- Email: [email protected]
ATF transcription factors
BBRC Biochemical and Biophysical Research Communications 312 (2003) 702–707 www.elsevier.com/locate/ybbrc
Transcriptional regulation of the murine brca2 gene by CREB/ATF transcription factors Nathalie Callens,a,b Jean-Luc Baert,a Didier Monte,a Morten Sunesen,c Carine Van Lint,d and Yvan de Launoita,b,* a
UMR 8117 CNRS, Institut Pasteur de Lille, Universit e de Lille 1, Institut de Biologie de Lille, BP 447, 1 rue Calmette, 59021 Lille Cedex, France Laboratoire de Virologie Mol eculaire, Facult e de M edecine, Universit e Libre de Bruxelles, CP 614, 808 route de Lennik, 1070 Brussels, Belgium c Laboratoire de Neurobiologie Mol eculaire, Room 1008, Institut Pasteur, 25, Rue du Dr Roux, 75724 Paris Cedex, 15, France d Laboratoire de Chimie Biologique, D epartement de Biologie Mol eculaire, Institut de Biologie et de M edecine Mol eculaires, Facult e des Sciences, Universit e Libre de Bruxelles, Rue des Professeurs Jeener et Brachet 12, Gosselies 6041, Belgium
b
Received 20 October 2003
Abstract The brca2 gene encodes a nuclear protein which is mainly involved in DNA repair and, when mutated, is responsible for some of the hereditary breast cancers. However, brca2 expression is also deregulated in sporadic breast tumors. In the mouse brca2 gene we had earlier identified a region of 148 bp upstream of the transcription start site sufficient to activate its expression. In the present report, we show that the )92 to )40 bp region is essential for the transcription of brca2 in murine mammary cells and that this nucleotide sequence contains one putative CREB/ATF consensus site (cAMP responsive element: CRE). We demonstrated that the mutation of this binding site led to a highly significant reduction of the mouse brca2 transcription, and that CREB, CREM, and/or ATF-1 functionally bound to and regulated this promoter. Therefore, the regulation of the promoter of the mouse brca2 gene is driven by this family of transcription factors. Ó 2003 Published by Elsevier Inc. Keywords: brca2; Promoter; Transcription; Mouse; Mammary
Germinal mutations in the human BRCA1 and BRCA2 genes are believed to be responsible for most hereditary breast cancers, which account for 5–10% of all breast cancer cases [1–3]. Both genes are up-regulated in proliferating and differentiating cells, expressed in a cell cycle-dependent manner peaking at the G1/S boundary [4,5] and widely expressed during development [6,7]. The human BRCA2 gene is composed of 27 exons and encodes a nuclear protein of 3418 residues possessing no obvious homology to any known protein [1]. In accord with a function in transcriptional regulation, BRCA2 interacts directly with P53 and P/CAF proteins, a fact which indicates a function as a transcriptional cofactor [8,9]. Of crucial importance is the fact that BRCA2 interacts with RAD51 [10–12]. RAD51 * Corresponding author. Fax: +32-25-55-62-57. E-mail address: [email protected] (Y. de Launoit).
0006-291X/$ - see front matter Ó 2003 Published by Elsevier Inc. doi:10.1016/j.bbrc.2003.10.176
is the eukaryotic homologous of the bacterial RecA protein, which has a pivotal activity in meiotic and mitotic recombination, DNA double-strand break repairing, and chromosome segregation. Highly interestingly brca2= cells develop gross chromosomal abnormalities such as spontaneous double-strand breaks and tri-radial and quadri-radial structures, which are well-described characteristics of a malfunctioning DNA repair system [10,13]. The mutations observed in hereditary breast cancers associated to the BRCA2 gene are mostly non-sense mutations leading to the production of truncated proteins. However, several studies have attempted to define a role for BRCA2 in the development of sporadic breast cancers [14]. A loss of heterozygosity in the BRCA2 locus has been detected in over 50% of sporadic breast tumors, although neither the alteration of the coding sequence [15–17] nor promoter
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
methylation has been found in these tumors [18]. Since BRCA2 is significantly over-expressed in many sporadic tumors, one possible mechanism of BRCA2 involvement in sporadic breast cancers could be the deregulation of the expression of the BRCA2 gene [19]. However, it is not known whether this over-expression is due to the induction of the BRCA2 promoter or simply reflects an increase in the number of cells in the S phase. Studies of the transcriptional regulation of the human BRCA2 promoter have revealed that a cellcycle-dependent expression is associated with the binding of both the upstream stimulatory factor (USF) protein and the Ets transcription factor Elf-1 [20]. Moreover, the nuclear factor-jB (NF-jB) [21] and USF [22] also bind to the human BRCA2 promoter and regulate it. At the present time, few data are available on the mouse brca2 promoter. We had earlier identified a region of 148 bp upstream of the first exon which is sufficient to activate the transcription of the brca2 gene in murine mammary cells [23]. In this report, we showed that the )92 to )40 bp region is essential for the positive regulation of the mouse brca2 transcription, and the nucleotide sequence revealed one putative CREB/ATF consensus site (cAMP responsive element: CRE). We showed that this site is essential for the activity of the minimal promoter and we identified CREB, CREM, and/or ATF-1 that functionally bind and regulate this promoter.
Results Identification of the minimal mouse brca2 promoter We had earlier localized the transcription start site of the mouse brca2 gene at approximately 300 bp upstream of the translation initiation codon. We initiated studies on the transcriptional promoter region and identified the first 148 bp as sufficient to drive the transcriptional activity of the mouse brca2 gene in the mammary cells tested [23]. In order to narrow down this promoter region to a minimal sequence, we constructed 50 -deleted mutants and tested their transcriptional activity on NIH3T3, HC11, NMuMg, and F9 mouse cells by luciferase reporter gene assays. The promoter region displayed high levels of transcriptional activity in all these cell lines (data not shown) and as illustrated for the NMuMg cells in Fig. 1, the transcriptional activity of the longer construct used ()814 to +38 bp: 100% activity) is higher than the activity of the SV40 virus promoter (pSV2-luc). The )148 to +38 bp and the )92 to +38 bp constructs retained 88% and 84%, respectively, of the transcriptional activity. In contrast, the construct lacking the region between )92 and )41 bp ()40 to +38 bp con-
703
Fig. 1. Effect of deletions on the transcriptional activity of the mouse brca2 promoter. Constructs containing 50 -deletion mutants linked to the reporter luciferase gene (shown on the left) were tested for transcriptional activity (shown on the right) after transfection into murine NMuMg cells. The end points of the fragments are indicated relative to the transcription start site. The black boxes represent the first 38 bp of the first exon. The transcriptional activity was quantified as luciferase activity and is indicated as a percentage of the longer construct activity ()814 to +38 bp construct ¼ 100%). The data shown are means SEM of five independent experiments. Each transfection condition was performed in duplicate and normalized with the dosage of b-galactosidase expressed by the pSG5-bGal plasmid. The data obtained on the pGL3-basic and the pSV2-luc reporters are also presented.
struct) displayed a critical reduction down to the basal level represented here by the pGL3-basic activity. Similar results were obtained in the three other cell lines (data not shown). On this basis, we defined the region between )92 and +38 bp as the minimal promoter of the mouse brca2 gene, with a critical sequence lying between )92 and )40 bp. The analysis of this sequence revealed putative transcription factor binding motifs. In particular, there was a perfect consensus CREB responsive element (CRE) sequence at position )41 bp. A perfect CRE site is a palindromic sequence (TGACGTCA) recognized by the transcription factors from the CREB/ ATF family. The CRE is important for the brca2 promoter activity Point mutations were introduced into the )148 to +38 bp and the )814 to +38 bp constructs (Fig. 2) to define the contribution of this binding motif. The mutation of the CRE in the NMuMg cells resulted in a high loss of promoter activity by 89% and 95% for the )148 to +38 bp and the )814 to +38 bp constructs, respectively. In the F9 cells, the CRE mutation resulted in a 98–99% transcriptional reduction. Similar results have been obtained from NIH3T3 and HC11 murine mammary cells (data not shown). Thus, we propose that the CRE drives the transcriptional activity of the mouse brca2 promoter.
704
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
Fig. 2. Contribution of the putative CRE to the transcriptional activity of the proximal mouse brca2 promoter. The transcriptional activity of the mutated CRE construct was compared to the transcriptional activity of the wild type construct (100%) after transient transfection into NMuMg cells (black box) and F9 cells (white box). The mutations were introduced into the )148 to +38 bp of the brca2 proximal promoter construct and into the )814 to +38 bp promoter construct. The luciferase activity data have been collected together and are presented as in the legend to Fig. 1.
Identification of the CREB/ATF transcription factors binding to the CRE In order to determine whether the transcription factors from the CREB/ATF family were able to bind specifically to the CRE motif we performed electrophoretic mobility shift assays (EMSA) using a labeled double-strand oligonucleotide containing the CRE and nuclear extracts from different murine cell lines (NIH3T3, HC11, NMuMg, and F9 cells). Four protein– DNA complexes were detected in the murine F9 nuclear extracts (Fig. 3, lane 1). The introduction of an excess of an unlabeled oligonucleotide identical to the probe induced the disappearance of all of the complexes (Fig. 3, lane 2). In contrast, excess of an oligonucleotide specifically mutated at the CRE site did not affect the complexes identified (Fig. 3, lane 3). When this mutated oligonucleotide is used as probe, the three upper bands disappeared (Fig. 3, lane 4). In NMuMg cells, two protein–DNA complexes were detected (lane 1). When the CRE-mutated brca2 oligonucleotide was used as probe, only the upper broad band disappeared (Fig. 3, lane 4). These data suggest that, in both cell lines, the higher migrating band was non-specific. These results indicate that in F9 cells three complexes and in NMuMg cells one complex correspond to transcription factors which specifically bind to the CRE within the brca2 minimal promoter. To identify the members of the CREB/ATF transcription factor family which bind the minimal brca2 promoter we performed EMSA with antibodies raised against several of these factors. A supershift was observed with an anti-ATF-1 antibody, which also recognizes CREM and CREB-1 (Santa Cruz sc-270). In fact, incubation with this antibody resulted in the shift
Fig. 3. Binding of the CREB/ATF proteins to the proximal brca2 promoter. EMSA was performed with nuclear extracts derived from F9 cells and NMuMg cells, and with a 32 P-labeled double-strand oligonucleotide corresponding to position )60 to position )25 and encompassing the CRE (lanes 1–3). Lane 4 corresponds to the same experiment with the )60 to )25 probe mutated at the position of the CRE. The excess of an unlabeled double-strand oligonucleotide either corresponding to the same oligonucleotide used for the probe (CRE brca2 oligo: lane 2) or mutated in the CRE (CRE-mutated brca2 oligo: lane 3) was added. The binding reaction was performed with the same nuclear extracts and the same )60 to )25 probe (WT), and incubated with an antibody raised against a Flag epitope (Irrelevant antibody) and against ATF-1 which recognizes ATF-1, CREM, and CREB-1 factors (anti-ATF-1: lane 6). The positions of the specific CREBcomplexes are indicated by arrows and the asterisk corresponds to the supershift.
of the three upper complexes observed in the F9 cells and most of the upper complex observed in NMuMg cells (Fig. 3, lane 6). When an irrelevant antibody against a Flag epitope was used no supershift was obtained (Fig. 3, lane 5). These results clearly indicate that the transcription factors binding to the minimal mouse brca2 promoter on the CRE site consist of homo/heterodimers containing at least ATF-1, CREM, and/or CREB-1. To further confirm the role of CREB family proteins in the regulation of the brca2 promoter, we used an expression vector expressing a specific negative dominant for these factors. This negative dominant is a mutated CREB protein which forms heterodimers with CREB-1, ATF-1 or CREM but prevents the binding of the complexes to DNA [24]. Coexpression of this negative dominant strongly reduced the promoter activity and the observed effect was dose-dependent. Interestingly, at the higher dose used, the reduction in activity was roughly similar to that obtained with the CREmutated reporter construct whose activity was unaffected by the negative dominant (Fig. 4A). This effect was also observed in other CRE promoter constructs (data not shown), whereas the transcriptional activity
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
705
Fig. 5. Chromatin immunoprecipitation (ChIP) shows that CREB/ ATF1 can target the brca2 proximal promoter in NMuMg cells. The crosslinked chromatin was immunoprecipitated using either an antiATF1 antibody (lane 4), an anti-Flag antibody used as negative control (lane 3) or the beads only (lane 2). The purified DNA was amplified by PCR using primers that encompassed the region of the mouse brca2 promoter previously shown to bind CREB/ATF1 ()149 vs start site to +38). Non-immunoprecipitated chromatin was used as positive control (lane 1). The PCRs were separated by electrophoresis on a 2% agarose gel.
Fig. 4. Effect of a CREB-negative dominant on the brca2 promoter regulation. (A) One hundred nanograms of the )148 to +38 bp brca2 promoter construct (black box) or of the promoter construct mutated in the CRE (white box) was cotransfected in F9 cells with increasing amounts (0, 10, and 50 ng) of a vector expressing a negative dominant specific to the ATF-1, CREM, and CREB-1 factors. (B) One hundred nanograms of the TORU promoter construct lacking a CRE was cotransfected as in A. The data on the luciferase activity have been collected together and are presented as in legend to Fig. 1. (C) EMSA using the double-strand )60 to )25 brca2 oligonucleotide as a probe and nuclear extracts from F9 cells transfected with 100 ng of the pCMV vector (lane 1), or the pCMV-CREB negative dominant vector (lane 2). The positions of the specific CREB-complexes are indicated by arrows.
of the TORU reporter system, which does not contain a CRE [25], was not influenced by this negative dominant mutant (Fig. 4B). To appreciate the mechanism of action of this mutant on the brca2 promoter activity we analyzed its effect on binding reactions. EMSA were performed with nuclear extracts from F9 cells transfected with the expression vector for the CREB-1 negative dominant. We present here the data obtained on the F9 cells, while these latter present a very high level of transfection (>90%). Expression of the mutated protein completely eliminated the three complexes previously identified as CREB-specific complexes (Fig. 4C). We finally asked whether these three transcription factors could be recruited in vivo to the brca2 promoter. To test this, we performed a chromatin immunoprecipitation experiment (ChIP) on NMuMg cells. For this purpose, we used primers encompassing the CRE previously identified in the proximal brca2 promoter region. Fig. 5 (lane 4) shows that ATF-1, CREM, and/or CREB-1 bind to the brca2 promoter in vivo. This binding is specific as immunoprecipitation of the crosslinked chromatin in the absence of antibody (lane 2) or with an irrelevant antibody (lane 3) did not give any significant signal (Fig. 5).
Altogether, these results propose an important role for the ATF-1, CREM, and/or CREB-1 transcription factors in the transcriptional control of the minimal mouse brca2 promoter.
Discussion Since brca2 is one of the two characterized genes that are responsible for most hereditary breast cancers, several studies have attempted to define a role for brca2 in the development of sporadic ones [14]. It has been found that brca2 is significantly over-expressed in many sporadic tumors, and one possible mechanism could be linked to the up-regulated expression of this gene [19]. Thus, the characterization of the elements that regulate the brca2 promoter is of crucial interest to a better understanding of how this change in expression occurs at the molecular level. In a previous report we described the structure of the mouse brca2 gene and identified a region of 148 bp upstream of the first exon, which is sufficient to activate the transcription in mammary cells [23]. Here, we demonstrated that a 52 bp fragment located between )92 and )40 bp is essential for the promoter activity. In fact, the deletion of this region dramatically reduced the transcription of the brca2 promoter. The CRE motif TGACGTCA in the mouse brca2 promoter we have identified is a perfect palindromic consensus sequence for the ATF/CREB subfamily of transcription factors belonging to the B-zip family [26]. Mutation of this motif dramatically reduced the promoter activity in each of the cell lines tested. Supershift assays demonstrated that all CRE-specific complexes consisted of homo- or heterodimers comprising at least the ATF-1, the CREM, and/or the CREB-1 transcription factors. These data have been reinforced by chromatin immunoprecipitation with the same antibody, thus indicating that ATF-1, CREM, and/or CREB-1 bind to this CRE in the context of
706
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
cellular chromatin. The importance of these factors on the mouse brca2 promoter activity was confirmed by the use of a specific negative dominant. The members of the CREB/ATF family are known to be activated by phosphorylation on specific serine residues [27]. This post-translational modification is essential for the interaction between these factors and the cofactor CBP. Since gene regulation mediated by the recruitment of CBP is repressed by the adenovirus 12S E1A oncoprotein [28], we have expressed the E1A protein in cells transfected with the miminal brca2 promoter construct. However, the expression of E1A was not efficient on the transcriptional activity of this promoter (data not shown). In the context of the mouse brca2 promoter, it is possible that, when functional, the CRE is activated in a constitutive manner via an interaction between the CREB factors and the proteins of the basal transcriptional apparatus [29,30]. However, it has been reported that CREB family members could activate transcription via cofactors other than CBP. In the testis, the activation of CREM is independent of CBP and bypasses the need for phosphorylation, via an interaction with another cofactor, ACT [31]. In the present work we have identified a functional CRE within the brca2 promoter by using the point mutation approach, but the over-expression of CREB factors did not activate its transcription (data not shown). It must be noted that the basal level of expression of the brca2 promoter is very high in all the cells used and the inability of exogenous CREB-1, CREM or ATF-1 to transactivate this promoter may be due to sufficient endogenous quantity of these factors in these cell lines. Similar observations have also been made in the case of the human brca1 promoter [32,33], as well as the human brca2 promoter with the Ets transcription factor Elf-1 and the USF-1 transcription factor [20]. The present data showing the role of CREB transcription factors in the regulation of the mouse brca2 gene have been obtained on the proximal promoter of this gene. Then, further experiments on the distal region of this promoter, which has been shown to dramatically down-regulate its transcription [23], should now be envisaged.
Experimental procedure Reporter and expression plasmids. The pGL3-basic reporter vectors (Promega) containing the )814 to +38 bp or the )148 to +38 bp of the mouse brca2 promoter had been described earlier [23]. The )92 to +38 bp and )40 to +38 bp fragments were obtained by PCR using the pGL3 plasmid containing the )148 to +38 bp fragment as a template with the same reverse primer 50 -TCCCGCAGCGGTAGCTGACTG ACG-30 . The forward primers were 50 -TGCGCTGACTTCCCG GTGGCACTCGCGCCGCGTCC-30 for the )92 to +38 bp fragment and 50 -GTCCCCGTCGCGGGGTCATCTCGAGACGGGCAGAG-
30 for the )40 to +38 bp fragment. The fragments were inserted into the pCRII-Topo vector (Invitrogen) and sequenced. Using the KpnI and/ or XhoI restriction sites, the fragments were subcloned in sense orientation into the pGL3-basic vector. The CRE mutant (at position )41) was introduced by PCR into the )814 to + 38 bp and )148 to +38 bp pGL3 reporter plasmids with the following mutations: 45 GTCATGACGTCA 33 C replaced by 45 GTCAT ctCGagA33 C. All the constructs were sequenced. Details of the cloning are available upon request. The pCMV-500-4HEP-CREBLZ expressing a dominant negative of CREB1, ATF-1, and CREM was kindly provided by Dr. A. Orosz (Laboratory of Metabolism, NCI, NHI). The pSG-CREB2 and pSVCREMs plasmids expressing CREB and CREM, respectively, were supplied by Dr. Luc Willems and Richard Kettmann (Faculty of Agronomy, Gembloux, Belgium) and Dr. Paolo Sasonne-Corsi (IGBMC, Strasbourg, France). The pSG5-bGal vector was used for transfection normalization. Cell culture and transfection. NIH3T3, HC11, NMuMg, and F9 cells were routinely maintained in Dulbecco’s medium (Gibco) with 10% fetal calf serum (supplemented with 4 lg/ml insulin for the NMuMg cells) at 37 °C in a water-saturated 5% CO2 atmosphere. Transient transfection experiments were performed using the PEI Exgen 500 procedure (Euromedex, France) with a total of 350 ng DNA and 2 ll PEI per 21-mm diameter dish as previously described [23]. To monitor transfection efficiency assays were normalized to the b-galactosidase activity of the pSG5-bGal vector, which was simultaneously transfected into the cells. The cells were scraped 24 h after transfection, and luciferase and b-galactosidase expressions were measured. All experiments were performed at least three times and in duplicate with at least two different plasmid preparations. Electrophoretic mobility shift assay. Nuclear extracts of NIH3T3, HC11, and F9 cells were prepared as described [34]. Ten micrograms of nuclear extracts was used in a gel retardation reaction with 20.000 cpm of a double-strand 32 P-labeled brca2 promoter oligonucleotide in the presence of 50 mM Hepes, pH 7.9; 100 mM KCl; 10 mM MgCl2 ; 1 mM EDTA; 20% glycerol; 10 mM DTT, and 2.5 lg salmon sperm DNA. The mixture was incubated for 1 h at room temperature and loaded onto a 7% polyacrylamide gel. The probe used was 50 -GTCCCCGTC GCGGGGTCATGACGTCACGGGC AGAG-30 . In the competition experiments the reactions contained a 400-fold molar excess of unlabeled double-strand oligonucleotides. The oligomer competitors used were 50 -GTCCCCGTCGCGGGGTCATGACGTCACGGGCAGA G-30 (CRE brca2 oligonucleotide), 50 -GT CCCCGTCGCGGGGTC ATctCGagACGGGCAGAG -30 (CRE-mutated brca2 oligonucleotide), 50 -AGAGA TTGCCTGACGTCAGAGAGCTAG-30 (CRE oligonucleotide), and 50 -AGAGATTGCCTGtgGTCAGAGAGCT AG-30 (CRE-mutated oligonucleotide). Specific antibodies for CREB transcription factors were purchased from Santa Cruz. DNA–protein complexes were resolved by native PAGE in 0.5 Tris borate–EDTA buffer for 3 h at 180 V. The gels were dried and exposed to film at )80 °C. Chromatin immunoprecipitation. Detection of promoter-bound CREB/ATF proteins in NMuMg cells was assessed by chromatin immunoprecipitation (ChIP) assays, essentially as described previously [35], except that the chromatin purification step on CsCl gradient was omitted. The chromatin was sonicated in order to obtain fragments of approximately 600 bp in length. CREB/ATF1-containing complexes were immunoprecipitated using the anti-ATF-1 (Santa Cruz Biotechnology, SC-270) antibody. An antibody against the FLAG epitope (Santa Cruz Biotechnology, Catalog No. SC-807) was used as a negative control. Immunoprecipitations were analyzed by PCR for the presence of the mouse brca2 proximal promoter region using primer pairs at positions (ChIP) 149 bp 50 -GAATTCGGCTGGGGATGG GCGAGCACATGCTAGC-30 vs start site to +38 (50 -TCCCGCAG CGGTAGCTGACTGACGGCAACGC CTCA-30 . The cycle number and the amount of template were designed to ensure that results were within the linear range of the PCR.
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
Acknowledgments N.C. holds a “Televie” grant (FNRS, Belgium) and is the recipient of a Van Buuren Foundation award. M.S. is supported by grants from the “Carlsberg Foundation,” the “Lundbeck Foundation,” and the “Danish Research Council.” This work has been carried out on the basis of grants awarded by the “Centre National de la Recherche Scientifique” (CNRS, France), the “Institut Pasteur de Lille,” the “Association pour la Recherche contre le Cancer” (France), the “Fonds National de la Recherche Scientifique” (FNRS, Belgium), and the “Action de Recherche Concertee (Communaute Francßaise de Belgique)” (Belgium).
References [1] R. Wooster, G. Bignell, J. Lancaster, S. Swift, S. Seal, J. Mangion, N. Collins, S. Gregory, C. Gumbs, G. Micklem, Nature 378 (1995) 789–792. [2] H. Takahashi, K. Behbakht, P.E. McGovern, H.C. Chiu, F.J. Couch, B.L. Weber, L.S. Friedman, M.C. King, M. Furusato, V.A. LiVolsi, et al., Cancer Res. 55 (1995) 2998–3002. [3] H. Takahashi, H.C. Chiu, C.A. Bandera, K. Behbakht, P.C. Liu, F.J. Couch, B.L. Weber, V.A. LiVolsi, M. Furusato, B.A. Rebane, A. Cardonick, I. Benjamin, M.A. Morgan, S.A. King, J.J. Mikuta, S.C. Rubin, J. Boyd, Cancer Res. 56 (1996) 2738–2741. [4] J.V. Rajan, M. Wang, S.T. Marquis, L.A. Chodosh, Proc. Natl. Acad. Sci. USA 93 (1996) 13078–13083. [5] J.P. Vaughn, P.L. Davis, M.D. Jarboe, G. Huper, A.C. Evans, R.W. Wiseman, A. Berchuck, J.D. Iglehart, P.A. Futreal, J.R. Marks, Cell Growth Differ. 7 (1996) 711–715. [6] T.F. Lane, C. Deng, A. Elson, M.S. Lyu, C.A. Kozak, P. Leder, Genes Dev. 9 (1995) 2712–2722. [7] J.V. Rajan, S.T. Marquis, H.P. Gardner, L.A. Chodosh, Dev. Biol. 184 (1997) 385–401. [8] L.Y. Marmorstein, T. Ouchi, S.A. Aaronson, Proc. Natl. Acad. Sci. USA 95 (1998) 13869–13874. [9] F. Fuks, J. Milner, T. Kouzarides, Oncogene 17 (1998) 2531– 2534. [10] R. Mizuta, J.M. LaSalle, H.L. Cheng, A. Shinohara, H. Ogawa, N. Copeland, N.A. Jenkins, M. Lalande, F.W. Alt, Proc. Natl. Acad. Sci. USA 94 (1997) 6927–6932. [11] A.R. Venkitaraman, Cell 108 (2002) 171–182. [12] A.R. Venkitaraman, Curr. Opin. Cell Biol. 13 (2001) 338–343. [13] K.J. Patel, V.P. Yu, H. Lee, A. Corcoran, F.C. Thistlethwaite, M.J. Evans, W.H. Colledge, L.S. Friedman, B.A. Ponder, A.R. Venkitaraman, Mol. Cell 1 (1998) 347–357.
707
[14] U. Hamann, C. Herbold, S. Costa, E.F. Solomayer, M. Kaufmann, G. Bastert, H.U. Ulmer, H. Frenzel, D. Komitowski, Cancer Res. 56 (1996) 1988–1990. [15] J.M. Lancaster, R. Wooster, J. Mangion, C.M. Phelan, C. Cochran, C. Gumbs, S. Seal, R. Barfoot, N. Collins, G. Bignell, S. Patel, R. Hamoudi, C. Larsson, R.W. Wiseman, A. Berchuck, J.D. Iglehart, J.R. Marks, A. Ashworth, M.R. Stratton, P.A. Futreal, Nat. Genet. 13 (1996) 238–240. [16] Y. Miki, T. Katagiri, F. Kasumi, T. Yoshimoto, Y. Nakamura, Nat. Genet. 13 (1996) 245–247. [17] D.H. Teng, R. Bogden, J. Mitchell, M. Baumgard, R. Bell, S. Berry, T. Davis, P.C. Ha, R. Kehrer, S. Jammulapati, Q. Chen, K. Offit, M.H. Skolnick, S.V. Tavtigian, S. Jhanwar, B. Swedlund, A.K. Wong, A. Kamb, Nat. Genet. 13 (1996) 241–244. [18] N. Collins, R. Wooster, M.R. Stratton, Br. J. Cancer 76 (1997) 1150–1156. [19] I. Bieche, C. Nogues, R. Lidereau, Oncogene 18 (1999) 5232–5238. [20] P.L. Davis, A. Miron, L.M. Andersen, J.D. Iglehart, J.R. Marks, Oncogene 18 (1999) 6000–6012. [21] K. Wu, S.W. Jiang, M. Thangaraju, G. Wu, F.J. Couch, J. Biol. Chem. 275 (2000) 35548–35556. [22] K. Wu, S.W. Jiang, F.J. Couch, J. Biol. Chem. 278 (2003) 15652– 15660. [23] N. Callens, M. Dumont, A. Begue, C. Lint, J.L. Baert, J. Simard, Y. de Launoit, Mamm. Genome 13 (2002) 352–358. [24] S. Ahn, M. Olive, S. Aggarwal, D. Krylov, D.D. Ginty, C. Vinson, Mol. Cell. Biol. 18 (1998) 967–977. [25] M.P. Laget, P.A. Defossez, O. Albagli, J.L. Baert, F. Dewitte, D. Stehelin, Y. de Launoit, Oncogene 12 (1996) 1325–1336. [26] T. Hai, M.G. Hartman, Gene 273 (2001) 1–11. [27] D. De Cesare, G.M. Fimia, P. Sassone-Corsi, Trends Biochem. Sci. 24 (1999) 281–285, 287_00001414 00001417_000001414. [28] Z. Arany, D. Newsome, E. Oldread, D.M. Livingston, R. Eckner, Nature 374 (1995) 81–84. [29] E.A. Felinski, P.G. Quinn, J. Biol. Chem. 274 (1999) 11672– 11678. [30] E.A. Felinski, P.G. Quinn, Proc. Natl. Acad. Sci. USA 98 (2001) 13078–13083. [31] G.M. Fimia, D. De Cesare, P. Sassone-Corsi, Nature 398 (1999) 165–169. [32] E. Atlas, M. Stramwasser, C.R. Mueller, Oncogene 20 (2001) 7110–7114. [33] E. Atlas, M. Stramwasser, K. Whiskin, C.R. Mueller, Oncogene 19 (2000) 1933–1940. [34] N.C. Andrews, D.V. Faller, Nucleic Acids Res. 19 (1991) 2499. [35] Y. Takahashi, J.B. Rayman, B.D. Dynlacht, Genes Dev. 14 (2000) 804–816.
Transcriptional regulation of the murine brca2 gene by CREB/ATF transcription factors Nathalie Callens,a,b Jean-Luc Baert,a Didier Monte,a Morten Sunesen,c Carine Van Lint,d and Yvan de Launoita,b,* a
UMR 8117 CNRS, Institut Pasteur de Lille, Universit e de Lille 1, Institut de Biologie de Lille, BP 447, 1 rue Calmette, 59021 Lille Cedex, France Laboratoire de Virologie Mol eculaire, Facult e de M edecine, Universit e Libre de Bruxelles, CP 614, 808 route de Lennik, 1070 Brussels, Belgium c Laboratoire de Neurobiologie Mol eculaire, Room 1008, Institut Pasteur, 25, Rue du Dr Roux, 75724 Paris Cedex, 15, France d Laboratoire de Chimie Biologique, D epartement de Biologie Mol eculaire, Institut de Biologie et de M edecine Mol eculaires, Facult e des Sciences, Universit e Libre de Bruxelles, Rue des Professeurs Jeener et Brachet 12, Gosselies 6041, Belgium
b
Received 20 October 2003
Abstract The brca2 gene encodes a nuclear protein which is mainly involved in DNA repair and, when mutated, is responsible for some of the hereditary breast cancers. However, brca2 expression is also deregulated in sporadic breast tumors. In the mouse brca2 gene we had earlier identified a region of 148 bp upstream of the transcription start site sufficient to activate its expression. In the present report, we show that the )92 to )40 bp region is essential for the transcription of brca2 in murine mammary cells and that this nucleotide sequence contains one putative CREB/ATF consensus site (cAMP responsive element: CRE). We demonstrated that the mutation of this binding site led to a highly significant reduction of the mouse brca2 transcription, and that CREB, CREM, and/or ATF-1 functionally bound to and regulated this promoter. Therefore, the regulation of the promoter of the mouse brca2 gene is driven by this family of transcription factors. Ó 2003 Published by Elsevier Inc. Keywords: brca2; Promoter; Transcription; Mouse; Mammary
Germinal mutations in the human BRCA1 and BRCA2 genes are believed to be responsible for most hereditary breast cancers, which account for 5–10% of all breast cancer cases [1–3]. Both genes are up-regulated in proliferating and differentiating cells, expressed in a cell cycle-dependent manner peaking at the G1/S boundary [4,5] and widely expressed during development [6,7]. The human BRCA2 gene is composed of 27 exons and encodes a nuclear protein of 3418 residues possessing no obvious homology to any known protein [1]. In accord with a function in transcriptional regulation, BRCA2 interacts directly with P53 and P/CAF proteins, a fact which indicates a function as a transcriptional cofactor [8,9]. Of crucial importance is the fact that BRCA2 interacts with RAD51 [10–12]. RAD51 * Corresponding author. Fax: +32-25-55-62-57. E-mail address: [email protected] (Y. de Launoit).
0006-291X/$ - see front matter Ó 2003 Published by Elsevier Inc. doi:10.1016/j.bbrc.2003.10.176
is the eukaryotic homologous of the bacterial RecA protein, which has a pivotal activity in meiotic and mitotic recombination, DNA double-strand break repairing, and chromosome segregation. Highly interestingly brca2= cells develop gross chromosomal abnormalities such as spontaneous double-strand breaks and tri-radial and quadri-radial structures, which are well-described characteristics of a malfunctioning DNA repair system [10,13]. The mutations observed in hereditary breast cancers associated to the BRCA2 gene are mostly non-sense mutations leading to the production of truncated proteins. However, several studies have attempted to define a role for BRCA2 in the development of sporadic breast cancers [14]. A loss of heterozygosity in the BRCA2 locus has been detected in over 50% of sporadic breast tumors, although neither the alteration of the coding sequence [15–17] nor promoter
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
methylation has been found in these tumors [18]. Since BRCA2 is significantly over-expressed in many sporadic tumors, one possible mechanism of BRCA2 involvement in sporadic breast cancers could be the deregulation of the expression of the BRCA2 gene [19]. However, it is not known whether this over-expression is due to the induction of the BRCA2 promoter or simply reflects an increase in the number of cells in the S phase. Studies of the transcriptional regulation of the human BRCA2 promoter have revealed that a cellcycle-dependent expression is associated with the binding of both the upstream stimulatory factor (USF) protein and the Ets transcription factor Elf-1 [20]. Moreover, the nuclear factor-jB (NF-jB) [21] and USF [22] also bind to the human BRCA2 promoter and regulate it. At the present time, few data are available on the mouse brca2 promoter. We had earlier identified a region of 148 bp upstream of the first exon which is sufficient to activate the transcription of the brca2 gene in murine mammary cells [23]. In this report, we showed that the )92 to )40 bp region is essential for the positive regulation of the mouse brca2 transcription, and the nucleotide sequence revealed one putative CREB/ATF consensus site (cAMP responsive element: CRE). We showed that this site is essential for the activity of the minimal promoter and we identified CREB, CREM, and/or ATF-1 that functionally bind and regulate this promoter.
Results Identification of the minimal mouse brca2 promoter We had earlier localized the transcription start site of the mouse brca2 gene at approximately 300 bp upstream of the translation initiation codon. We initiated studies on the transcriptional promoter region and identified the first 148 bp as sufficient to drive the transcriptional activity of the mouse brca2 gene in the mammary cells tested [23]. In order to narrow down this promoter region to a minimal sequence, we constructed 50 -deleted mutants and tested their transcriptional activity on NIH3T3, HC11, NMuMg, and F9 mouse cells by luciferase reporter gene assays. The promoter region displayed high levels of transcriptional activity in all these cell lines (data not shown) and as illustrated for the NMuMg cells in Fig. 1, the transcriptional activity of the longer construct used ()814 to +38 bp: 100% activity) is higher than the activity of the SV40 virus promoter (pSV2-luc). The )148 to +38 bp and the )92 to +38 bp constructs retained 88% and 84%, respectively, of the transcriptional activity. In contrast, the construct lacking the region between )92 and )41 bp ()40 to +38 bp con-
703
Fig. 1. Effect of deletions on the transcriptional activity of the mouse brca2 promoter. Constructs containing 50 -deletion mutants linked to the reporter luciferase gene (shown on the left) were tested for transcriptional activity (shown on the right) after transfection into murine NMuMg cells. The end points of the fragments are indicated relative to the transcription start site. The black boxes represent the first 38 bp of the first exon. The transcriptional activity was quantified as luciferase activity and is indicated as a percentage of the longer construct activity ()814 to +38 bp construct ¼ 100%). The data shown are means SEM of five independent experiments. Each transfection condition was performed in duplicate and normalized with the dosage of b-galactosidase expressed by the pSG5-bGal plasmid. The data obtained on the pGL3-basic and the pSV2-luc reporters are also presented.
struct) displayed a critical reduction down to the basal level represented here by the pGL3-basic activity. Similar results were obtained in the three other cell lines (data not shown). On this basis, we defined the region between )92 and +38 bp as the minimal promoter of the mouse brca2 gene, with a critical sequence lying between )92 and )40 bp. The analysis of this sequence revealed putative transcription factor binding motifs. In particular, there was a perfect consensus CREB responsive element (CRE) sequence at position )41 bp. A perfect CRE site is a palindromic sequence (TGACGTCA) recognized by the transcription factors from the CREB/ ATF family. The CRE is important for the brca2 promoter activity Point mutations were introduced into the )148 to +38 bp and the )814 to +38 bp constructs (Fig. 2) to define the contribution of this binding motif. The mutation of the CRE in the NMuMg cells resulted in a high loss of promoter activity by 89% and 95% for the )148 to +38 bp and the )814 to +38 bp constructs, respectively. In the F9 cells, the CRE mutation resulted in a 98–99% transcriptional reduction. Similar results have been obtained from NIH3T3 and HC11 murine mammary cells (data not shown). Thus, we propose that the CRE drives the transcriptional activity of the mouse brca2 promoter.
704
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
Fig. 2. Contribution of the putative CRE to the transcriptional activity of the proximal mouse brca2 promoter. The transcriptional activity of the mutated CRE construct was compared to the transcriptional activity of the wild type construct (100%) after transient transfection into NMuMg cells (black box) and F9 cells (white box). The mutations were introduced into the )148 to +38 bp of the brca2 proximal promoter construct and into the )814 to +38 bp promoter construct. The luciferase activity data have been collected together and are presented as in the legend to Fig. 1.
Identification of the CREB/ATF transcription factors binding to the CRE In order to determine whether the transcription factors from the CREB/ATF family were able to bind specifically to the CRE motif we performed electrophoretic mobility shift assays (EMSA) using a labeled double-strand oligonucleotide containing the CRE and nuclear extracts from different murine cell lines (NIH3T3, HC11, NMuMg, and F9 cells). Four protein– DNA complexes were detected in the murine F9 nuclear extracts (Fig. 3, lane 1). The introduction of an excess of an unlabeled oligonucleotide identical to the probe induced the disappearance of all of the complexes (Fig. 3, lane 2). In contrast, excess of an oligonucleotide specifically mutated at the CRE site did not affect the complexes identified (Fig. 3, lane 3). When this mutated oligonucleotide is used as probe, the three upper bands disappeared (Fig. 3, lane 4). In NMuMg cells, two protein–DNA complexes were detected (lane 1). When the CRE-mutated brca2 oligonucleotide was used as probe, only the upper broad band disappeared (Fig. 3, lane 4). These data suggest that, in both cell lines, the higher migrating band was non-specific. These results indicate that in F9 cells three complexes and in NMuMg cells one complex correspond to transcription factors which specifically bind to the CRE within the brca2 minimal promoter. To identify the members of the CREB/ATF transcription factor family which bind the minimal brca2 promoter we performed EMSA with antibodies raised against several of these factors. A supershift was observed with an anti-ATF-1 antibody, which also recognizes CREM and CREB-1 (Santa Cruz sc-270). In fact, incubation with this antibody resulted in the shift
Fig. 3. Binding of the CREB/ATF proteins to the proximal brca2 promoter. EMSA was performed with nuclear extracts derived from F9 cells and NMuMg cells, and with a 32 P-labeled double-strand oligonucleotide corresponding to position )60 to position )25 and encompassing the CRE (lanes 1–3). Lane 4 corresponds to the same experiment with the )60 to )25 probe mutated at the position of the CRE. The excess of an unlabeled double-strand oligonucleotide either corresponding to the same oligonucleotide used for the probe (CRE brca2 oligo: lane 2) or mutated in the CRE (CRE-mutated brca2 oligo: lane 3) was added. The binding reaction was performed with the same nuclear extracts and the same )60 to )25 probe (WT), and incubated with an antibody raised against a Flag epitope (Irrelevant antibody) and against ATF-1 which recognizes ATF-1, CREM, and CREB-1 factors (anti-ATF-1: lane 6). The positions of the specific CREBcomplexes are indicated by arrows and the asterisk corresponds to the supershift.
of the three upper complexes observed in the F9 cells and most of the upper complex observed in NMuMg cells (Fig. 3, lane 6). When an irrelevant antibody against a Flag epitope was used no supershift was obtained (Fig. 3, lane 5). These results clearly indicate that the transcription factors binding to the minimal mouse brca2 promoter on the CRE site consist of homo/heterodimers containing at least ATF-1, CREM, and/or CREB-1. To further confirm the role of CREB family proteins in the regulation of the brca2 promoter, we used an expression vector expressing a specific negative dominant for these factors. This negative dominant is a mutated CREB protein which forms heterodimers with CREB-1, ATF-1 or CREM but prevents the binding of the complexes to DNA [24]. Coexpression of this negative dominant strongly reduced the promoter activity and the observed effect was dose-dependent. Interestingly, at the higher dose used, the reduction in activity was roughly similar to that obtained with the CREmutated reporter construct whose activity was unaffected by the negative dominant (Fig. 4A). This effect was also observed in other CRE promoter constructs (data not shown), whereas the transcriptional activity
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
705
Fig. 5. Chromatin immunoprecipitation (ChIP) shows that CREB/ ATF1 can target the brca2 proximal promoter in NMuMg cells. The crosslinked chromatin was immunoprecipitated using either an antiATF1 antibody (lane 4), an anti-Flag antibody used as negative control (lane 3) or the beads only (lane 2). The purified DNA was amplified by PCR using primers that encompassed the region of the mouse brca2 promoter previously shown to bind CREB/ATF1 ()149 vs start site to +38). Non-immunoprecipitated chromatin was used as positive control (lane 1). The PCRs were separated by electrophoresis on a 2% agarose gel.
Fig. 4. Effect of a CREB-negative dominant on the brca2 promoter regulation. (A) One hundred nanograms of the )148 to +38 bp brca2 promoter construct (black box) or of the promoter construct mutated in the CRE (white box) was cotransfected in F9 cells with increasing amounts (0, 10, and 50 ng) of a vector expressing a negative dominant specific to the ATF-1, CREM, and CREB-1 factors. (B) One hundred nanograms of the TORU promoter construct lacking a CRE was cotransfected as in A. The data on the luciferase activity have been collected together and are presented as in legend to Fig. 1. (C) EMSA using the double-strand )60 to )25 brca2 oligonucleotide as a probe and nuclear extracts from F9 cells transfected with 100 ng of the pCMV vector (lane 1), or the pCMV-CREB negative dominant vector (lane 2). The positions of the specific CREB-complexes are indicated by arrows.
of the TORU reporter system, which does not contain a CRE [25], was not influenced by this negative dominant mutant (Fig. 4B). To appreciate the mechanism of action of this mutant on the brca2 promoter activity we analyzed its effect on binding reactions. EMSA were performed with nuclear extracts from F9 cells transfected with the expression vector for the CREB-1 negative dominant. We present here the data obtained on the F9 cells, while these latter present a very high level of transfection (>90%). Expression of the mutated protein completely eliminated the three complexes previously identified as CREB-specific complexes (Fig. 4C). We finally asked whether these three transcription factors could be recruited in vivo to the brca2 promoter. To test this, we performed a chromatin immunoprecipitation experiment (ChIP) on NMuMg cells. For this purpose, we used primers encompassing the CRE previously identified in the proximal brca2 promoter region. Fig. 5 (lane 4) shows that ATF-1, CREM, and/or CREB-1 bind to the brca2 promoter in vivo. This binding is specific as immunoprecipitation of the crosslinked chromatin in the absence of antibody (lane 2) or with an irrelevant antibody (lane 3) did not give any significant signal (Fig. 5).
Altogether, these results propose an important role for the ATF-1, CREM, and/or CREB-1 transcription factors in the transcriptional control of the minimal mouse brca2 promoter.
Discussion Since brca2 is one of the two characterized genes that are responsible for most hereditary breast cancers, several studies have attempted to define a role for brca2 in the development of sporadic ones [14]. It has been found that brca2 is significantly over-expressed in many sporadic tumors, and one possible mechanism could be linked to the up-regulated expression of this gene [19]. Thus, the characterization of the elements that regulate the brca2 promoter is of crucial interest to a better understanding of how this change in expression occurs at the molecular level. In a previous report we described the structure of the mouse brca2 gene and identified a region of 148 bp upstream of the first exon, which is sufficient to activate the transcription in mammary cells [23]. Here, we demonstrated that a 52 bp fragment located between )92 and )40 bp is essential for the promoter activity. In fact, the deletion of this region dramatically reduced the transcription of the brca2 promoter. The CRE motif TGACGTCA in the mouse brca2 promoter we have identified is a perfect palindromic consensus sequence for the ATF/CREB subfamily of transcription factors belonging to the B-zip family [26]. Mutation of this motif dramatically reduced the promoter activity in each of the cell lines tested. Supershift assays demonstrated that all CRE-specific complexes consisted of homo- or heterodimers comprising at least the ATF-1, the CREM, and/or the CREB-1 transcription factors. These data have been reinforced by chromatin immunoprecipitation with the same antibody, thus indicating that ATF-1, CREM, and/or CREB-1 bind to this CRE in the context of
706
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
cellular chromatin. The importance of these factors on the mouse brca2 promoter activity was confirmed by the use of a specific negative dominant. The members of the CREB/ATF family are known to be activated by phosphorylation on specific serine residues [27]. This post-translational modification is essential for the interaction between these factors and the cofactor CBP. Since gene regulation mediated by the recruitment of CBP is repressed by the adenovirus 12S E1A oncoprotein [28], we have expressed the E1A protein in cells transfected with the miminal brca2 promoter construct. However, the expression of E1A was not efficient on the transcriptional activity of this promoter (data not shown). In the context of the mouse brca2 promoter, it is possible that, when functional, the CRE is activated in a constitutive manner via an interaction between the CREB factors and the proteins of the basal transcriptional apparatus [29,30]. However, it has been reported that CREB family members could activate transcription via cofactors other than CBP. In the testis, the activation of CREM is independent of CBP and bypasses the need for phosphorylation, via an interaction with another cofactor, ACT [31]. In the present work we have identified a functional CRE within the brca2 promoter by using the point mutation approach, but the over-expression of CREB factors did not activate its transcription (data not shown). It must be noted that the basal level of expression of the brca2 promoter is very high in all the cells used and the inability of exogenous CREB-1, CREM or ATF-1 to transactivate this promoter may be due to sufficient endogenous quantity of these factors in these cell lines. Similar observations have also been made in the case of the human brca1 promoter [32,33], as well as the human brca2 promoter with the Ets transcription factor Elf-1 and the USF-1 transcription factor [20]. The present data showing the role of CREB transcription factors in the regulation of the mouse brca2 gene have been obtained on the proximal promoter of this gene. Then, further experiments on the distal region of this promoter, which has been shown to dramatically down-regulate its transcription [23], should now be envisaged.
Experimental procedure Reporter and expression plasmids. The pGL3-basic reporter vectors (Promega) containing the )814 to +38 bp or the )148 to +38 bp of the mouse brca2 promoter had been described earlier [23]. The )92 to +38 bp and )40 to +38 bp fragments were obtained by PCR using the pGL3 plasmid containing the )148 to +38 bp fragment as a template with the same reverse primer 50 -TCCCGCAGCGGTAGCTGACTG ACG-30 . The forward primers were 50 -TGCGCTGACTTCCCG GTGGCACTCGCGCCGCGTCC-30 for the )92 to +38 bp fragment and 50 -GTCCCCGTCGCGGGGTCATCTCGAGACGGGCAGAG-
30 for the )40 to +38 bp fragment. The fragments were inserted into the pCRII-Topo vector (Invitrogen) and sequenced. Using the KpnI and/ or XhoI restriction sites, the fragments were subcloned in sense orientation into the pGL3-basic vector. The CRE mutant (at position )41) was introduced by PCR into the )814 to + 38 bp and )148 to +38 bp pGL3 reporter plasmids with the following mutations: 45 GTCATGACGTCA 33 C replaced by 45 GTCAT ctCGagA33 C. All the constructs were sequenced. Details of the cloning are available upon request. The pCMV-500-4HEP-CREBLZ expressing a dominant negative of CREB1, ATF-1, and CREM was kindly provided by Dr. A. Orosz (Laboratory of Metabolism, NCI, NHI). The pSG-CREB2 and pSVCREMs plasmids expressing CREB and CREM, respectively, were supplied by Dr. Luc Willems and Richard Kettmann (Faculty of Agronomy, Gembloux, Belgium) and Dr. Paolo Sasonne-Corsi (IGBMC, Strasbourg, France). The pSG5-bGal vector was used for transfection normalization. Cell culture and transfection. NIH3T3, HC11, NMuMg, and F9 cells were routinely maintained in Dulbecco’s medium (Gibco) with 10% fetal calf serum (supplemented with 4 lg/ml insulin for the NMuMg cells) at 37 °C in a water-saturated 5% CO2 atmosphere. Transient transfection experiments were performed using the PEI Exgen 500 procedure (Euromedex, France) with a total of 350 ng DNA and 2 ll PEI per 21-mm diameter dish as previously described [23]. To monitor transfection efficiency assays were normalized to the b-galactosidase activity of the pSG5-bGal vector, which was simultaneously transfected into the cells. The cells were scraped 24 h after transfection, and luciferase and b-galactosidase expressions were measured. All experiments were performed at least three times and in duplicate with at least two different plasmid preparations. Electrophoretic mobility shift assay. Nuclear extracts of NIH3T3, HC11, and F9 cells were prepared as described [34]. Ten micrograms of nuclear extracts was used in a gel retardation reaction with 20.000 cpm of a double-strand 32 P-labeled brca2 promoter oligonucleotide in the presence of 50 mM Hepes, pH 7.9; 100 mM KCl; 10 mM MgCl2 ; 1 mM EDTA; 20% glycerol; 10 mM DTT, and 2.5 lg salmon sperm DNA. The mixture was incubated for 1 h at room temperature and loaded onto a 7% polyacrylamide gel. The probe used was 50 -GTCCCCGTC GCGGGGTCATGACGTCACGGGC AGAG-30 . In the competition experiments the reactions contained a 400-fold molar excess of unlabeled double-strand oligonucleotides. The oligomer competitors used were 50 -GTCCCCGTCGCGGGGTCATGACGTCACGGGCAGA G-30 (CRE brca2 oligonucleotide), 50 -GT CCCCGTCGCGGGGTC ATctCGagACGGGCAGAG -30 (CRE-mutated brca2 oligonucleotide), 50 -AGAGA TTGCCTGACGTCAGAGAGCTAG-30 (CRE oligonucleotide), and 50 -AGAGATTGCCTGtgGTCAGAGAGCT AG-30 (CRE-mutated oligonucleotide). Specific antibodies for CREB transcription factors were purchased from Santa Cruz. DNA–protein complexes were resolved by native PAGE in 0.5 Tris borate–EDTA buffer for 3 h at 180 V. The gels were dried and exposed to film at )80 °C. Chromatin immunoprecipitation. Detection of promoter-bound CREB/ATF proteins in NMuMg cells was assessed by chromatin immunoprecipitation (ChIP) assays, essentially as described previously [35], except that the chromatin purification step on CsCl gradient was omitted. The chromatin was sonicated in order to obtain fragments of approximately 600 bp in length. CREB/ATF1-containing complexes were immunoprecipitated using the anti-ATF-1 (Santa Cruz Biotechnology, SC-270) antibody. An antibody against the FLAG epitope (Santa Cruz Biotechnology, Catalog No. SC-807) was used as a negative control. Immunoprecipitations were analyzed by PCR for the presence of the mouse brca2 proximal promoter region using primer pairs at positions (ChIP) 149 bp 50 -GAATTCGGCTGGGGATGG GCGAGCACATGCTAGC-30 vs start site to +38 (50 -TCCCGCAG CGGTAGCTGACTGACGGCAACGC CTCA-30 . The cycle number and the amount of template were designed to ensure that results were within the linear range of the PCR.
N. Callens et al. / Biochemical and Biophysical Research Communications 312 (2003) 702–707
Acknowledgments N.C. holds a “Televie” grant (FNRS, Belgium) and is the recipient of a Van Buuren Foundation award. M.S. is supported by grants from the “Carlsberg Foundation,” the “Lundbeck Foundation,” and the “Danish Research Council.” This work has been carried out on the basis of grants awarded by the “Centre National de la Recherche Scientifique” (CNRS, France), the “Institut Pasteur de Lille,” the “Association pour la Recherche contre le Cancer” (France), the “Fonds National de la Recherche Scientifique” (FNRS, Belgium), and the “Action de Recherche Concertee (Communaute Francßaise de Belgique)” (Belgium).
References [1] R. Wooster, G. Bignell, J. Lancaster, S. Swift, S. Seal, J. Mangion, N. Collins, S. Gregory, C. Gumbs, G. Micklem, Nature 378 (1995) 789–792. [2] H. Takahashi, K. Behbakht, P.E. McGovern, H.C. Chiu, F.J. Couch, B.L. Weber, L.S. Friedman, M.C. King, M. Furusato, V.A. LiVolsi, et al., Cancer Res. 55 (1995) 2998–3002. [3] H. Takahashi, H.C. Chiu, C.A. Bandera, K. Behbakht, P.C. Liu, F.J. Couch, B.L. Weber, V.A. LiVolsi, M. Furusato, B.A. Rebane, A. Cardonick, I. Benjamin, M.A. Morgan, S.A. King, J.J. Mikuta, S.C. Rubin, J. Boyd, Cancer Res. 56 (1996) 2738–2741. [4] J.V. Rajan, M. Wang, S.T. Marquis, L.A. Chodosh, Proc. Natl. Acad. Sci. USA 93 (1996) 13078–13083. [5] J.P. Vaughn, P.L. Davis, M.D. Jarboe, G. Huper, A.C. Evans, R.W. Wiseman, A. Berchuck, J.D. Iglehart, P.A. Futreal, J.R. Marks, Cell Growth Differ. 7 (1996) 711–715. [6] T.F. Lane, C. Deng, A. Elson, M.S. Lyu, C.A. Kozak, P. Leder, Genes Dev. 9 (1995) 2712–2722. [7] J.V. Rajan, S.T. Marquis, H.P. Gardner, L.A. Chodosh, Dev. Biol. 184 (1997) 385–401. [8] L.Y. Marmorstein, T. Ouchi, S.A. Aaronson, Proc. Natl. Acad. Sci. USA 95 (1998) 13869–13874. [9] F. Fuks, J. Milner, T. Kouzarides, Oncogene 17 (1998) 2531– 2534. [10] R. Mizuta, J.M. LaSalle, H.L. Cheng, A. Shinohara, H. Ogawa, N. Copeland, N.A. Jenkins, M. Lalande, F.W. Alt, Proc. Natl. Acad. Sci. USA 94 (1997) 6927–6932. [11] A.R. Venkitaraman, Cell 108 (2002) 171–182. [12] A.R. Venkitaraman, Curr. Opin. Cell Biol. 13 (2001) 338–343. [13] K.J. Patel, V.P. Yu, H. Lee, A. Corcoran, F.C. Thistlethwaite, M.J. Evans, W.H. Colledge, L.S. Friedman, B.A. Ponder, A.R. Venkitaraman, Mol. Cell 1 (1998) 347–357.
707
[14] U. Hamann, C. Herbold, S. Costa, E.F. Solomayer, M. Kaufmann, G. Bastert, H.U. Ulmer, H. Frenzel, D. Komitowski, Cancer Res. 56 (1996) 1988–1990. [15] J.M. Lancaster, R. Wooster, J. Mangion, C.M. Phelan, C. Cochran, C. Gumbs, S. Seal, R. Barfoot, N. Collins, G. Bignell, S. Patel, R. Hamoudi, C. Larsson, R.W. Wiseman, A. Berchuck, J.D. Iglehart, J.R. Marks, A. Ashworth, M.R. Stratton, P.A. Futreal, Nat. Genet. 13 (1996) 238–240. [16] Y. Miki, T. Katagiri, F. Kasumi, T. Yoshimoto, Y. Nakamura, Nat. Genet. 13 (1996) 245–247. [17] D.H. Teng, R. Bogden, J. Mitchell, M. Baumgard, R. Bell, S. Berry, T. Davis, P.C. Ha, R. Kehrer, S. Jammulapati, Q. Chen, K. Offit, M.H. Skolnick, S.V. Tavtigian, S. Jhanwar, B. Swedlund, A.K. Wong, A. Kamb, Nat. Genet. 13 (1996) 241–244. [18] N. Collins, R. Wooster, M.R. Stratton, Br. J. Cancer 76 (1997) 1150–1156. [19] I. Bieche, C. Nogues, R. Lidereau, Oncogene 18 (1999) 5232–5238. [20] P.L. Davis, A. Miron, L.M. Andersen, J.D. Iglehart, J.R. Marks, Oncogene 18 (1999) 6000–6012. [21] K. Wu, S.W. Jiang, M. Thangaraju, G. Wu, F.J. Couch, J. Biol. Chem. 275 (2000) 35548–35556. [22] K. Wu, S.W. Jiang, F.J. Couch, J. Biol. Chem. 278 (2003) 15652– 15660. [23] N. Callens, M. Dumont, A. Begue, C. Lint, J.L. Baert, J. Simard, Y. de Launoit, Mamm. Genome 13 (2002) 352–358. [24] S. Ahn, M. Olive, S. Aggarwal, D. Krylov, D.D. Ginty, C. Vinson, Mol. Cell. Biol. 18 (1998) 967–977. [25] M.P. Laget, P.A. Defossez, O. Albagli, J.L. Baert, F. Dewitte, D. Stehelin, Y. de Launoit, Oncogene 12 (1996) 1325–1336. [26] T. Hai, M.G. Hartman, Gene 273 (2001) 1–11. [27] D. De Cesare, G.M. Fimia, P. Sassone-Corsi, Trends Biochem. Sci. 24 (1999) 281–285, 287_00001414 00001417_000001414. [28] Z. Arany, D. Newsome, E. Oldread, D.M. Livingston, R. Eckner, Nature 374 (1995) 81–84. [29] E.A. Felinski, P.G. Quinn, J. Biol. Chem. 274 (1999) 11672– 11678. [30] E.A. Felinski, P.G. Quinn, Proc. Natl. Acad. Sci. USA 98 (2001) 13078–13083. [31] G.M. Fimia, D. De Cesare, P. Sassone-Corsi, Nature 398 (1999) 165–169. [32] E. Atlas, M. Stramwasser, C.R. Mueller, Oncogene 20 (2001) 7110–7114. [33] E. Atlas, M. Stramwasser, K. Whiskin, C.R. Mueller, Oncogene 19 (2000) 1933–1940. [34] N.C. Andrews, D.V. Faller, Nucleic Acids Res. 19 (1991) 2499. [35] Y. Takahashi, J.B. Rayman, B.D. Dynlacht, Genes Dev. 14 (2000) 804–816.