- Email: [email protected]
Transcriptional regulation of cathelicidin genes in chicken bone marrow cells
Transcriptional regulation of cathelicidin genes in chicken bone marrow cells Sang In Lee,∗,§,1 Hyun June Jang,†,1 Mi-hyang Jeon,∗ Mi Ock Lee,‡ Jeom Sun Kim,∗ Ik-Soo Jeon,∗ and Sung June Byun∗,2 ∗
Animal Biotechnology Division, National Institute of Animal Science, RDA, 1500, Kongjwipatjwi-ro, Iseo-myeon, Wanju-gun, Jeollabuk-do, 565-851, Republic of Korea; † College of Pharmacy, Dankook University, 119 Dandae-ro, Cheonan, Chungnam 330-714, Republic of Korea; ‡ Department of Veterinary Pathobiology, Texas A&M University, College Station, TX 77843-4467; and § Department of Animal Resource and Science, Dankook University, Cheonan, Choongnam, 330-714, Republic of Korea
Key words: chicken, cathelicidin, CAMP, promoter, transcription 2016 Poultry Science 95:912–919 http://dx.doi.org/10.3382/ps/pev361
INTRODUCTION
proteolytic processing with specific enzymes, the heterogeneous domain of cathelicidin-related antimicrobial peptides (CRAMPs) is released. The sequence heterogeneity of CRAMPs is reflected in their structural diversity, which includes all three major folding types: cysteine-free linear peptides with an α-helical and amphipathic structure, cysteine-containing peptides with a flat β -sheet structure, and peptides rich in particular amino acids such as proline, arginine, and tryptophan (Zaiou and Gallo, 2002). In addition, CRAMPs participate in cellular responses that are associated with protection against infection (Nizet et al., 2001; Bowdish et al., 2005; Jo, 2010), activation of the immune system (Scott et al., 2002; Tjabringa et al., 2006; Montreekachon et al., 2011), control of inflammation (Morioka et al., 2008; Wong et al., 2012), and immune response disorders (Ong et al., 2002; Wehkamp et al., 2007; Bartley, 2010). The chicken genome encodes four cathelicidin genes: LOC100858343 (also known as CATH-3), CAMP (also known as CATHL2), CATHB1 (also known as CATHL1), and CATHL3 (also known as CATH-1). These genes are clustered within a 7.5-kb region at the proximal end of chromosome 2. LOC100858343 is potentially transcribed in the inverted orientation relative to the orientation of the other cathelicidin genes (Goitsuka et al., 2007; van Dijk et al., 2005; Xiao et al.,
Cathelicidins form a family of vertebrate-specific immune molecules present in cattle, sheep, goats, horses, mice, guinea pigs, and humans (Gennaro et al., 1989; Nagaoka et al., 1994; Mahoney et al., 1995; Gallo et al., 1997; Scocchi et al., 1999; Shamova et al., 1999). Cathelicidins are expressed in various cell types, including neutrophils, myeloid precursors, epithelial cells, mast cells, lymphocytes, and keratinocytes; in many tissues, such as the oral cavity, skin, intestine, lungs, and cervix; and in body fluids, such as plasma, breast milk, saliva, gastric juice, semen, sweat, and bronchoalveolar fluid (Zanetti, 2005; Nijnik and Hancock, 2009; Choi and Mookherjee, 2012). Cathelicidins exhibit unique bipartite features: a substantially heterogeneous C-terminal antimicrobial domain of 12–100 residues and an evolutionarily conserved N-terminal cathelin-like domain of 99–114 residues (Zanetti, 2005; Chang et al., 2006). Cathelicidins are first produced as inactive precursors; following the removal of the conserved cathelin-like domain via C 2016 Poultry Science Association Inc. Received August 6, 2015. Accepted October 20, 2015. 1 These authors contributed equally to this work. 2 Corresponding author: [email protected]
912
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
factors (TFs) that bind to the 5 -flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5 -flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.
ABSTRACT Cathelicidins form a family of vertebratespecific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription
913
REGULATION OF CATHELICIDIN IN CHICKEN Table 1. List of primer for quantitative RT-PCR. Primer sequence (5 -> 3 ) No.
Gene Symbol
Accession No.
CAMP CATH3 CATHB1 CEBPA
NM NM NM NM
001024830 001311177 001271172 001031459
5 6 7
MSX1 EBF1 HES1
NM 205488 NM 204752 NM 001005848
8 9
PAX9 VDR
NM 204912 NM 205098
10
ZIC3
XM 420237
11
GAPDH
NM 204305
Forward
Reverse
Product Size
cathelicidin-2 cathelicidin-3 cathelicidin-B1-like CCAAT/enhancer binding protein (C/EBP), alpha msh homeobox 1 early B-cell factor 1 hairy and enhancer of split 1 paired box 9 vitamin D (1,25dihydroxyvitamin D3) receptor Zic family member 3 heterotaxy 1 glyceraldehyde-3phosphate dehydrogenase
GACAGAGTGCACCCCGAGCG CGGGCTCGTCAAGGACTGCG GCCGATCACCTACCTGGATG TGGAGACGCAGCAGAAGGTG
GGCCCCGTTGGACCAGAACG CCCGCAGCCACCGTGTTGAT TGGTGACGTTCAGATGTCCG CTGAAGATGCCCCGCAGAGT
157 150 189 106
TTCTCCGCTCCCTTCATCCA GCGAAAAGACCAACAACGGG CCAGAGGGCACAGATGGCA
CTGCCACAGTTCCTTCCCCA TCGTGCGTGAGCAGAACTCG CTCGCAGGTGGACAGGAACC
108 172 115
ACTCCTACCCCAGCCCCATC CCTGAAGCCCAAACTGTCGG
TGTCGCTCACTTGGTCCGTG GACGGAGGAGGAGTGCGTTG
162 160
AGGGCTCGGACTCTTCCCC
TCCTTTCTGCCTCGTTCCCA
229
GGTGGTGCTAAGCGTGTTAT
ACCTCTGTCATCTCTCCACA
244
2006; van Dijk et al., 2011). CAMP and CATHL3 are highly expressed in bone marrow and show similar levels of expression in other tissues, whereas CATHB1 is mainly produced in the bursa of Fabricius and shows a unique expression pattern among the cathelicidins during embryonic development (Goitsuka et al., 2007; Achanta et al., 2012). All chicken cathelicidins have antimicrobial activities against a broad spectrum of Gram-positive and Gramnegative bacteria (Xiao et al., 2006; Bommineni et al., 2007; Goitsuka et al., 2007; van Dijk et al., 2009; Veldhuizen et al., 2013). The matured LOC100858343 and CATHL3 have over 70% sequence similarity, which suggests an inverted duplication of the gene (Xiao et al., 2006). LOC100858343 and CATHL3 commonly have a linear alpha-helical shape, whereas CAMP has a proline-induced hinge region that is thought to have antibacterial and immunomodulatory roles (van Dijk et al., 2009; Xiao et al., 2009). In humans, 1,25-dihydroxyvitamin D3, the hormonally active metabolite of vitamin D, induces the expression of human cathelicidin antimicrobial peptide (CAMP) gene in keratinocytes and bone marrow cells. This induction occurs through the coupling of the consensus vitamin D response element (VDRE) in the CAMP promoter and the vitamin D receptor (VDR) (Gombart et al., 2005). ER stress in human keratinocytes also increases CAMP expression via NFκB and CCAAT/enhancer-binding protein α (CEBPA) through a VDR-independent pathway (Park et al., 2011). Additionally, NF-κB has been shown to be associated with the induction of CRAMPs in murine mast cells by lipopolysaccharides (Li et al., 2009). However, the regulatory mechanisms of cathelicidin genes in various species, including the chicken, remain unclear.
In this study, we predicted the regulatory elements of chicken cathelicidin genes and analyzed the interaction between the predicted elements and their binding factors in chicken bone marrow cells. Our study expands our understanding of the regulatory mechanisms underlying cathelicidin expression in chickens.
MATERIALS AND METHODS Experimental Animals and Animal Care The study protocol and standard operating procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the National Institute of Animal Science in Korea (2013–048). The experimental procedures used in animal management, reproduction, and embryo manipulation followed the standard program of our laboratory.
Quantitative Real-Time RT-PCR Analysis of mRNAs and miRNAs BMCs and CEFs were cultured in Dulbecco’s Modified Eagle’s medium (high glucose; Gibco, NY) containing 10% fetal bovine serum (Hyclone, UT) and 2% chicken serum (Sigma-Aldrich, MO). Cultured cells were treated by 0.05% trypsin-EDTA for 3 min followed by inactivation of enzyme using 10% fetal bovine serum. Then, cells were collected by centrifugation. RNA was isolated from chicken embryonic fibroblasts (CEFs) and bone marrow cells (BMCs) using TRIzol reagent (Invitrogen, CA). For qRT-PCR, total RNA (1 µg) was used for cDNA synthesis with the Superscript III FirstStrand Synthesis System (Invitrogen). The primers for qRT-PCR of each gene transcript were designed
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
1 2 3 4
Description
914
LEE ET AL. Table 2. siRNA sequence for inhibition of MSX1. siRNA sequence (5 -> 3 ) Target gene MSX1
Location
Sense
Antisense
927 987 1114
GUAUGUACCACCUUACAUA CUCCCUUCAUCCAGACCUU GGACAUUUCUGCAAGGCGA
UAUGUAAGGUGGUACAUAC AAGGUCUGGAUGAAGGGAG UCGCCUUGCAGAAAUGUCC
In Vitro Functional Assays of mRNAs and siRNAs For the analysis of mRNA functionality, we designed siRNAs against MSX1 (Table 2). The siRNA control was not complementary to any sequences in the chicken genome and was purchased from Bioneer Inc. For the functional analysis of mRNAs, 5 × 105 BMCs were transfected using RNAiMAX (Invitrogen, CA) according to the manufacturer’s instructions. Briefly, 7.5 µL of RNAiMAX reagent suspended in 250 µL Opti-MEM solution was incubated for 5 min at room temperature, and the mixture was added to 75 nM of siRNAs against MSX1. Then, the mixture of RNAiMAX and probes were added drop-wise to BMCs in a culture medium lacking antibiotics. At 48 h after transfection, total RNA was extracted and analyzed by qRT-PCR.
The Luciferase Reporter Assay The 220-bp DNA sequence in the 5 -flanking region of CAMP and the mutated sequence of MSX1 binding sites in the 5 -flanking region of CAMP were synthesized by Bioneer Inc. The 5 -flanking region of CAMP was subcloned into the multiple cloning region of the pGL3-Basic vector (Promega, WI). To evaluate luminescence, the cells were assayed using the Luciferase assay system kit (Promega) according to the manufacturer’s protocol. At 72 h after transfection, the cells were harvested, washed with cold PBS and extracted with 100 µL of diluted Passive Lysis buffer. The extracts were centrifuged at 13,000 × g for 5 min, and the supernatants were collected. The activity of firefly and Renilla luciferase was measured using a GLOMAX 20/20 Luminometer (Promega). All measurements were normalized to the level of Renilla activity.
Statistical Analyses In the knockdown experiments, the expression of gene transcripts was analyzed using Student’s t-tests and SAS software (SAS Institute, NC). To evaluate the significance of differences between the treatment and control groups, the data were analyzed with general linear models (PROC-GLM) implemented in the SAS software. A P-value of less than 0.05 was considered to indicate statistical significance.
RESULTS Expression Pattern of Cathelicidin Genes and Putative Binding Factors for 5 -Flanking Regions of Cathelicidin Genes in Chicken Bone Marrow Cells (BMCs) When the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) were compared between chicken BMCs and chicken embryonic fibroblasts (CEFs), CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly (Figure 1). To study the mechanism of up-regulation of the cathelicidin genes CAMP and CATHB1 in BMCs, transcription factors (TFs) within 220 to 300 bp of the 5 -flanking regions of all cathelicidin genes were predicted by PROMO (http://alggen.lsi.upc.es/cgi-bin/ promo v3/promo/promoinit.cgi?dirDB=TF 8.3). The expression levels of the predicted TFs, including CEBPA, EBF1, HES1, MSX1, VDR, and ZIC3, were compared between the BMCs and CEFs. The analysis indicated that CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated, whereas the expression of VDR did not differ significantly between BMCs and CEFs (Figure 2). From these results, we concluded that the TFs up-regulated in BMCs were correlated with the regulation of the chicken cathelicidin genes CAMP and CATHB1.
Knockdown Assay for MSX1 in Chicken BMCs To examine whether the expression levels of CAMP, CATH3, and CATHB1 were altered by the repression of the up-regulated TFs, we selected chicken MSX1targeted siRNAs after screening siRNAs for the upregulated TFs in BMCs. To obtain the MSX1 siRNAs, we designed three siRNA sequences that obeyed
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
using the program Primer3 (http://frodo.wi.mit.edu/) (Table 1). The qRT-PCR analysis was performed using Roter-Gene 6000 (Qiagen, CA) and EvaGreen (Biotium, CA). The PCR reaction (total 20 µL) was performed by 0.1 µM primer. The PCR conditions were 94◦ C for 3 min, followed by 40 cycles of 94◦ C for 30 s, 59–61◦ C for 30 s and 72◦ C for 30 s. Melting curve profiles were analyzed for the amplicons. The qRTPCR data were normalized relative to the expression of GAPDH and calculated using the 2 ΔΔCt method, where ΔΔCt = (Ct of the target gene – Ct of GAPDH) treatment – (Ct of the target gene – Ct of GAPDH) control.
REGULATION OF CATHELICIDIN IN CHICKEN
915
Figure 2. Expression analysis of the putative binding factors of cathelicidin gene promoters in chicken BMCs and CEFs. Real-time PCR analysis was conducted in triplicate and normalized to the expression levels of GAPDH. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05, ∗∗ P < 0.005, and ∗∗∗ P < 0.001. Error bars indicate the SE of triplicate analyses. BMCs, bone marrow cells; CEFs, chicken embryonic fibroblasts.
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 1. Expression analysis of cathelicidin genes in chicken BMCs and CEFs. Real-time PCR analysis was conducted in triplicate and normalized to the expression levels of GAPDH. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05, ∗∗ P < 0.005, and ∗∗∗ P < 0.001. Error bars indicate the SE of triplicate analyses. BMCs, bone marrow cells; CEFs, chicken embryonic fibroblasts.
916
LEE ET AL.
Thuthel’s rule for MSX1. We then evaluated whether the designed siRNAs repressed expression in BMCs using a knockdown approach. A nonspecific siRNA with no homology to chicken sequences was used as a control. The knockdown efficiency of the siRNA for MSX1 was 59.5 ± 0.8% (P < 0.05) (Figure 3A). Subsequently, when we compared the expression of cathelicidin genes between the MSX1-repressed BMCs and the normal BMCs, the expression of both CAMP and CATHB1 was decreased in the MSX1-repressed BMCs (P < 0.05), whereas the expression of CATH3 did not differ significantly (Figure 3B). Thus, we concluded that MSX1 directly regulates the expression of CAMP and CATHB.
Binding Activity of MSX1 to the 5 -flanking Region of CAMP In our predictions of the TFs binding to cathelicidin genes, 14 MSX1-binding motifs were predicted within
the 5 -flanking region of chicken CAMP (Figure 4). To elucidate whether MSX1 regulated the transcriptional activity of CAMP, 11 MSX1-binding sites that did not overlap with other binding sites were mutated in the 5 -flanking region of CAMP (Figure 4B). When the transcriptional activity of the mutated region was evaluated in BMCs, we found that it was decreased by approximately 60% compared to the transcriptional activity of the non-mutated region (Figure 5). These results suggested that MSX1 could regulate the transcriptional activity of CAMP binding to the MSX1-binding sites within the 5 -flanking region of CAMP.
DISCUSSION In this study, our results suggest that commonly upregulated TFs, such as CEBPA, EBF1, HES1, MSX1, and ZIC3, are involved in the regulation of the chicken cathelicidin genes (CAMP, CATHB1 and CATH3) and
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 3. Expression of MSX1 in bone marrow cells after target-specific siRNA expression. Designed siRNA probes were introduced into bone marrow cells by lipofection (A). Expression of cathelicidin genes in bone marrow cells after siRNA-mediated inhibition of MSX1 (B). The control siRNAs have no complementary sequence in the chicken genome. The quantitative real-time PCR analysis was conducted in triplicate and normalized to the expression levels of GAPDH. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05, ∗∗ P < 0.005, and ∗∗∗ P < 0.001. Error bars indicate the SE of triplicate analyses.
REGULATION OF CATHELICIDIN IN CHICKEN
917
that MSX1 directly regulates the expression of chicken CAMP by interacting with MSX1-binding sites in the CAMP promoter. Previous studies have reported that human CAMP is induced by two independent pathways: a VDRdependent pathway and an NF-κB/CEBPA-dependent pathway (Gombart et al., 2005; Park et al., 2011). The VDR-dependent model is only adopted in primates, as demonstrated by the absence of VDRE within the regulatory regions of other species such as rats, mice, and dogs (Gombart et al., 2005). Despite the evolutionary discontinuance among the regulatory regions, cathelicidin genes have been found in various species, including most mammals, birds, reptiles and fish (Zanetti, 2005; van Dijk et al., 2011). It has also been reported that cathelicidin genes share a conserved gene structure consisting of four exons and three introns (Gudmundsson et al., 1995; Zhao et al., 1995; Gudmundsson et al., 1996; Larrick et al., 1996; Scocchi et al., 1997; Huttner et al., 1998; Goitsuka et al., 2007). These previous studies suggest that cathelicidin genes are derived from a common ancestor (van Dijk et al., 2011) and that multiple cathelicidin genes within a single species arose from the rearrangement of the same gene precursor (Zanetti, 2005). Unlike the VDR-dependent model, the NF-κB/CEBPA-dependent model explains the cathelicidin induction pattern observed in mice (Li et al., 2009) and suggests a basal expression of cathelicidin genes (Park et al., 2011). In our study, CEBPA levels were up-regulated in BMCs compared with CEFs, but VDR expression did not change. Thus, we conclude that the NF-κB/CEBPA-dependent model supports the evolutionally conserved regulation of cathelicidin genes in the chicken.
When we compared the predicted TF binding elements in the 5 -flanking regions among humans, mice, and chickens, HES1-binding elements were found only in chickens (Figure 4A). Recently, it was reported that HES1 increases the expression of antimicrobial peptide coding genes, such as REG1A, REG3A, and REG3G, in human intestinal epithelial cells by enhancement of the IL-22-STAT3 signaling pathway (Murano et al., 2014). IL-22 and STAT3 expression have also been reported in chickens (Caldwell et al., 2005; Kim et al., 2012). Therefore, chicken cathelicidin genes might have a unique induction pathway, such as the IL-22-STAT3 signaling pathway. In addition, EBF1, MSX1 and ZIC3 are commonly associated with early bone development as a transcriptional regulator (Han et al., 2007; Horowitz and Lorenzo, 2007; Purandare et al., 2002). In particular, EBF1 has been closely linked to the activation and maintenance of the B cell lineage (Nechanitzky et al., 2013). Recently, cathelicidinderived peptides have been demonstrated to modulate immune cell differentiation and strengthen immune cell function (Davidson et al., 2004; Kin et al., 2011). Our data also demonstrate that MSX1 can directly interact with the promoter of the CAMP gene to regulate CAMP gene expression. Collectively, we conclude that these transcription factors are related to the activation and differentiation of cathelicidin genes in chicken BMCs. In conclusion, we screened for transcription factors that are related to the control of chicken cathelicidin genes and found that MSX1 directly interacted with the putative binding sites found in the chicken CAMP promoter. Our data contribute to the understanding
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 4. Prediction of TF binding sites and mutation of the CAMP promoter. The binding sites for MSX1, EBF1, C/EBBPA, and HES1 were predicted in the CAMP promoters of the human, mouse, and chicken (A). A CAMP promoter with mutated MSX1-binding motifs was synthesized (B). Large and bold sequences indicate the MSX1-binding motif, and red-colored sequences indicate modified sequences.
918
LEE ET AL.
of the regulatory mechanisms of cathelicidin genes in BMCs.
ACKNOWLEDGMENTS This study was supported by 2014–2015 Postdoctoral Fellowship Program of National Institute of Animal Science, Rural Development Administration, Republic of Korea. This work was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ010201012015)” Rural Development Administration, Republic of Korea.
REFERENCES Achanta, M., L. T. Sunkara, G. Dai, Y. R. Bommineni, W. Jiang, and G. Zhang. 2012. Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides. J. Anim. Sci. Biotechnol. 3:15. Bartley, J. 2010. Vitamin D: emerging roles in infection and immunity. Expert Rev. Anti-Infect. Ther. 8:1359–1369.
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 5. Analysis of promoter activity for the 5 -flanking region of CAMP. The potential transcriptional activity of the 5 -flanking region and the mutated 5 -flanking region for MSX1-binding motifs was assessed in BMCs. At 48 h after transfection of a luciferase construct, luminescence signals were detected using a luminometer. All measurements were normalized to the Renilla activity. The mean ± standard deviation from three independent experiments is shown. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05.
Bommineni, Y. R., H. Dai, Y. X. Gong, J. L. Soulages, S. C. Fernando, U. Desilva, O. Prakash, and G. Zhang. 2007. Fowlicidin-3 is an alpha-helical cationic host defense peptide with potent antibacterial and lipopolysaccharide-neutralizing activities. FEBS J. 274:418–428. Bowdish, D. M., D. J. Davidson, Y. E. Lau, K. Lee, M. G. Scott, and R. E. Hancock. 2005. Impact of LL-37 on anti-infective immunity. J. Leukoc. Biol. 77:451–459. Caldwell, R. B., A. M. Kierzek, H. Arakawa, Y. Bezzubov, J. Zaim, P. Fiedler, S. Kutter, A. Blagodatski, D. Kostovska, M. Koter, J. Plachy, P. Carninci, Y. Hayashizaki, and J. M. Buerstedde. 2005. Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis. Genome Biol. 6:R6 Chang, C. I., Y. A. Zhang, J. Zou, P. Nie, and C. J. Secombes. 2006. Two cathelicidin genes are present in both rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Antimicrob. Agents Chemother. 50:185–195. Choi, K. Y., and N. Mookherjee. 2012. Multiple immune-modulatory functions of cathelicidin host defense peptides. Front. Immunol. 3:149. Davidson, D. J., A. J. Currie, G. S. Reid, D. M. Bowdish, K. L. MacDonald, R. C. Ma, R. E. Hancock, and D. P. Speert. 2004. The cationic antimicrobial peptide LL-37 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization. J. Immunol. 172:1146–1156. Gallo, R. L., K. J. Kim, M. Bernfield, C. A. Kozak, M. Zanetti, L. Merluzzi, and R. Gennaro. 1997. Identification of CRAMP, a cathelin-related antimicrobial peptide expressed in the embryonic and adult mouse. J. Biol. Chem. 272:13088–13093. Gennaro, R., B. Skerlavaj, and D. Romeo. 1989. Purification, composition, and activity of two bactenecins, antibacterial peptides of bovine neutrophils. Infect. Immun. 57:3142–3146. Goitsuka, R., C. L. Chen, L. Benyon, Y. Asano, D. Kitamura, and M. D. Cooper. 2007. Chicken cathelicidin-B1, an antimicrobial guardian at the mucosal M cell gateway. Proc. Natl. Acad. Sci. U. S. A. 104:15063–15068. Gombart, A. F., N. Borregaard, and H. P. Koeffler. 2005. Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3. FASEB. J. 19:1067–1077. Gudmundsson, G. H., B. Agerberth, J. Odeberg, T. Bergman, B. Olsson, and R. Salcedo. 1996. The human gene FALL39 and processing of the cathelin precursor to the antibacterial peptide LL37 in granulocytes. Eur. J. Biochem. 238:325–332. Gudmundsson, G. H., K. P. Magnusson, B. P. Chowdhary, M. Johansson, L. Andersson, and H. G. Boman. 1995. Structure of the gene for porcine peptide antibiotic PR-39, a cathelin gene family member: comparative mapping of the locus for the human peptide antibiotic FALL-39. Proc. Natl. Acad. Sci. U. S. A. 92:7085–7089. Han, J., M. Ishii, P. Bringas, Jr., R. L. Maas, R. E. Maxson, Jr., and Y. Chai. 2007. Concerted action of Msx1 and Msx2 in regulating cranial neural crest cell differentiation during frontal bone development. Mech. Dev. 124:729–745. Horowitz, M. C., and J. A. Lorenzo. 2007. Immunologic regulation of bone development. Adv. Exp. Med. Biol. 602:47–56. Huttner, K. M., M. R. Lambeth, H. R. Burkin, D. J. Burkin, and T. E. Broad. 1998. Localization and genomic organization of sheep antimicrobial peptide genes. Gene. 206:85–91. Jo, E. K. 2010. Innate immunity to mycobacteria: vitamin D and autophagy. Cell Microbiol. 12:1026–1035. Kim, S., L. Faris, C. M. Cox, L. H. Sumners, M. C. Jenkins, R. H. Fetterer, K. B. Miska, and R. A. Dalloul. 2012. Molecular characterization and immunological roles of avian IL-22 and its soluble receptor IL-22 binding protein. Cytokine. 60:815–827. Kin, N. W., Y. Chen, E. K. Stefanov, R. L. Gallo, and J. F. Kearney. 2011. Cathelin-related antimicrobial peptide differentially regulates T- and B-cell function. Eur. J. Immunol. 41:3006–3016. Larrick, J. W., J. Lee, S. Ma, X. Li, U. Francke, S. C. Wright, and R. F. Balint. 1996. Structural, functional analysis and localization of the human CAP18 gene. FEBS Lett. 398:74–80. Li, G., J. Domenico, Y. Jia, J. J. Lucas, and E. W. Gelfand. 2009. NF-kappaB-dependent induction of cathelicidin-related antimicrobial peptide in murine mast cells by lipopolysaccharide. Int. Arch. Allergy Immunol. 150:122–132.
REGULATION OF CATHELICIDIN IN CHICKEN
Scocchi, M., S. Wang, and M. Zanetti. 1997. Structural organization of the bovine cathelicidin gene family and identification of a novel member. FEBS Lett. 417:311–315. Scott, M. G., D. J. Davidson, M. R. Gold, D. Bowdish, and R. E. Hancock. 2002. The human antimicrobial peptide LL-37 is a multifunctional modulator of innate immune responses. J. Immunol. 169:3883–3891. Shamova, O., K. A. Brogden, C. Zhao, T. Nguyen, V. N. Kokryakov, and R. I. Lehrer. 1999. Purification and properties of proline-rich antimicrobial peptides from sheep and goat leukocytes. Infect. Immun. 67:4106–4111. Tjabringa, G. S., D. K. Ninaber, J. W. Drijfhout, K. F. Rabe, and P. S. Hiemstra. 2006. Human cathelicidin LL-37 is a chemoattractant for eosinophils and neutrophils that acts via formyl-peptide receptors. Int. Arch. Allergy Immunol. 140:103–112. van Dijk, A., E. M. Molhoek, F. J. Bikker, P. L. Yu, E. J. Veldhuizen, and H. P. Haagsman. 2011. Avian cathelicidins: paradigms for the development of anti-infectives. Vet. Microbiol. 153:27–36. van Dijk, A., E. M. Molhoek, E. J. Veldhuizen, J. L. Bokhoven, E. Wagendorp, F. Bikker, and H. P. Haagsman. 2009. Identification of chicken cathelicidin-2 core elements involved in antibacterial and immunomodulatory activities. Mol. Immunol. 46: 2465–2473. van Dijk, A., E. J. Veldhuizen, A. J. van Asten, and H. P. Haagsman. 2005. CMAP27, a novel chicken cathelicidin-like antimicrobial protein. Vet. Immunol. Immunopathol. 106:321–327. Veldhuizen, E. J., E. C. Brouwer, V. A. Schneider, and A. C. Fluit. 2013. Chicken cathelicidins display antimicrobial activity against multiresistant bacteria without inducing strong resistance. PloS one. 8:e61964. Wehkamp, J., M. Schmid, and E. F. Stange. 2007. Defensins and other antimicrobial peptides in inflammatory bowel disease. Curr. Opin. Gastroenterol. 23:370–378. Wong, C. C., L. Zhang, Z. J. Li, W. K. Wu, S. X. Ren, Y. C. Chen, T. B. Ng, and C. H. Cho. 2012. Protective effects of cathelicidinencoding Lactococcus lactis in murine ulcerative colitis. J. Gastroenterol. Hepatol. 27:1205–1212. Xiao, Y., Y. Cai, Y. R. Bommineni, S. C. Fernando, O. Prakash, S. E. Gilliland, and G. Zhang. 2006. Identification and functional characterization of three chicken cathelicidins with potent antimicrobial activity. J. Biol. Chem. 281:2858–2867. Xiao, Y., A. I. Herrera, Y. R. Bommineni, J. L. Soulages, O. Prakash, and G. Zhang. 2009. The central kink region of fowlicidin-2, an alpha-helical host defense peptide, is critically involved in bacterial killing and endotoxin neutralization. J. Innate Immun. 1:268– 280. Zaiou, M., and R. L. Gallo. 2002. Cathelicidins, essential geneencoded mammalian antibiotics. J. Mol. Med. 80:549–561. Zanetti, M. 2005. The role of cathelicidins in the innate host defenses of mammals. Curr. Issues Mol. Biol. 7:179–196. Zhao, C., T. Ganz, and R. I. Lehrer. 1995. The structure of porcine protegrin genes. FEBS Lett. 368:197–202.
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Mahoney, M. M., A. Y. Lee, D. J. Brezinski-Caliguri, and K. M. Huttner. 1995. Molecular analysis of the sheep cathelin family reveals a novel antimicrobial peptide. FEBS Lett. 377: 519–522. Montreekachon, P., P. Chotjumlong, J. G. Bolscher, K. Nazmi, V. Reutrakul, and S. Krisanaprakornkit. 2011. Involvement of P2X(7) purinergic receptor and MEK1/2 in interleukin-8 upregulation by LL-37 in human gingival fibroblasts. J. Periodont. Res. 46:327–337. Morioka, Y., K. Yamasaki, D. Leung, and R. L. Gallo. 2008. Cathelicidin antimicrobial peptides inhibit hyaluronan-induced cytokine release and modulate chronic allergic dermatitis. J. Immunol. 181:3915–3922. Murano, T., R. Okamoto, G. Ito, T. Nakata, S. Hibiya, H. Shimizu, S. Fujii, Y. Kano, T. Mizutani, S. Yui, J. Akiyama-Morio, Y. Nemoto, K. Tsuchiya, T. Nakamura, and M. Watanabe. 2014. Hes1 promotes the IL-22-mediated antimicrobial response by enhancing STAT3-dependent transcription in human intestinal epithelial cells. Biochem. Biophys. Res. Commun. 443:840– 846. Nagaoka, I., N. Ishihara, and T. Yamashita. 1994. Characterization of the promoters of the guinea pig neutrophil cationic peptide-1 and -2 genes. FEBS Lett. 356:33–38. Nechanitzky, R., D. Akbas, S. Scherer, I. Gyory, T. Hoyler, S. Ramamoorthy, A. Diefenbach, and R. Grosschedl. 2013. Transcription factor EBF1 is essential for the maintenance of B cell identity and prevention of alternative fates in committed cells. Nat. Immunol. 14:867–875. Nijnik, A., and R. E. Hancock. 2009. The roles of cathelicidin LL-37 in immune defences and novel clinical applications. Curr. Opin. Hematol. 16:41–47. Nizet, V., T. Ohtake, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Dorschner, V. Pestonjamasp, J. Piraino, K. Huttner, and R. L. Gallo. 2001. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature. 414:454–457. Ong, P. Y., T. Ohtake, C. Brandt, I. Strickland, M. Boguniewicz, T. Ganz, R. L. Gallo, and D. Y. Leung. 2002. Endogenous antimicrobial peptides and skin infections in atopic dermatitis. N. Engl. J. Med. 347:1151–1160. Park, K., P. M. Elias, Y. Oda, D. Mackenzie, T. Mauro, W. M. Holleran, and Y. Uchida. 2011. Regulation of cathelicidin antimicrobial peptide expression by an endoplasmic reticulum (ER) stress signaling, vitamin D receptor-independent pathway. J. Biol. Chem. 286:34121–34130. Purandare, S. M., S. M. Ware, K. M. Kwan, M. Gebbia, M. T. Bassi, J. M. Deng, H. Vogel, R. R. Behringer, J. W. Belmont, and B. Casey. 2002. A complex syndrome of left-right axis, central nervous system and axial skeleton defects in Zic3 mutant mice. Development. 129:2293–2302. Scocchi, M., D. Bontempo, S. Boscolo, L. Tomasinsig, E. Giulotto, and M. Zanetti. 1999. Novel cathelicidins in horse leukocytes(1). FEBS Lett. 457:459–464.
919
Animal Biotechnology Division, National Institute of Animal Science, RDA, 1500, Kongjwipatjwi-ro, Iseo-myeon, Wanju-gun, Jeollabuk-do, 565-851, Republic of Korea; † College of Pharmacy, Dankook University, 119 Dandae-ro, Cheonan, Chungnam 330-714, Republic of Korea; ‡ Department of Veterinary Pathobiology, Texas A&M University, College Station, TX 77843-4467; and § Department of Animal Resource and Science, Dankook University, Cheonan, Choongnam, 330-714, Republic of Korea
Key words: chicken, cathelicidin, CAMP, promoter, transcription 2016 Poultry Science 95:912–919 http://dx.doi.org/10.3382/ps/pev361
INTRODUCTION
proteolytic processing with specific enzymes, the heterogeneous domain of cathelicidin-related antimicrobial peptides (CRAMPs) is released. The sequence heterogeneity of CRAMPs is reflected in their structural diversity, which includes all three major folding types: cysteine-free linear peptides with an α-helical and amphipathic structure, cysteine-containing peptides with a flat β -sheet structure, and peptides rich in particular amino acids such as proline, arginine, and tryptophan (Zaiou and Gallo, 2002). In addition, CRAMPs participate in cellular responses that are associated with protection against infection (Nizet et al., 2001; Bowdish et al., 2005; Jo, 2010), activation of the immune system (Scott et al., 2002; Tjabringa et al., 2006; Montreekachon et al., 2011), control of inflammation (Morioka et al., 2008; Wong et al., 2012), and immune response disorders (Ong et al., 2002; Wehkamp et al., 2007; Bartley, 2010). The chicken genome encodes four cathelicidin genes: LOC100858343 (also known as CATH-3), CAMP (also known as CATHL2), CATHB1 (also known as CATHL1), and CATHL3 (also known as CATH-1). These genes are clustered within a 7.5-kb region at the proximal end of chromosome 2. LOC100858343 is potentially transcribed in the inverted orientation relative to the orientation of the other cathelicidin genes (Goitsuka et al., 2007; van Dijk et al., 2005; Xiao et al.,
Cathelicidins form a family of vertebrate-specific immune molecules present in cattle, sheep, goats, horses, mice, guinea pigs, and humans (Gennaro et al., 1989; Nagaoka et al., 1994; Mahoney et al., 1995; Gallo et al., 1997; Scocchi et al., 1999; Shamova et al., 1999). Cathelicidins are expressed in various cell types, including neutrophils, myeloid precursors, epithelial cells, mast cells, lymphocytes, and keratinocytes; in many tissues, such as the oral cavity, skin, intestine, lungs, and cervix; and in body fluids, such as plasma, breast milk, saliva, gastric juice, semen, sweat, and bronchoalveolar fluid (Zanetti, 2005; Nijnik and Hancock, 2009; Choi and Mookherjee, 2012). Cathelicidins exhibit unique bipartite features: a substantially heterogeneous C-terminal antimicrobial domain of 12–100 residues and an evolutionarily conserved N-terminal cathelin-like domain of 99–114 residues (Zanetti, 2005; Chang et al., 2006). Cathelicidins are first produced as inactive precursors; following the removal of the conserved cathelin-like domain via C 2016 Poultry Science Association Inc. Received August 6, 2015. Accepted October 20, 2015. 1 These authors contributed equally to this work. 2 Corresponding author: [email protected]
912
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
factors (TFs) that bind to the 5 -flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5 -flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.
ABSTRACT Cathelicidins form a family of vertebratespecific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription
913
REGULATION OF CATHELICIDIN IN CHICKEN Table 1. List of primer for quantitative RT-PCR. Primer sequence (5 -> 3 ) No.
Gene Symbol
Accession No.
CAMP CATH3 CATHB1 CEBPA
NM NM NM NM
001024830 001311177 001271172 001031459
5 6 7
MSX1 EBF1 HES1
NM 205488 NM 204752 NM 001005848
8 9
PAX9 VDR
NM 204912 NM 205098
10
ZIC3
XM 420237
11
GAPDH
NM 204305
Forward
Reverse
Product Size
cathelicidin-2 cathelicidin-3 cathelicidin-B1-like CCAAT/enhancer binding protein (C/EBP), alpha msh homeobox 1 early B-cell factor 1 hairy and enhancer of split 1 paired box 9 vitamin D (1,25dihydroxyvitamin D3) receptor Zic family member 3 heterotaxy 1 glyceraldehyde-3phosphate dehydrogenase
GACAGAGTGCACCCCGAGCG CGGGCTCGTCAAGGACTGCG GCCGATCACCTACCTGGATG TGGAGACGCAGCAGAAGGTG
GGCCCCGTTGGACCAGAACG CCCGCAGCCACCGTGTTGAT TGGTGACGTTCAGATGTCCG CTGAAGATGCCCCGCAGAGT
157 150 189 106
TTCTCCGCTCCCTTCATCCA GCGAAAAGACCAACAACGGG CCAGAGGGCACAGATGGCA
CTGCCACAGTTCCTTCCCCA TCGTGCGTGAGCAGAACTCG CTCGCAGGTGGACAGGAACC
108 172 115
ACTCCTACCCCAGCCCCATC CCTGAAGCCCAAACTGTCGG
TGTCGCTCACTTGGTCCGTG GACGGAGGAGGAGTGCGTTG
162 160
AGGGCTCGGACTCTTCCCC
TCCTTTCTGCCTCGTTCCCA
229
GGTGGTGCTAAGCGTGTTAT
ACCTCTGTCATCTCTCCACA
244
2006; van Dijk et al., 2011). CAMP and CATHL3 are highly expressed in bone marrow and show similar levels of expression in other tissues, whereas CATHB1 is mainly produced in the bursa of Fabricius and shows a unique expression pattern among the cathelicidins during embryonic development (Goitsuka et al., 2007; Achanta et al., 2012). All chicken cathelicidins have antimicrobial activities against a broad spectrum of Gram-positive and Gramnegative bacteria (Xiao et al., 2006; Bommineni et al., 2007; Goitsuka et al., 2007; van Dijk et al., 2009; Veldhuizen et al., 2013). The matured LOC100858343 and CATHL3 have over 70% sequence similarity, which suggests an inverted duplication of the gene (Xiao et al., 2006). LOC100858343 and CATHL3 commonly have a linear alpha-helical shape, whereas CAMP has a proline-induced hinge region that is thought to have antibacterial and immunomodulatory roles (van Dijk et al., 2009; Xiao et al., 2009). In humans, 1,25-dihydroxyvitamin D3, the hormonally active metabolite of vitamin D, induces the expression of human cathelicidin antimicrobial peptide (CAMP) gene in keratinocytes and bone marrow cells. This induction occurs through the coupling of the consensus vitamin D response element (VDRE) in the CAMP promoter and the vitamin D receptor (VDR) (Gombart et al., 2005). ER stress in human keratinocytes also increases CAMP expression via NFκB and CCAAT/enhancer-binding protein α (CEBPA) through a VDR-independent pathway (Park et al., 2011). Additionally, NF-κB has been shown to be associated with the induction of CRAMPs in murine mast cells by lipopolysaccharides (Li et al., 2009). However, the regulatory mechanisms of cathelicidin genes in various species, including the chicken, remain unclear.
In this study, we predicted the regulatory elements of chicken cathelicidin genes and analyzed the interaction between the predicted elements and their binding factors in chicken bone marrow cells. Our study expands our understanding of the regulatory mechanisms underlying cathelicidin expression in chickens.
MATERIALS AND METHODS Experimental Animals and Animal Care The study protocol and standard operating procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the National Institute of Animal Science in Korea (2013–048). The experimental procedures used in animal management, reproduction, and embryo manipulation followed the standard program of our laboratory.
Quantitative Real-Time RT-PCR Analysis of mRNAs and miRNAs BMCs and CEFs were cultured in Dulbecco’s Modified Eagle’s medium (high glucose; Gibco, NY) containing 10% fetal bovine serum (Hyclone, UT) and 2% chicken serum (Sigma-Aldrich, MO). Cultured cells were treated by 0.05% trypsin-EDTA for 3 min followed by inactivation of enzyme using 10% fetal bovine serum. Then, cells were collected by centrifugation. RNA was isolated from chicken embryonic fibroblasts (CEFs) and bone marrow cells (BMCs) using TRIzol reagent (Invitrogen, CA). For qRT-PCR, total RNA (1 µg) was used for cDNA synthesis with the Superscript III FirstStrand Synthesis System (Invitrogen). The primers for qRT-PCR of each gene transcript were designed
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
1 2 3 4
Description
914
LEE ET AL. Table 2. siRNA sequence for inhibition of MSX1. siRNA sequence (5 -> 3 ) Target gene MSX1
Location
Sense
Antisense
927 987 1114
GUAUGUACCACCUUACAUA CUCCCUUCAUCCAGACCUU GGACAUUUCUGCAAGGCGA
UAUGUAAGGUGGUACAUAC AAGGUCUGGAUGAAGGGAG UCGCCUUGCAGAAAUGUCC
In Vitro Functional Assays of mRNAs and siRNAs For the analysis of mRNA functionality, we designed siRNAs against MSX1 (Table 2). The siRNA control was not complementary to any sequences in the chicken genome and was purchased from Bioneer Inc. For the functional analysis of mRNAs, 5 × 105 BMCs were transfected using RNAiMAX (Invitrogen, CA) according to the manufacturer’s instructions. Briefly, 7.5 µL of RNAiMAX reagent suspended in 250 µL Opti-MEM solution was incubated for 5 min at room temperature, and the mixture was added to 75 nM of siRNAs against MSX1. Then, the mixture of RNAiMAX and probes were added drop-wise to BMCs in a culture medium lacking antibiotics. At 48 h after transfection, total RNA was extracted and analyzed by qRT-PCR.
The Luciferase Reporter Assay The 220-bp DNA sequence in the 5 -flanking region of CAMP and the mutated sequence of MSX1 binding sites in the 5 -flanking region of CAMP were synthesized by Bioneer Inc. The 5 -flanking region of CAMP was subcloned into the multiple cloning region of the pGL3-Basic vector (Promega, WI). To evaluate luminescence, the cells were assayed using the Luciferase assay system kit (Promega) according to the manufacturer’s protocol. At 72 h after transfection, the cells were harvested, washed with cold PBS and extracted with 100 µL of diluted Passive Lysis buffer. The extracts were centrifuged at 13,000 × g for 5 min, and the supernatants were collected. The activity of firefly and Renilla luciferase was measured using a GLOMAX 20/20 Luminometer (Promega). All measurements were normalized to the level of Renilla activity.
Statistical Analyses In the knockdown experiments, the expression of gene transcripts was analyzed using Student’s t-tests and SAS software (SAS Institute, NC). To evaluate the significance of differences between the treatment and control groups, the data were analyzed with general linear models (PROC-GLM) implemented in the SAS software. A P-value of less than 0.05 was considered to indicate statistical significance.
RESULTS Expression Pattern of Cathelicidin Genes and Putative Binding Factors for 5 -Flanking Regions of Cathelicidin Genes in Chicken Bone Marrow Cells (BMCs) When the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) were compared between chicken BMCs and chicken embryonic fibroblasts (CEFs), CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly (Figure 1). To study the mechanism of up-regulation of the cathelicidin genes CAMP and CATHB1 in BMCs, transcription factors (TFs) within 220 to 300 bp of the 5 -flanking regions of all cathelicidin genes were predicted by PROMO (http://alggen.lsi.upc.es/cgi-bin/ promo v3/promo/promoinit.cgi?dirDB=TF 8.3). The expression levels of the predicted TFs, including CEBPA, EBF1, HES1, MSX1, VDR, and ZIC3, were compared between the BMCs and CEFs. The analysis indicated that CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated, whereas the expression of VDR did not differ significantly between BMCs and CEFs (Figure 2). From these results, we concluded that the TFs up-regulated in BMCs were correlated with the regulation of the chicken cathelicidin genes CAMP and CATHB1.
Knockdown Assay for MSX1 in Chicken BMCs To examine whether the expression levels of CAMP, CATH3, and CATHB1 were altered by the repression of the up-regulated TFs, we selected chicken MSX1targeted siRNAs after screening siRNAs for the upregulated TFs in BMCs. To obtain the MSX1 siRNAs, we designed three siRNA sequences that obeyed
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
using the program Primer3 (http://frodo.wi.mit.edu/) (Table 1). The qRT-PCR analysis was performed using Roter-Gene 6000 (Qiagen, CA) and EvaGreen (Biotium, CA). The PCR reaction (total 20 µL) was performed by 0.1 µM primer. The PCR conditions were 94◦ C for 3 min, followed by 40 cycles of 94◦ C for 30 s, 59–61◦ C for 30 s and 72◦ C for 30 s. Melting curve profiles were analyzed for the amplicons. The qRTPCR data were normalized relative to the expression of GAPDH and calculated using the 2 ΔΔCt method, where ΔΔCt = (Ct of the target gene – Ct of GAPDH) treatment – (Ct of the target gene – Ct of GAPDH) control.
REGULATION OF CATHELICIDIN IN CHICKEN
915
Figure 2. Expression analysis of the putative binding factors of cathelicidin gene promoters in chicken BMCs and CEFs. Real-time PCR analysis was conducted in triplicate and normalized to the expression levels of GAPDH. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05, ∗∗ P < 0.005, and ∗∗∗ P < 0.001. Error bars indicate the SE of triplicate analyses. BMCs, bone marrow cells; CEFs, chicken embryonic fibroblasts.
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 1. Expression analysis of cathelicidin genes in chicken BMCs and CEFs. Real-time PCR analysis was conducted in triplicate and normalized to the expression levels of GAPDH. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05, ∗∗ P < 0.005, and ∗∗∗ P < 0.001. Error bars indicate the SE of triplicate analyses. BMCs, bone marrow cells; CEFs, chicken embryonic fibroblasts.
916
LEE ET AL.
Thuthel’s rule for MSX1. We then evaluated whether the designed siRNAs repressed expression in BMCs using a knockdown approach. A nonspecific siRNA with no homology to chicken sequences was used as a control. The knockdown efficiency of the siRNA for MSX1 was 59.5 ± 0.8% (P < 0.05) (Figure 3A). Subsequently, when we compared the expression of cathelicidin genes between the MSX1-repressed BMCs and the normal BMCs, the expression of both CAMP and CATHB1 was decreased in the MSX1-repressed BMCs (P < 0.05), whereas the expression of CATH3 did not differ significantly (Figure 3B). Thus, we concluded that MSX1 directly regulates the expression of CAMP and CATHB.
Binding Activity of MSX1 to the 5 -flanking Region of CAMP In our predictions of the TFs binding to cathelicidin genes, 14 MSX1-binding motifs were predicted within
the 5 -flanking region of chicken CAMP (Figure 4). To elucidate whether MSX1 regulated the transcriptional activity of CAMP, 11 MSX1-binding sites that did not overlap with other binding sites were mutated in the 5 -flanking region of CAMP (Figure 4B). When the transcriptional activity of the mutated region was evaluated in BMCs, we found that it was decreased by approximately 60% compared to the transcriptional activity of the non-mutated region (Figure 5). These results suggested that MSX1 could regulate the transcriptional activity of CAMP binding to the MSX1-binding sites within the 5 -flanking region of CAMP.
DISCUSSION In this study, our results suggest that commonly upregulated TFs, such as CEBPA, EBF1, HES1, MSX1, and ZIC3, are involved in the regulation of the chicken cathelicidin genes (CAMP, CATHB1 and CATH3) and
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 3. Expression of MSX1 in bone marrow cells after target-specific siRNA expression. Designed siRNA probes were introduced into bone marrow cells by lipofection (A). Expression of cathelicidin genes in bone marrow cells after siRNA-mediated inhibition of MSX1 (B). The control siRNAs have no complementary sequence in the chicken genome. The quantitative real-time PCR analysis was conducted in triplicate and normalized to the expression levels of GAPDH. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05, ∗∗ P < 0.005, and ∗∗∗ P < 0.001. Error bars indicate the SE of triplicate analyses.
REGULATION OF CATHELICIDIN IN CHICKEN
917
that MSX1 directly regulates the expression of chicken CAMP by interacting with MSX1-binding sites in the CAMP promoter. Previous studies have reported that human CAMP is induced by two independent pathways: a VDRdependent pathway and an NF-κB/CEBPA-dependent pathway (Gombart et al., 2005; Park et al., 2011). The VDR-dependent model is only adopted in primates, as demonstrated by the absence of VDRE within the regulatory regions of other species such as rats, mice, and dogs (Gombart et al., 2005). Despite the evolutionary discontinuance among the regulatory regions, cathelicidin genes have been found in various species, including most mammals, birds, reptiles and fish (Zanetti, 2005; van Dijk et al., 2011). It has also been reported that cathelicidin genes share a conserved gene structure consisting of four exons and three introns (Gudmundsson et al., 1995; Zhao et al., 1995; Gudmundsson et al., 1996; Larrick et al., 1996; Scocchi et al., 1997; Huttner et al., 1998; Goitsuka et al., 2007). These previous studies suggest that cathelicidin genes are derived from a common ancestor (van Dijk et al., 2011) and that multiple cathelicidin genes within a single species arose from the rearrangement of the same gene precursor (Zanetti, 2005). Unlike the VDR-dependent model, the NF-κB/CEBPA-dependent model explains the cathelicidin induction pattern observed in mice (Li et al., 2009) and suggests a basal expression of cathelicidin genes (Park et al., 2011). In our study, CEBPA levels were up-regulated in BMCs compared with CEFs, but VDR expression did not change. Thus, we conclude that the NF-κB/CEBPA-dependent model supports the evolutionally conserved regulation of cathelicidin genes in the chicken.
When we compared the predicted TF binding elements in the 5 -flanking regions among humans, mice, and chickens, HES1-binding elements were found only in chickens (Figure 4A). Recently, it was reported that HES1 increases the expression of antimicrobial peptide coding genes, such as REG1A, REG3A, and REG3G, in human intestinal epithelial cells by enhancement of the IL-22-STAT3 signaling pathway (Murano et al., 2014). IL-22 and STAT3 expression have also been reported in chickens (Caldwell et al., 2005; Kim et al., 2012). Therefore, chicken cathelicidin genes might have a unique induction pathway, such as the IL-22-STAT3 signaling pathway. In addition, EBF1, MSX1 and ZIC3 are commonly associated with early bone development as a transcriptional regulator (Han et al., 2007; Horowitz and Lorenzo, 2007; Purandare et al., 2002). In particular, EBF1 has been closely linked to the activation and maintenance of the B cell lineage (Nechanitzky et al., 2013). Recently, cathelicidinderived peptides have been demonstrated to modulate immune cell differentiation and strengthen immune cell function (Davidson et al., 2004; Kin et al., 2011). Our data also demonstrate that MSX1 can directly interact with the promoter of the CAMP gene to regulate CAMP gene expression. Collectively, we conclude that these transcription factors are related to the activation and differentiation of cathelicidin genes in chicken BMCs. In conclusion, we screened for transcription factors that are related to the control of chicken cathelicidin genes and found that MSX1 directly interacted with the putative binding sites found in the chicken CAMP promoter. Our data contribute to the understanding
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 4. Prediction of TF binding sites and mutation of the CAMP promoter. The binding sites for MSX1, EBF1, C/EBBPA, and HES1 were predicted in the CAMP promoters of the human, mouse, and chicken (A). A CAMP promoter with mutated MSX1-binding motifs was synthesized (B). Large and bold sequences indicate the MSX1-binding motif, and red-colored sequences indicate modified sequences.
918
LEE ET AL.
of the regulatory mechanisms of cathelicidin genes in BMCs.
ACKNOWLEDGMENTS This study was supported by 2014–2015 Postdoctoral Fellowship Program of National Institute of Animal Science, Rural Development Administration, Republic of Korea. This work was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ010201012015)” Rural Development Administration, Republic of Korea.
REFERENCES Achanta, M., L. T. Sunkara, G. Dai, Y. R. Bommineni, W. Jiang, and G. Zhang. 2012. Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides. J. Anim. Sci. Biotechnol. 3:15. Bartley, J. 2010. Vitamin D: emerging roles in infection and immunity. Expert Rev. Anti-Infect. Ther. 8:1359–1369.
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Figure 5. Analysis of promoter activity for the 5 -flanking region of CAMP. The potential transcriptional activity of the 5 -flanking region and the mutated 5 -flanking region for MSX1-binding motifs was assessed in BMCs. At 48 h after transfection of a luciferase construct, luminescence signals were detected using a luminometer. All measurements were normalized to the Renilla activity. The mean ± standard deviation from three independent experiments is shown. Significant differences between the control and treatment groups are indicated as ∗ P < 0.05.
Bommineni, Y. R., H. Dai, Y. X. Gong, J. L. Soulages, S. C. Fernando, U. Desilva, O. Prakash, and G. Zhang. 2007. Fowlicidin-3 is an alpha-helical cationic host defense peptide with potent antibacterial and lipopolysaccharide-neutralizing activities. FEBS J. 274:418–428. Bowdish, D. M., D. J. Davidson, Y. E. Lau, K. Lee, M. G. Scott, and R. E. Hancock. 2005. Impact of LL-37 on anti-infective immunity. J. Leukoc. Biol. 77:451–459. Caldwell, R. B., A. M. Kierzek, H. Arakawa, Y. Bezzubov, J. Zaim, P. Fiedler, S. Kutter, A. Blagodatski, D. Kostovska, M. Koter, J. Plachy, P. Carninci, Y. Hayashizaki, and J. M. Buerstedde. 2005. Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis. Genome Biol. 6:R6 Chang, C. I., Y. A. Zhang, J. Zou, P. Nie, and C. J. Secombes. 2006. Two cathelicidin genes are present in both rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Antimicrob. Agents Chemother. 50:185–195. Choi, K. Y., and N. Mookherjee. 2012. Multiple immune-modulatory functions of cathelicidin host defense peptides. Front. Immunol. 3:149. Davidson, D. J., A. J. Currie, G. S. Reid, D. M. Bowdish, K. L. MacDonald, R. C. Ma, R. E. Hancock, and D. P. Speert. 2004. The cationic antimicrobial peptide LL-37 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization. J. Immunol. 172:1146–1156. Gallo, R. L., K. J. Kim, M. Bernfield, C. A. Kozak, M. Zanetti, L. Merluzzi, and R. Gennaro. 1997. Identification of CRAMP, a cathelin-related antimicrobial peptide expressed in the embryonic and adult mouse. J. Biol. Chem. 272:13088–13093. Gennaro, R., B. Skerlavaj, and D. Romeo. 1989. Purification, composition, and activity of two bactenecins, antibacterial peptides of bovine neutrophils. Infect. Immun. 57:3142–3146. Goitsuka, R., C. L. Chen, L. Benyon, Y. Asano, D. Kitamura, and M. D. Cooper. 2007. Chicken cathelicidin-B1, an antimicrobial guardian at the mucosal M cell gateway. Proc. Natl. Acad. Sci. U. S. A. 104:15063–15068. Gombart, A. F., N. Borregaard, and H. P. Koeffler. 2005. Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3. FASEB. J. 19:1067–1077. Gudmundsson, G. H., B. Agerberth, J. Odeberg, T. Bergman, B. Olsson, and R. Salcedo. 1996. The human gene FALL39 and processing of the cathelin precursor to the antibacterial peptide LL37 in granulocytes. Eur. J. Biochem. 238:325–332. Gudmundsson, G. H., K. P. Magnusson, B. P. Chowdhary, M. Johansson, L. Andersson, and H. G. Boman. 1995. Structure of the gene for porcine peptide antibiotic PR-39, a cathelin gene family member: comparative mapping of the locus for the human peptide antibiotic FALL-39. Proc. Natl. Acad. Sci. U. S. A. 92:7085–7089. Han, J., M. Ishii, P. Bringas, Jr., R. L. Maas, R. E. Maxson, Jr., and Y. Chai. 2007. Concerted action of Msx1 and Msx2 in regulating cranial neural crest cell differentiation during frontal bone development. Mech. Dev. 124:729–745. Horowitz, M. C., and J. A. Lorenzo. 2007. Immunologic regulation of bone development. Adv. Exp. Med. Biol. 602:47–56. Huttner, K. M., M. R. Lambeth, H. R. Burkin, D. J. Burkin, and T. E. Broad. 1998. Localization and genomic organization of sheep antimicrobial peptide genes. Gene. 206:85–91. Jo, E. K. 2010. Innate immunity to mycobacteria: vitamin D and autophagy. Cell Microbiol. 12:1026–1035. Kim, S., L. Faris, C. M. Cox, L. H. Sumners, M. C. Jenkins, R. H. Fetterer, K. B. Miska, and R. A. Dalloul. 2012. Molecular characterization and immunological roles of avian IL-22 and its soluble receptor IL-22 binding protein. Cytokine. 60:815–827. Kin, N. W., Y. Chen, E. K. Stefanov, R. L. Gallo, and J. F. Kearney. 2011. Cathelin-related antimicrobial peptide differentially regulates T- and B-cell function. Eur. J. Immunol. 41:3006–3016. Larrick, J. W., J. Lee, S. Ma, X. Li, U. Francke, S. C. Wright, and R. F. Balint. 1996. Structural, functional analysis and localization of the human CAP18 gene. FEBS Lett. 398:74–80. Li, G., J. Domenico, Y. Jia, J. J. Lucas, and E. W. Gelfand. 2009. NF-kappaB-dependent induction of cathelicidin-related antimicrobial peptide in murine mast cells by lipopolysaccharide. Int. Arch. Allergy Immunol. 150:122–132.
REGULATION OF CATHELICIDIN IN CHICKEN
Scocchi, M., S. Wang, and M. Zanetti. 1997. Structural organization of the bovine cathelicidin gene family and identification of a novel member. FEBS Lett. 417:311–315. Scott, M. G., D. J. Davidson, M. R. Gold, D. Bowdish, and R. E. Hancock. 2002. The human antimicrobial peptide LL-37 is a multifunctional modulator of innate immune responses. J. Immunol. 169:3883–3891. Shamova, O., K. A. Brogden, C. Zhao, T. Nguyen, V. N. Kokryakov, and R. I. Lehrer. 1999. Purification and properties of proline-rich antimicrobial peptides from sheep and goat leukocytes. Infect. Immun. 67:4106–4111. Tjabringa, G. S., D. K. Ninaber, J. W. Drijfhout, K. F. Rabe, and P. S. Hiemstra. 2006. Human cathelicidin LL-37 is a chemoattractant for eosinophils and neutrophils that acts via formyl-peptide receptors. Int. Arch. Allergy Immunol. 140:103–112. van Dijk, A., E. M. Molhoek, F. J. Bikker, P. L. Yu, E. J. Veldhuizen, and H. P. Haagsman. 2011. Avian cathelicidins: paradigms for the development of anti-infectives. Vet. Microbiol. 153:27–36. van Dijk, A., E. M. Molhoek, E. J. Veldhuizen, J. L. Bokhoven, E. Wagendorp, F. Bikker, and H. P. Haagsman. 2009. Identification of chicken cathelicidin-2 core elements involved in antibacterial and immunomodulatory activities. Mol. Immunol. 46: 2465–2473. van Dijk, A., E. J. Veldhuizen, A. J. van Asten, and H. P. Haagsman. 2005. CMAP27, a novel chicken cathelicidin-like antimicrobial protein. Vet. Immunol. Immunopathol. 106:321–327. Veldhuizen, E. J., E. C. Brouwer, V. A. Schneider, and A. C. Fluit. 2013. Chicken cathelicidins display antimicrobial activity against multiresistant bacteria without inducing strong resistance. PloS one. 8:e61964. Wehkamp, J., M. Schmid, and E. F. Stange. 2007. Defensins and other antimicrobial peptides in inflammatory bowel disease. Curr. Opin. Gastroenterol. 23:370–378. Wong, C. C., L. Zhang, Z. J. Li, W. K. Wu, S. X. Ren, Y. C. Chen, T. B. Ng, and C. H. Cho. 2012. Protective effects of cathelicidinencoding Lactococcus lactis in murine ulcerative colitis. J. Gastroenterol. Hepatol. 27:1205–1212. Xiao, Y., Y. Cai, Y. R. Bommineni, S. C. Fernando, O. Prakash, S. E. Gilliland, and G. Zhang. 2006. Identification and functional characterization of three chicken cathelicidins with potent antimicrobial activity. J. Biol. Chem. 281:2858–2867. Xiao, Y., A. I. Herrera, Y. R. Bommineni, J. L. Soulages, O. Prakash, and G. Zhang. 2009. The central kink region of fowlicidin-2, an alpha-helical host defense peptide, is critically involved in bacterial killing and endotoxin neutralization. J. Innate Immun. 1:268– 280. Zaiou, M., and R. L. Gallo. 2002. Cathelicidins, essential geneencoded mammalian antibiotics. J. Mol. Med. 80:549–561. Zanetti, M. 2005. The role of cathelicidins in the innate host defenses of mammals. Curr. Issues Mol. Biol. 7:179–196. Zhao, C., T. Ganz, and R. I. Lehrer. 1995. The structure of porcine protegrin genes. FEBS Lett. 368:197–202.
Downloaded from http://ps.oxfordjournals.org/ at Orta Dogu Teknik University Library (ODTU) on March 29, 2016
Mahoney, M. M., A. Y. Lee, D. J. Brezinski-Caliguri, and K. M. Huttner. 1995. Molecular analysis of the sheep cathelin family reveals a novel antimicrobial peptide. FEBS Lett. 377: 519–522. Montreekachon, P., P. Chotjumlong, J. G. Bolscher, K. Nazmi, V. Reutrakul, and S. Krisanaprakornkit. 2011. Involvement of P2X(7) purinergic receptor and MEK1/2 in interleukin-8 upregulation by LL-37 in human gingival fibroblasts. J. Periodont. Res. 46:327–337. Morioka, Y., K. Yamasaki, D. Leung, and R. L. Gallo. 2008. Cathelicidin antimicrobial peptides inhibit hyaluronan-induced cytokine release and modulate chronic allergic dermatitis. J. Immunol. 181:3915–3922. Murano, T., R. Okamoto, G. Ito, T. Nakata, S. Hibiya, H. Shimizu, S. Fujii, Y. Kano, T. Mizutani, S. Yui, J. Akiyama-Morio, Y. Nemoto, K. Tsuchiya, T. Nakamura, and M. Watanabe. 2014. Hes1 promotes the IL-22-mediated antimicrobial response by enhancing STAT3-dependent transcription in human intestinal epithelial cells. Biochem. Biophys. Res. Commun. 443:840– 846. Nagaoka, I., N. Ishihara, and T. Yamashita. 1994. Characterization of the promoters of the guinea pig neutrophil cationic peptide-1 and -2 genes. FEBS Lett. 356:33–38. Nechanitzky, R., D. Akbas, S. Scherer, I. Gyory, T. Hoyler, S. Ramamoorthy, A. Diefenbach, and R. Grosschedl. 2013. Transcription factor EBF1 is essential for the maintenance of B cell identity and prevention of alternative fates in committed cells. Nat. Immunol. 14:867–875. Nijnik, A., and R. E. Hancock. 2009. The roles of cathelicidin LL-37 in immune defences and novel clinical applications. Curr. Opin. Hematol. 16:41–47. Nizet, V., T. Ohtake, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Dorschner, V. Pestonjamasp, J. Piraino, K. Huttner, and R. L. Gallo. 2001. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature. 414:454–457. Ong, P. Y., T. Ohtake, C. Brandt, I. Strickland, M. Boguniewicz, T. Ganz, R. L. Gallo, and D. Y. Leung. 2002. Endogenous antimicrobial peptides and skin infections in atopic dermatitis. N. Engl. J. Med. 347:1151–1160. Park, K., P. M. Elias, Y. Oda, D. Mackenzie, T. Mauro, W. M. Holleran, and Y. Uchida. 2011. Regulation of cathelicidin antimicrobial peptide expression by an endoplasmic reticulum (ER) stress signaling, vitamin D receptor-independent pathway. J. Biol. Chem. 286:34121–34130. Purandare, S. M., S. M. Ware, K. M. Kwan, M. Gebbia, M. T. Bassi, J. M. Deng, H. Vogel, R. R. Behringer, J. W. Belmont, and B. Casey. 2002. A complex syndrome of left-right axis, central nervous system and axial skeleton defects in Zic3 mutant mice. Development. 129:2293–2302. Scocchi, M., D. Bontempo, S. Boscolo, L. Tomasinsig, E. Giulotto, and M. Zanetti. 1999. Novel cathelicidins in horse leukocytes(1). FEBS Lett. 457:459–464.
919