. Mol. Biol. 311, 265–282. Nudler, E., Mustaev, A., Lukhtanov, E. & Goldfarb, A. (1997). The RNA–DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase. Cell, 89, 33–41. Thomas, M. J., Platas, A. A. & Hawley, D. K. (1998). Transcriptional fidelity and proofreading by RNA polymerase II. Cell, 93, 627–637. Marr, M. T. & Roberts, J. W. (2000). Function of transcription cleavage factors GreA and GreB at a regulatory pause site. Mol. Cell, 6, 1275–1285. Artsimovitch, I. & Landick, R. (2002). The transcriptional regulator RfaH stimulates RNA chain synthesis after recruitment to elongation complexes by the exposed non-template DNA strand. Cell, 109, 193–203. Gusarov, I. & Nudler, E. (1999). The mechanism of intrinsic transcription termination. Mol. Cell, 3, 495–504. Komissarova, N., Becker, J., Solter, S., Kireeva, M. & Kashlev, M. (2002). Shortening of RNA:DNA hybrid in the elongation complex of RNA polymerase is a prerequisite for transcription termination. Mol. Cell, 10, 1151–1162. Komissarova, N. & Kashlev, M. (1997). Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3 0 end of the RNA intact and extruded. Proc. Natl Acad. Sci. USA, 94, 1755–1760. Orlova, M., Newlands, J., Das, A., Goldfarb, A. & Borukhov, S. (1995). Intrinsic transcript cleavage activity of RNA polymerase. Proc. Natl Acad. Sci. USA, 92, 4596–4600.

51

Transcriptional Pausing in Vivo

24. Leeds, J. A. & Welch, R. A. (1997). Enhancing transcription through the Escherichia coli hemolysin operon, hlyCABD: RfaH and upstream JUMPStart DNA sequences function together via a postinitiation mechanism. J. Bacteriol. 179, 3519–3527. 25. Toulme´, F., Mosrin-Huaman, C., Sparkowski, J., Das, A., Leng, M. & Rahmouni, A. R. (2000). GreA and GreB proteins revive backtracked RNA polymerase in vivo by promoting transcript trimming. EMBO J. 19, 6853–6859. 26. Komissarova, N. & Kashlev, M. (1997). RNA polymerase switches between inactivated and activated states by translocating back and forth along the DNA and the RNA. J. Biol. Chem. 272, 15329–15338. 27. Reeder, T. C. & Hawley, D. K. (1996). Promoter proximal sequences modulate RNA polymerase II elongation by a novel mechanism. Cell, 87, 767–777. 28. Adelman, K., La Porta, A., Santangelo, T. J., Lis, J. T., Roberts, J. W. & Wang, M. D. (2002). Single molecule analysis of RNA polymerase elongation reveals uniform kinetic behavior. Proc. Natl Acad. Sci. USA, 99, 13538–13543. 29. Forde, N. R., Izhaky, D., Woodcock, G. R., Wuite, G. J. & Bustamante, C. (2002). Using mechanical force to probe the mechanism of pausing and arrest during continuous elongation by Escherichia coli RNA polymerase. Proc. Natl Acad. Sci. USA, 99, 11682–11687. 30. Shaevitz, J. W., Abbondanzieri, E. A., Landick, R. & Block, S. M. (2003). Backtracking by single RNA polymerase molecules observed at near-base-pair resolution. Nature, 426, 684–687. 31. Epshtein, V. & Nudler, E. (2003). Cooperation between RNA polymerase molecules in transcription elongation. Science, 300, 801–805. 32. Epshtein, V., Toulme, F., Rahmouni, A. R., Borukhov, S. & Nudler, E. (2003). Transcription through the roadblocks: the role of RNA polymerase cooperation. EMBO J. 22, 4719–4727. 33. Toulme´, F., Gue´rin, M., Robichon, N., Leng, M. &

34.

35. 36.

37.

38. 39.

40. 41.

42.

43.

Rahmouni, A. R. (1999). In vivo evidence for back and forth oscillations of the transcription elongation complex. EMBO J. 18, 5052–5060. Figueroa-Bossi, N., Gue´rin, M., Rahmouni, A. R., Leng, M. & Bossi, L. (1998). The supercoiling sensitivity of a bacterial tRNA promoter parallels its responsiveness to stringent control. EMBO J. 17, 2359–2367. Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucl. Acids Res. 31, 3406–3415. Chan, C. L. & Landick, R. (1997). Effects of neutral salts on RNA chain elongation and pausing by Escherichia coli RNA polymerase. J. Mol. Biol. 268, 37–53. Pal, M., McKean, D. & Luse, D. S. (2001). Promoter clearance by RNA polymerase II is an extended, multistep process strongly affected by sequence. Mol. Cell. Biol. 21, 5815–5825. Santangelo, T. J. & Roberts, J. W. (2004). Forward translocation is the natural pathway of RNA release at an intrinsic terminator. Mol. Cell, 14, 117–126. Ujvari, A., Pal, M. & Luse, D. S. (2002). RNA polymerase II transcription complexes may become arrested if the nascent RNA is shortened to less than 50 nucleotides. J. Biol. Chem. 277, 32527–32537. Bossi, L. (1983). The hisR locus of Salmonella: nucleotide sequence and expression. Mol. Gen. Genet. 192, 163–170. Figueroa, N., Wills, N. & Bossi, L. (1991). Common sequence determinants of the response of a prokaryotic promoter to DNA bending and supercoiling. EMBO J. 10, 941–949. Gue´rin, M., Leng, M. & Rahmouni, A. R. (1996). High resolution mapping of E. coli transcription elongation complex in situ reveals protein interactions with the non-transcribed strand. EMBO J. 15, 5397–5407. Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Edited by R. Ebright (Received 21 March 2005; received in revised form 12 May 2005; accepted 23 May 2005) Available online 13 June 2005