Transcriptional regulation of the NADPH oxidase isoform, Nox1, in colon epithelial cells: Role of GATA-binding factor(s)

Free Radical Biology & Medicine 40 (2006) 260 – 274 www.elsevier.com/locate/freeradbiomed

Original Contribution

Transcriptional regulation of the NADPH oxidase isoform, Nox1, in colon epithelial cells: Role of GATA-binding factor(s) Alison C. Brewer *, Emma C. Sparks, Ajay M. Shah King’s College London, Department of Cardiology, GKT School of Medicine and Dentistry, New Medical School Building, Bessemer Road, London SE5 9PJ, UK Received 20 April 2005; revised 29 July 2005; accepted 13 August 2005 Available online 10 October 2005

Abstract Nonphagocytic NADPH oxidases (Noxs) are major sources of reactive oxygen species (ROS) and exist as a family of isoenzymes with tissuerestricted expression and functions. Nox1, expressed in colon epithelium and vascular smooth muscle, is suggested to be involved in innate immune defense and cell growth or proliferation. The transcriptional regulation of Nox1 appears to be particularly important in the modulation of its activity but the underlying mechanisms are unknown. Here we have identified the functional Nox1 promoter in human colon epithelial Caco-2 cells, and show that a 520-bp genomic fragment encompassing the CAP site is sufficient to direct high levels of expression of a linked reporter gene in these cells. Deletion analyses together with electrophoretic mobility-shift assays (EMSAs) suggest that maximal promoter activity is dependent on a GATA-binding site, conserved between human and mouse, within the proximal promoter region. The ability of mouse GATA factors to transactivate the Nox1 promoter was demonstrated in Cos-7 cells and site-directed mutagenesis of the conserved GATA-binding site further demonstrates that the regulation of Nox1 transcription is mediated by the direct binding of a GATA factor to the Nox1 proximal promoter. We also identified more distal, upstream regions which act to repress significantly expression from the Nox1 promoter. D 2005 Elsevier Inc. All rights reserved. Keywords: NADPH oxidase; Nox1; GATA-binding factors; Transcriptional regulation; Free radicals

Introduction The regulated production of reactive oxygen species (ROS, such as superoxide and hydrogen peroxide) by specialized enzymes plays a role in diverse processes including innate immune defense, oxygen sensing, and the modulation of redoxsensitive intracellular signal transduction pathways involved in cell growth, proliferation, and matrix remodeling [1 – 3]. The best example of an enzyme whose primary purpose is the generation of ROS is the phagocytic NADPH oxidase which comprises a membrane-bound cytochrome b 558 catalytic core, composed of one gp91phox and one p22phox subunit, and at least four cytosolic regulatory subunits (p47phox, p67phox, p40phox, and Rac) that translocate to the cytochrome to activate the enzyme [3,4]. More recently, it has been shown that the Abbreviations: ROS, reactive oxygen species; FCS, fetal calf serum: RTPCR, reverse transcriptase-polymerase chain reaction; RACE, rapid amplification of the cDNA ends; EMSA, electrophoretic mobility-shift assays; ds, double stranded. * Corresponding author. Fax: +44 207 346 4771. E-mail address: [email protected] (A.C. Brewer). 0891-5849/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.freeradbiomed.2005.08.022

expression of NADPH oxidase is not restricted to phagocytes, but is more widespread [5], and several homologues of gp91phox, termed Nox1-5 (with gp91phox = Nox2), have been identified, which are each encoded by separate genes and show distinctive tissue-restricted patterns of gene expression [6]. Thus it has now become clear that a family of superoxidegenerating NADPH oxidases is a major source of ROS in many diverse cell types. Nox1 is expressed in colon epithelium, prostate, uterus, and vascular smooth muscle [7,8], while low levels of gp91phox(Nox 2) have been detected in many cardiovascular cells [5] in addition to the high levels expressed in phagocytes. Nox3 is found in the inner ear and in fetal kidney [9,10] and Nox4, while first identified in the kidney [10], now appears to be widely expressed [11]. Finally Nox5 is found in spleen, sperm, and mammary glands [12]. The basic domain structure of Nox1 is similar to Nox2, being approximately 56% identical at the amino acid level [7]. However, its activation mechanisms differ significantly from those that are well established for Nox2. In particular, it has recently been determined that Nox1 normally binds to two novel regulatory proteins named NOXA1 and NOXO1, rather

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

than their analogues p67phox and p47phox, respectively [13 – 15]. Whereas the phosphorylation of p47phox and its subsequent binding to gp91phox-p22phox are key events in the activation of the phagocytic Nox2 oxidase, NOXO1 appears to be constitutively associated with Nox1 and does not require cell activation for this binding [16]. Rather, there are several lines of evidence to suggest that regulation at the level of gene transcription may be particularly important in the control of Nox1 activity. First, the overexpression of Nox1 alone in NIH 3T3 fibroblasts resulted in an increased constitutive production of both superoxide and hydrogen peroxide, while transfection of rat aortic vascular smooth muscle cells with antisense Nox1 resulted in a decrease in superoxide generation [7]. In addition, a large body of data implicates an increase in NADPH oxidasederived ROS, and corresponding significant increases in the levels of Nox1 mRNA, in vascular pathologies such as atherosclerosis and restenosis after angioplasty [4,17 –19]. The precise function(s) of Nox1, and Nox1-generated ROS, remain unclear. It has been suggested that within the colon epithelium Nox1 plays a role in host defense, analogous to that of Nox2 in phagocytes [8]. This idea is supported by both of the observations that an increase in the level of Nox1 mRNA is induced by the inflammatory mediator IFN-g and that Nox1 is activated by Type I Helicobacter pylori lipopolysaccharide through Toll-like receptor 4 [20,21]. Many studies, in a variety of cell types, have also implicated a role for Nox1 in cell growth and differentiation. Thus in vascular smooth muscle cells, Nox1 mRNA is strongly induced by growth factors which effect cellular hypertrophy, such as angiotensin II, platelet-derived growth factor, and prostaglandin F2a in association with an increase in oxidase activity [17,22]. By contrast, a forced decrease in Nox1 expression results in a reduction in the rate of serum-dependent growth [7]. Immortalized human keratinocytes display higher levels of Nox1 at proliferating, compared to quiescent confluent stages [23], and similarly, Nox1 oxidase activity was found to be higher in proliferating compared to confluent colon epithelial Caco-2 cells [24]. A correlation between Nox1-derived ROS and cellular transformation to a tumorigenic phenotype in certain fibroblast cell lines also initially suggested that increased Nox1 activity may be mitogenic [7,25]. More recent studies, however, have failed to confirm these results either in fibroblasts [3] or in a variety of tumor samples including colon carcinoma [20]. Nonetheless, Nox1 overexpression has been reported to increase growth and tumorigenicity of prostate epithelial cells [25], while a recent study has demonstrated that targeted inhibition of Nox1 expression suppresses Ras-induced transformation of fibroblast cells [26]. Thus while Nox 1 may not by itself be mitogenic, it can clearly mediate growth signals, and the close association between altered Nox1 expression and cell growth suggests a causal and functional relationship. An understanding of the molecular mechanisms that underlie the transcriptional regulation of Nox1 is essential in view of the importance of alterations of Nox1 mRNA expression in its activation, and would help to inform strategies to target increased Nox1 activity in, for instance, vascular

261

pathologies. In the present study, we have investigated the regulation of the Nox1 promoter in Caco-2 cells. We have identified the transcriptional initiation site of the human Nox1 gene in Caco-2 cells, and undertaken initial characterization of the regulatory elements within the promoter that mediate Nox1 expression in these cells. Materials and methods Chemicals and reagents Standard chemicals, custom-designed primers, culture medium, antibiotics, Glutamax, and trypsin were purchased from Sigma; fetal calf serum (FCS) from Invitrogen; and dihydroethidium from Molecular Probes. RNA isolation, cDNA preparation, and real-time reverse transcriptase (RT)-PCR Total RNA from cell cultures was isolated using the SV total RNA isolation kit (Promega), according to the manufacturer’s protocol. RNA was reverse-transcribed with AMV RT (Promega) according to the manufacturer’s instructions, using random decamers. Negative control reactions were also performed, omitting the RT. Relative levels of human or rat Nox1 mRNA were quantified by real-time RT-PCR using fluorescent SYBR Green technology on the ABI PRISM 7000 HT sequence detection system (Applied Biosystems). Levels of Nox1 transcripts were normalized to those of cytoskeletal h actin. Primers were designed using the Primer Express software (Applied Biosystems), applied to cDNA sequences derived from the National Center for Biotechnology Information (NCBI) web site (http://ncbi.nlm.nih.gov), and were as follows (all 5V– 3V): human Nox1 forward primer CACAAGAAAAATCCTTGGGTCAA, reverse primer GACAGCAGATTGCGACACACA; rat Nox1 forward primer GGCAAQ CCCCCTGAGTCTTG, reverse primer AGCGATAAAAGCGAAGGATCCT; human h actin forward primer CTGGCACCCAGCACAATG, reverse primer GCCGATCCACACQ GGAGTACT; rat h actin forward primer CGTGAAAAGATGACCCAGATCA, reverse primer TGGTACGACCAGAGGCATACAG; human GATA-4 forward primer TTTCCCCQ TTTGATTTTTGATCTTC, reverse primer AAAACGACGGCAACAACGA; human GATA-5 forward primer TGGGTTGGATGATACCTTAATGAGT, reverse primer CATCACCQ GGCCATTCACA; human GATA-6 forward primer GATTGTCCTGTGCCAACTGTCA, reverse primer GGTTCACCCTCGGCGTTT. The comparative C t method was used for relative quantification. The amount of Nox1 message, normalized to h-actin mRNA and relative to a calibrator, is given by 2 DDCt, where C t is the cycle number at which the fluorescent signal of the product crosses an arbitrary threshold, set within the exponential phase of the PCR, and DDC t = (C t Nox 1(unknown sample) C t h actin (unknown sample)) (C t Nox 1(calibrator sample) C t h actin (calibrator sample)). Validation experiments demonstrated that the efficiencies of the primers were approximately

262

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

equal and specific for their targets; thus the DDC t calculation for the relative quantification could be used without standard curves [27]. Mapping of 5V ends of mRNA transcripts The 5V ends of the human Nox1 transcript were amplified by rapid amplification of the cDNA ends (RACE) using the SMART RACE cDNA amplification kit according to the manufacturer’s instructions (Clontech). The double-stranded cDNAs were prepared from total RNA isolated from Caco-2 cells. Two gene-specific, reverse-nested primers were designed to the sequence of human Nox1 mRNA (again, derived from the NCBI web site), according to the parameters suggested in the user manual; (both 5V– 3V) CTGGAGAGAATGGAGGCAAGGG, and AGCCATCTGTGGCCTGTCGGCTTC. PCR products were analysed by agarose gel electrophoresis, cloned using the TA TOPO-II cloning kit (Invitrogen), and sequenced.

untranslated regions in a pUC 19 backbone was a kind gift of Louis Mahadevan. Full-length mouse GATA-4 and GATA-6 cDNAs were subcloned into the EcoRI or SpeI sites, respectively, of pEF pLINK II 4.9 to generate pLINK-G4 and pLINK-G6. The plasmids pcDNAG4 and pcDNAG5 in which the expression of full-length mouse GATA-4 and GATA-5 are directed by the CMV promoter within the pcDNA 3.1 vector (Invitrogen) were a kind gift of Edward Morrisey. Sequence comparisons Comparison of human (Accession Nos. Z83819) and mouse (Contig No. AL671915.8.1.171014; located on the Wellcome Trust Sanger Institute website, http://www.ensembl.org/Mus_ musculus/) Nox1 gene loci were carried out using the University of Wisconsin GCG suite of programs for molecular biology analysis.

Plasmid constructs

Cell culture and transient transfection assays

The Pac clone RP1-146H21 (Accession No. Z83819), which comprises the human Nox1 locus, was obtained from the Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire, CB10 1SA, UK. Using this as a template, putative Nox1 promoter fragments were generated by PCR, with Pfu DNA polymerase (Promega), using primers with suitable restriction enzyme sites incorporated into their 5V ends. In each case the 3V end of the cloned fragment remained constant at position +211 bp, relative to the most upstream CAP site (see Fig. 2A). The deletion constructs, 4722, 2798, 1275, 203, 102, and 2 bp were all subcloned into the XhoI-HindIII cloning sites, upstream of the luciferase gene, in the reporter vector, pGL3 Basic (Promega). The deletion construct 306 bp was generated by NheI digestion and subsequent recircularization of the 1275-bp deletion construct. The site specific mutant, 306 GATAmut, was generated by the splicing overlap extension PCR technique [28], with the following primers, to introduce the mutated GATA site: 5VAGAAACQ TTTAGCAAATCTTTAAAGTAGGAAGGCAATGCTTCACA 3V (F), 5VTGTGAAGCAQTTGCCTTCCTACTTTAAQ AGATTTGCTAAAGTTTCT 3V (R). (Mutant residues are marked in bold). Using the 306-bp construct as template, the two parts of the Nox1 promoter fragment were generated as PCR fragments using the forward and reverse primers above, together with GL primer 2 and RV primer 3 (Promega), respectively. In a second PCR step the complete, mutated genomic fragment was reassembled by amplifying the two PCR fragments using GL primer 2 and RV primer 3. This product was then digested with NheI and HindIII and inserted into similarly digested pGL3 Basic, to generate 306 GATAmut.

Caco-2, A7r5, and Cos-7 cells were obtained from the ECACC. All cell lines were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal calf serum, 20 mM l-glutamine, 100 U/ml of penicillin, and 100 mg/ml of streptomycin in 5% CO2. Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations. Caco-2 and Cos-7 cells at approximately 60 – 70% confluence in 6-cm dishes, containing 4 ml media, were incubated for 18 h with a constant amount of 8 Ag total DNA, including 400 ng reference plasmid, and 10 Al of Lipofectamine 2000, which had been preincubated for 20 min in 0.5 ml serum-free OPTIMEM (Invitrogen). Where a mouse GATA-factor-expressing plasmid was cotransfected, each reaction comprised 4 Ag test plasmid, 3.6 Ag GATA-expression plasmid (or empty vector control), and 400 ng reference plasmid. The cells were then lysed and asssayed for luciferase activity using the Dual-Glo Luciferase Assay System (Promega). The firefly luciferase activity, driven by the Nox1 promoter fragments, was normalized to the Renilla luciferase activity resulting from the cotransfected pRL-TK vector (Promega), in which activity is directed by the herpes simplex virus thymidine kinase promoter, to yield the relative luciferase activity (RLA). Each experiment, repeated in triplicate, was assayed at least in duplicate.

Mouse GATA factor expression plasmids The expression vector pEF pLINK II 4.9, which contains an EFIa promoter, and 5V and 3V flanking Xenopus h-globin

Electrophoretic mobility-shift assay (EMSA) Nuclear extracts were prepared from untransfected Caco-2 and Cos-7 cells, and from Cos-7 cells which had been transiently transfected with mouse GATA-6 cDNA using the NE-PER kit (Pierce), exactly as described. Aliquots were stored at 80-C. Complementary single-stranded oligonucleotides were annealed at 1 AM by heating to 95-C for 10 min in 100 mM NaCl, 10 mM TrisUHCl (pH 8.0), 1 mM EDTA, and allowing to cool gradually to room temperature. The sequences

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

of the oligonucleotides used were as follows: Nox1 wt, 5V CAAATCTTTTATCTAGGAAGGC 3V, 3V GTTTAGAAAATAQ GATCCTTCCG 5V; Nox1 mut, 5V CAAATCTTTAAAGTAGGAAGGC 3V, 3V GTTTAGAAATTTCATCCTTCCG 5V; aG2 (GATA), 5V GATCCGGGCAACTGATAAGGATTCCCA 3V, 3V CTAGGCCCGTTGACTATTCCTAAGGGT 5V; Sp1, 5V ATTCGATCGGGGCGGGGCGAGC 3V, 3V TAAGCTAGCCCCGCQ CCCGCTCG 5V. Double-stranded (ds) oligonucleotides (Nox1 wt and aG2) were radiolabeled to high specific activity at their 5V termini using [g32P]dATP (3000 Ci/mM) and T4 polynucleotide kinase (Promega). Each assay mix (20 Al) contained 20 fmol ds radiolabeled oligonucleotide probe, 4 or 2 pmol (as indicated in the figure legend) ds unlabeled competitor oligonucleotide (as necessary), and 6 Ag protein extract in a buffer comprising 10 mM Tris-HCl, pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 150 Ag/ml poly(dIdC), 10% glycerol. Reactions were preincubated at room temperature for 20 min before the addition of the radiolabeled probe, and subsequently for a further 20 min. DNA-protein complexes were resolved on 6% nondenaturing polyacrylamide gels, containing 10% glycerol, which were dried and exposed to X-ray film for autoradiographic detection. Statistical methods Data are expressed as means T SE and compared using Student’s t test. p < 0.05 was considered significant.

263

Nox1 is highly expressed in Caco-2 cells, and transcription levels are cell-density dependent Nox1 expression was analyzed by real-time RT-PCR on cDNA isolated from human Caco-2 cells and the rat vascular smooth muscle cell line, A7r5. Although readily detectable in both cell types, Nox1 was expressed at an approximately 80fold higher level in Caco-2 cells compared with the smooth muscle cells (Fig. 1A). This level of expression in Caco-2 cells was approximately 0.4% of that of cytoskeletal h-actin. Since the activity of the Nox1-containing oxidase was reported to be markedly higher in proliferating Caco-2 cells compared with confluent cultures [24], we tested whether this variation reflected different levels of Nox1 transcripts. Quantitative real-time RT-PCR on cDNA isolated from Caco-2 cells at varying degrees of confluence showed that the relative expression of Nox1 was markedly lower at higher cell densities, suggesting that transcriptional regulation of Nox1 could account, at least in part, for the lower NADPH oxidase activity in these cells (Fig. 1B). To determine whether the cell density effect on Nox1 transcription was mediated by a soluble factor, cells were plated out at low density for 16 h, before the culture media were changed to that which had been conditioned for 24 h by confluent cultures. After a further 24-h incubation, cDNA was analyzed to determine whether the media conditioned by confluent cultures could lower the relative expression of Nox1 within the less dense cells. As shown in Fig. 1C, the

Fig. 1. Expression of Nox1 in cell cultures. Real-time RT-PCR analysis of: (A) mRNA isolated from the rat smooth muscle cell line, A7r5, and the human colon epithelial cell line, Caco-2; (B) mRNA isolated from Caco-2 cells plated at different densities as indicated, and cultured subsequently for 24 h; (C) mRNA isolated from Caco-2 cells plated at high density (100%) or low density (6.25%), and cultured for 16 h. Low-density cultures were subsequently cultured for a further 24 h in normal media, or media that had been conditioned for 24 h by high-density cultures (+CM). Levels are relative to those of endogenous cytoskeletal h-actin. Panels A and B show the average of triplicate measurements on single cultures; panel C shows the average of duplicate measurements on biological triplicate samples.

264

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

conditioned media did not suppress Nox1 transcription, suggesting that the transcriptional ‘‘downregulation’’ of Nox1 within the confluent cultures is not mediated by a soluble factor. Identification of the Nox1 transcriptional initiation site(s) The Nox1 transcriptional initiation site(s), (CAP site(s)), in Caco-2 cells was identified by 5V RACE. After two rounds of nested PCR, a broad band corresponding to multiple cDNA 5V ends was isolated and cloned into a Topo-II vector (Clontech).

Bacterial colonies were isolated and sequenced, and found to correspond to human genomic sequence adjacent to and contiguous with the most 5V known cDNA sequence, indicating a lack of any additional, more upstream 5V exons. The CAP site corresponding to the longest clone isolated is marked on Fig. 2A. This corresponds to position 221 base pairs (bp), relative to the start of translation. Although apparently lacking a canonical TATA box, there is a TATA box-like sequence, TAAAAT, 37 –42 bp upstream of the identified CAP site. The 5V ends of the other human Nox1 transcripts mapped in this way are indicated. It is not known whether the variability in the

Fig. 2. Identification of human Nox1 promoter. (A) Proximal promoter sequence spanning the human Nox1 CAP site. The most 5V CAP site detected is indicated. Other putative CAP sites are marked with asterisks. The TATA box-like sequence around 40 bp is boxed. The bold line at 10 bp relative to the translation initiator methionine, and +211 bp relative to the CAP site, represents the 3V boundary of all the promoter constructs generated. (B) Transcriptional activity of a series of Nox1 deletion mutants studied in Caco-2 cells. The results represent the average of duplicate readings on biological triplicate samples. (C) Diagrammatic representation of deletion series of Nox1 promoter constructs, and positions of positively and negatively acting elements within these constructs.

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

isolated clones is due to a real heterogeneity in transcriptional initiations, or whether it reflects a partial degradation of the RNA. In this regard it should be noted that other 5V RACE analyses performed in parallel in our laboratory did not give these multiple bands, suggesting that the heterogeneity is a true reflection of the distribution of the CAP sites. Positive and negative regulatory elements within the Nox1 promoter In order to identify the functional elements within the promoter, we generated a series of 5V deletions of an approximately 5-kb genomic fragment, which spanned the CAP site(s) and included all but the most 3V 10 bp of the 5V untranslated region (UTR). The 3V boundary of all the putative promoter genomic fragments was kept constant in these experiments and is indicated in Fig. 2A. Fragments were ligated into the poly-linker of the firefly luciferase-containing pGL3-Basic construct (Promega). The resulting plasmids were transfected into Caco-2 cells, and expression of the luciferase reporter gene was analyzed relative to that resulting from a cotransfected, Renilla luciferase control gene (pRL-TK). The results are summarized in Fig. 2B. Maximal luciferase gene expression was directed by a promoter fragment comprising sequences to 306 bp (relative to the CAP site). Deletion to 102 bp resulted in a significant (>70%) reduction in activity. Perhaps surprisingly, a further deletion to 2 bp had no significant effect, and still resulted in levels of transcription significantly greater than those directed by the promoterless pGL3 Basic control plasmid. More distal sequences between 306 and 1275 bp acted to decrease the activity of the reporter gene, to approximately 60% of the maximal level, while the sequences between 2798 and 1275 bp did not significantly affect expression (either positively or negatively). Lastly, the sequences upstream of this between 4722 and 2798 bp dramatically repressed expression, by more than 80%, to levels only slightly greater than those resulting from pGL3 Basic. Thus, the expression of Nox1 in Caco-2 cells is regulated by proximal activating promoter element(s) and more distal repressor elements. A schematic map of these regulatory regions is shown in Fig. 2C. The positively acting promoter sequences include two potential GATA-binding sites, one of which is conserved between mouse and human In order to determine potential transcription factor-binding sites mediating the transcriptional activation apparent from the 5V promoter deletion series, we analyzed the ‘‘positively acting’’ human Nox1 promoter sequence between 306 and 102 bp, using the TRANSFAC program (http://www.cbrc.jp/research/ db/TFSEARCH.html). The sites of potential importance are indicated in Fig. 3A. In particular, the program identified two putative GATA-binding sites within this region; one at position 268/ 273 bp, and another reverse site at 130/ 135 bp. The consensus GATA-binding site, WGATAR (in which W indicates A/T and R indicates A/G), was originally derived

265

from regulatory elements within erythroid cell-specific genes. Subsequently, however, functional GATA-binding sites with broader recognition sequences have been identified [29]. The more proximal, reverse site identified here within the Nox1 promoter fits the consensus exactly. Moreover the site is conserved within the homologous region of the mouse Nox1 locus, suggesting a possible functional significance. However, although identified by the TRANSFAC program, the more distal site does not fit the consensus exactly, and does not appear conserved between the two mammalian species (see Fig. 3A). All three members of the GATA-4, -5, and -6 subfamily of transcription factors are known to be expressed in enterocytes in vivo, and also within cultured Caco-2 cells, where they have been implicated in the regulation of a number of intestinal gene promoters [30 –35]. Also indicated in Fig. 3A are potential binding sites for factors of the CCAAT/enhancerbinding protein (C/EBP) and caudal-related homeobox (CDX) gene families. CDX-1 and C/EBPh are both endodermal factors, expressed in enterocytes which have been shown, together with GATA factors, to be involved in synergistic interactions which regulate intestinal expression of the rat liver fatty acid-binding protein gene (Fabpl) [36]. We next analyzed the expression in Caco-2 cells of the luciferase reporter gene driven by 5V deletion constructs in which these two potential GATA-binding sites had been sequentially deleted. As shown in Fig. 3B, deletion of the more distal sequences, including the upstream putative GATAbinding site, to 203 bp, resulted in a 38% reduction of maximal promoter activity. Further deletion of the more proximal sequences, including the conserved GATA site, reduced expression by a further 35.5%, to 26.5% of the activity effected by the 306-bp construct. As stated above, Caco-2 cells are known to express GATA4, -5, and -6. We therefore tested the ability of these three factors independently to transactivate the 306-bp construct in Cos 7 cells. These cells do not express significant levels of any endogenous GATA factor [37], and are therefore a suitable system in which to investigate the specific effect of GATA overexpression on promoter function. In comparing the transactivation potentials of the three factors, it is clearly important for them to be expressed from the same promoter in each case, in order to effect equivalent levels of expression. We have here compared, in one experiment, the abilities of GATA4 and GATA-5, each cloned into the vector pcDNA3.1 (to generate pcDNAG4 and pcDNAG5, respectively) to transactivate the 306-bp Nox1 promoter construct. As shown in Fig. 4A, overexpression of either GATA-4 or GATA-5 resulted in a similar, and in each case highly significant, increase in the activity of the Nox1 promoter. The results are presented relative to the activity levels of the control plasmid, pGL3 basic, in each case cotransfected with empty vector, GATA-4, or GATA-5. A similar comparison of the transactivation capabilities of GATA4 and GATA-6, each cloned into the expression pEF pLINK II, is shown in Fig. 4B. Again, overexpression of either GATA-4 or GATA-6 acted to upregulate the Nox1 promoter significantly, with GATA-6 being the slightly more potent transactivator. It should be noted

266

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

Fig. 3. Transcription of human Nox1 gene is upregulated by GATA factors. (A) Sequence homology of human and mouse Nox1 5V flanking sequence. Numbers indicated, corresponding to nucleotides marked in bold, are relative to the human CAP site (arrowed, in Fig. 2A). Putative GATA-factor-binding motifs are marked as open boxes; homologies to CCAAT/enhancer binding protein (C/EBP) and caudal-related homeobox (CDX)-binding sites are underlined and marked as shaded boxes, respectively. (B) Transcriptional activity of Nox1 promoter constructs in Caco-2 cells in which the putative GATA sites have been sequentially deleted. Results shown are the average of duplicate measurements on biological triplicate samples.

that in this case the level of transactivation by the two GATA factors is less than that seen effected by pcDNAG4 and pcDNAG5, presumably because the EFIa promoter, present in pEFpLINK, acts to direct a lower level of expression of the GATA factors than the CMV promoter present in pcDNA3.1. Irrespective of these differences in promoter strength, it is clear from these experiments that GATA-4, -5, and -6 are all capable of transactivating the Nox1 promoter with similar efficiencies. Since we detected little difference in the relative abilities of the three GATA factors to transactivate Nox1, it seems likely that all three factors have similar binding affinities to the putative GATA-binding site(s) present within the promoter. Thus the relative abundance of each factor may be a determinant of functional significance. We therefore measured by quantitative RT-PCR the relative levels of mRNAs encoding the three factors in Caco-2 cells. As seen in Fig. 4C, GATA-6 was by far the most abundant message detected, being >1000fold more highly expressed than GATA-5, which was in turn approximately 3-fold more abundant than GATA-4. Thus, at

least in Caco-2 cells, GATA-6 may be the factor most likely to be activating Nox1 expression. The Nox1 promoter is a direct target of GATA binding In order to demonstrate direct binding of GATA proteins to the Nox1 promoter, we performed electrophoretic mobilityshift assays. A known GATA-binding site from within an erythroid-specific element of the mouse a globin promoter, aG2 [38], was radiolabeled and incubated in the presence of nuclear cell extract isolated from Caco-2 cells. Extracts from untransfected Cos-7 cells, which do not contain detectable levels of GATA-binding activity [37], together with extracts from Cos-7 cells which had been transiently transfected with mouse GATA-6, acted as negative and positive controls, respectively. As shown in Fig. 5A, Caco-2 cell extracts clearly contain a binding activity of a mobility similar to that isolated from GATA-6 transfected Cos-7 cells (compare lanes 3 and 5). This activity was not detected in extracts from untransfected

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

267

Fig. 4. Ectopic expression of GATA-4, -5, and -6 can transactivate the Nox1 promoter. (A) Comparison of the relative abilities of mouse GATA-4 and GATA-5 to upregulate the Nox1 promoter. Cos-7 cells were transfected with the 306-bp Nox1 promoter construct together with empty vector control (pcDNA3.1), pcDNAG4, or pcDNAG5, in addition to the cotransfection control pRL-TK. To control for any differential effects of the different GATA factors on expression from pRL-TK, the promoterless luciferase reporter vector pGL3 Basic was also cotransfected with pcDNA3.1, pcDNAG4, or pcDNAG5, together with pRL-TK, and the results presented represent the ratio of the relative activities of the 306-bp construct/pGL3 Basic in each case. (B) A comparison, as in panel A of the abilities of GATA-4 and GATA-6 to transactivate the Nox1 promoter. In this case the empty vector control is pEF pLINK II 4.9, and the GATA-4 and GATA-6 expressing constructs are pLINK-G4 and pLINKG6, respectively. In each case the results represent the average of duplicate measurements on biological triplicate samples. (C) Real-time RTPCR run profile of fluorescence vs cycle number, of equivalent cDNA aliquots, isolated from Caco-2 cells, using primers specific for human GATA-4, -5, and -6. Duplicate measurements are shown in each case.

Cos-7 cells (lane 1). Binding specificity was demonstrated by competition with a 200-fold excess of unlabeled oligonucleotide, which resulted in a large reduction of the retarded complex in both cases (lanes 4 and 6). Thus, as has been demonstrated previously [31], and in accordance with our RNA data (Fig. 4B), Caco-2 cells contain readily detectable levels of GATA-binding activity. Furthermore, as shown in Fig. 5B, the complex formed between the aG2 oligonucleotide and the GATA-binding activity within Caco-2 cells could also be competed significantly by the addition of an oligonucleotide comprising the more proximal putative GATA-binding site, identified within the Nox1 promoter (Nox1 wt) that is conserved between human and mouse (see Fig. 3A). An oligonucleotide in which this putative GATA site had been mutated (Nox1 mut), however, could not compete for binding (compare Fig. 5B, lanes 1, 3, and 4). We next incubated Caco-2 nuclear cell extract with radiolabeled Nox1 wt (comprising the more proximal, conserved site) and again detected a complex which could be competed by unlabeled Nox1 wt and by aG2, but not by Nox1 mut or by an Sp1-binding site (Fig. 5C). The mobility of the complex formed between Caco-2 cell extract

and Nox1 wt was indistinguishable from that detected with the aG2 oligonucleotide (data not shown). Lastly we compared the ability of the radiolabeled Nox1 wt ds oligonucleotide to bind to cell extracts isolated from Cos-7 cells, with those isolated from Cos-7 cells which had been transfected with mouse GATA-6. As shown in Fig. 5D, the extract isolated from Cos-7 cells does not contain an activity which binds to the Nox1 wt oligonucleotide. By contrast Cos-7 cells which had been transfected with mouse GATA-6 did contain high levels of an activity which bound to the Nox1 wt oligonucleotide. As in the case of the complex formed between Caco-2 cell extracts and Nox1 wt oligonucleotide, the complex formed between GATA6-expressing Cos-7 cell extract and Nox1 wt could be specifically competed by an excess (in this case 100-fold) of unlabeled Nox1 wt and by aG2, but not by Nox1 mut or by an Sp1-binding site (Fig. 5D). We also performed EMSAs using a radiolabeled ds oligonucleotide corresponding to the more upstream putative GATA-binding site, identified by the TRANSFAC program. Although this site was found to bind to an activity present in Caco-2 cells, the complex could not be competed by the aG2

268

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

Fig. 5. A GATA factor(s) isolated from Caco-2 cells interacts directly with the Nox1 promoter. (A) EMSA using a known radiolabeled GATA-binding doublestranded (ds) oligonucleotide probe, aG2, and various nuclear cell extracts as indicated, with (+) or without ( ) a 200-fold excess of unlabeled probe as competitor (self competitor). (B) EMSA using radiolabeled ds aG2 probe and Caco-2 nuclear cell exract, with no competitor (lane 1), or with a 200-fold excess of unlabeled ds aG2 (lane 2), a ds oligonucleotide comprising the 130/ 135-bp putative GATA-binding site, identified within the Nox1 promoter (Nox1 wt; lane 3), or a ds oligonuleotide in which this putative GATA site had been mutated (Nox1 mut; lane 4). (C) EMSA using radiolabeled ds Nox1 wt probe and Caco-2 nuclear cell extract, with no competitor (lane 2), or with a 200-fold excess of unlabeled ds Nox1 wt (lane 3), (lane 4) ds Nox1 mut (lane 5), or a ds oligonucleotide comprising a consensus Sp1-binding site (lane 6). Lane 1 is free probe, not incubated with extract. (D) EMSA using radiolabeled ds Nox1 wt probe and Cos-7 cell extract (lane 2), or extracts from Cos-7 cells which had been transfected with mouse GATA-6 cDNA (lanes 3 – 7). Lanes 2 and 3 are without competitor; lanes 4 – 7 include a 100-fold excess of unlabeled ds Nox1, ds aG2, ds Nox1 mut, and ds Sp1, respectively. Lane 1 is free probe, not incubated with extract. The position of the GATA-bound shifted complex in all cases is indicated (GATA).

oligonucleotide, suggesting that it is not a GATA-binding factor (data not shown). Moreover the oligonucleotide was able to form a bound complex with extract from Cos-7 cells that had not been transfected with a GATA factor. Again the complex could not be specifically competed with the aG2 oligonucleotide (data not shown). Thus these data suggest that the putative GATA site at position 268/ 273 bp, although recognized by the TRANSFAC program, does not bind a GATA factor directly. However, our data indicate that the more proximal,

reverse site at position 130/ 135 bp does bind directly to a GATA factor, and that GATA-6 specifically is capable of forming a complex with this site. To demonstrate further that the Nox1 promoter is a direct target of GATA-binding activity, we specifically mutated the 130/ 135 GATA-binding site. Within the context of the 306-bp deletion construct that effects maximal promoter activity, the sequence 5V TTATCT 3V (AGATAA in the complementary strand) was mutated to a sequence 5V TAAAGT

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

3V (ACTTTA in the complementary strand; see Fig. 6), which will not bind to GATA factors, [29]. The resultant construct ( 306 GATAmut) was tested for its ability to direct reporter expression in both Caco-2 cells and Cos-7 cells, when cotransfected with a GATA-6-expressing construct. As shown in Fig. 6A, specific mutation of this GATA site resulted in an approximate 30% reduction in the activity of the promoter in Caco-2 cells, relative to that of the unmutated 306-bp promoter construct. Thus specifically mutating this site resulted in a decrease in activity in Caco-2 cells, similar to that observed when all the sequences (including this GATA site) between 203 and 102 were deleted (see Fig. 3B). Similarly, the activity of the Nox1 promoter on GATA-6 overexpression in Cos-7 cells was reduced by about 35% when this GATA site was specifically mutated (Fig. 6B). Taken together, therefore, these data strongly suggest that GATA-6, and possibly additionally GATA-4 and -5, acts to upregulate Nox 1 in colon epithelial cells by direct binding to a proximal site within the Nox 1 promoter.

269

The effect of cell density on Nox1 expression is mediated by sequences proximal to the transcriptional initiation site As shown above, the levels of Nox1 mRNA are lower in Caco-2 cells grown at high density, relative to those grown at less confluent densities. It is possible that this effect may be mediated either by active repression of the promoter (within high-density cultures) and/or by transcriptional activation within less confluent cells. The sequences between 4722 and 2798 bp upstream of the CAP site act strongly to repress Nox1 transcription (Fig. 2B). We therefore tested whether this ‘‘cell-density effect’’ was mediated by elements within this region; i.e., whether the sequences between 4722 and 2798 bp conferred a greater repressive effect on the Nox1 promoter at high cell densities, compared to lower cell densities. Caco-2 cells were transfected at approximately 70% density with the 4722- and 2798bp constructs, and were incubated overnight. The following day, the cultures were trypsinized, plated out at both high

Fig. 6. Site-specific mutation of a canonical GATA-binding site down regulates human Nox1 transcription. (A) Transcriptional activity of the 306-bp deletion construct in Caco-2 cells, in which the (reverse) canonical GATA-binding site at 130/ 135 bp has been specifically mutated as shown ( 306 GATAmut). Mutated residues are marked with asterisks. (B) Transcriptional activity of 306 GATAmut in Cos-7 cells, with or without cotransfected mouse GATA-6. Results in both cases are shown relative to the promoterless control, pGL3 Basic, and the wild-type control, 306 bp, and represent the average of duplicate measurements on biological triplicate samples.

270

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

(100% confluency) and low (approximately 10% confluency) densities, and incubated for a further 24 h before harvesting and analysis. As shown in Fig. 7A, while expression resulting from the 2798-bp reporter construct was higher than that resulting from the 4722-bp construct, in both cases expression was decreased in the confluent cultures, relative to the less dense cells. Moreover, the percentage increase in expression in each case was similar; approximately 100% (Fig. 7B). This suggests therefore that the celldensity-dependent modulations in Nox1 transcription are not mediated by regulating the activity of repressor elements between 4722 and 2798 bp. We next tested the activity of the 306-bp promoter construct, which directs the highest levels of reporter activity that we have been able to detect in this system. Again, cells were initially transfected at approximately 70% density with either pGL3 Basic or the 306-bp Nox1 construct, incubated overnight and subsequently split into high- and low-density cultures as described above. Again, the Nox1 promoter was approximately twofold more active in the less dense cultures. By contrast, there was no increase in luciferase expression resulting from pGL3 Basic in the less dense compared to confluent cell cultures. Thus elements within the proximal promoter appear to mediate changes in Nox1 expression dependent on cell density. We have also tested whether the GATA site at 130/ 135 plays a role in mediating this effect. However, the cell-density-dependent percentage increase in expression from 306 GATAmut (in which the GATA site has been mutated) was similar to that observed

for the wild-type 306-bp construct (data not shown). We have therefore been unable thus far to demonstrate a role for a GATA-binding factor in regulating cell-density-dependent Nox1 expression. Discussion Transcriptional regulation of Nox1 The Nox isoform, Nox1, is expressed both in the colon epithelial cell line, Caco-2, and in the vascular smooth muscle cell line, A7r5. However, the relative levels of expression within the two cell lines are very different, with Nox1 mRNA being approximately 80-fold more abundant in Caco-2 cells than A7r5 cells. This suggests that distinct regulatory mechanisms may effect expression in the two different cell types. Transcriptional regulation of the Nox1 gene is increasingly being understood to be an important mechanism in the control of Nox1 activity. In vivo, in the vasculature, a chronic upregulation of NADPH oxidase activity is often associated with progression to pathophysiological disorders including atherosclerosis and hypertension, and this upregulation has increasingly been shown to correlate with increases in Nox1 mRNA levels [4]. Thus vascular NADPH oxidase activity is known to be increased in rats made hypertensive by chronic angiotensin II (AII) infusion [39], and, correspondingly, Nox 1 transcript levels were found to be higher in the aortae of transgenic hypertensive rats overexpressing the Ren2 gene, compared to wild-type controls [19]. Nox 1

Fig. 7. The cell-density effect is mediated by sequences proximal to the promoter. (A) Transcriptional activity of the 4722- and 2798-bp Nox1 deletion constructs, transfected into Caco-2 cells, and incubated overnight. Cultures were subsequently trypsinized and plated at both high (100% confluence) and low (10% confluence) densities. (B) Percentage increase in relative expression of constructs in low- compared to high-density cultures (NS is not significant). (C) Transcriptional activity of 306-bp deletion construct, and the promoterless control, pGL3 Basic, in high- and low-density Caco-2 cultures. (D) pGL3 Basic showed no percentage increase in relative expression in low- compared to high-density cultures, while there was an approximately twofold increase in 306-bp expression (percentage increase approximately 100%). All panels show the average data of duplicate readings on biological triplicate samples.

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

mRNA has also been found to be upregulated in both minimally and terminally diseased human coronary arteries [4] and during the early stages of restenosis after balloon injury [18]. In isolated VSMC, in vitro, the expression of Nox 1 mRNA has been shown to be upregulated by a plethora of agonists, many of which effect cellular hypertrophy, including serum, AII, platelet-derived growth factor (PDGF) prostaglandin F2a, low-density lipoprotein, (LDL), phorbal 12myristate 13-acetate (PMA), and mechanical stretch [7,17,19, 22,40], and to be downregulated by atorvastatin [41], suggesting that Nox1 transcription is dynamically modulated by external physiological cues. In intestinal epithelial cells the transcription of Nox1 again appears to be dynamically regulated by external cues. Thus, both the inflammatory mediator IFN-g and the keratinocyte growth factor-a can act to upregulate Nox1 mRNA levels in human colon cells in vitro [3,20]. In addition, high levels of Nox1 expression correlate with more undifferentiated cells both in vivo and in vitro. In all vertebrates, the intestinal lumen is lined by an endoderm-derived epithelial sheet, comprised predominantly of absorptive enterocytes [42,43]. These originate from undifferentiated, multipotent stem cells near the base of the small intestinal crypts. The differentiating cells migrate from the crypt toward the villus tip, where they eventually die and are extruded into the lumen [44 – 47]. By in situ hybridization, the highest expression of Nox1 has been demonstrated within the lower twothirds of the colon crypt, where epithelial cells are most proliferative [20]. The Caco-2 cell line is a well-characterized human adenocarcinoma-derived line which serves as an inducible in vitro model for gut cell differentiation [48]. NADPH oxidase activity was found to be higher in proliferative, subconfluent cultures of colonic epithelial cells, including Caco-2 cells, than in more confluent cultures [24]. Consistent with these observations, we demonstrate here that this increase in oxidase activity within less confluent cells may be mediated, at least in part, at the level of transcription of Nox1. Thus Nox1 mRNA levels were found to be significantly higher in the low confluent Caco-2 cell cultures, further suggesting that the rate of transcription of Nox1 is mediated, in part, by external physiological cues which effect cell growth and differentiation. Transcriptional regulation of Nox1 and role of GATA-binding factors In the present study, we have identified the transcriptional initiation site of the Nox1 gene in human colon epithelial Caco-2 cells and analyzed the proximal promoter region. We report that the maximal transcriptional activity of the Nox1 promoter in Caco-2 cells is dependent on the direct binding of a GATAbinding factor. The GATA family of transcription factors comprises, in vertebrates, at least six members which have been shown to play crucial roles in cellular specification and differentiation [49]. They each contain a highly conserved DNA-binding domain comprising two zinc fingers which preferentially bind to the consensus core motif, 5V-T/ A(GATA)A/G-3V, found within the regulatory regions of their downstream target genes, and consequentially they exhibit

271

similar DNA-binding properties [29]. GATA-4, -5, and -6 represent a subfamily of these transcription factors which display partially overlapping expression domains, within some endodermal and mesodermal derivatives including gut and heart [50]. Many studies have now implicated GATA factors in the transcriptional regulation of intestinal-specific genes, such as rat and human lactase-phlorizin hydrolase (LPH), human sucraseisomaltase (SI), and rat sodium-hydrogen exchanger isoform 3 (NHE3) [30,33,34]. GATA-4, -5, and -6 are all expressed in the intestinal gut epithelium and, where tested, have all been shown to transactivate GATA-dependent gut-specific promoters [32]. In common with these previous studies we found that all three factors were capable of transactivating the Nox1 promoter in the fibroblast cell line, Cos-7. The patterns of expression of the three GATA factors along the proximal-distal villus axis are distinct. Thus in the chick, transcript levels for GATA-4 increase along the axis toward the villus tip, and GATA-5 transcripts are similarly largely restricted to the distal tip, which comprises differentiated cells. By contrast GATA-6 expression compliments that of GATA-4 and -5, with the highest levels apparent in the proliferating progenitor cells of the crypts [32]. Thus the pattern of expression of Nox1 within the more proliferative cells of the intestinal crypts correlates with that of GATA-6 rather than GATA-4 or -5, and it seems likely therefore that GATA-6 may positively regulate Nox1 expression in immature, proliferating gut epithelial cells in vivo. In addition we demonstrate here that GATA-6, transfected into Cos-7 cells, is capable of forming a specific complex with the conserved, functional GATA site within the Nox1 promoter, and that GATA-6 is by far the most abundant of the three factors in Caco-2 cells, in which Nox1 is highly expressed. Moreover it is intriguing that GATA-6 is also expressed in VSMC, where it acts to regulate cellular proliferation and differentiation [51]. The GATA-binding site at position 130/ 135, although important in the activation of Nox1 expression, is not, however, the only positively acting element within the proximal Nox1 promoter. Deletion of the sequences between 306 and 203 bp resulted in a 38% decrease in promoter activity, indicating the presence of additional activating elements within this region. By bioinformatic analyses, a second potential GATA site was identified in this region, but was subsequently shown not to bind GATA by EMSA. A consensus homology to the binding site of C/EBP (indicated in Fig. 3A) was also recognized by the TRANSFAC program that has not thus far been functionally tested. It is also worth noting that site-specific mutation of the functional GATA-binding site at 130/ 135 did not abolish the upregulation of the promoter by coexpressed GATA factors in Cos-7 cells, but reduced it by approximately 35%. Therefore there may be other, as yet unidentified (direct or indirect), GATA-binding sites within this region of the promoter, or binding sites for other transcription factors whose expression is, in turn, upregulated by GATA factor(s). Our experiments described here also demonstrate that transcriptional repression plays an important role in the regulation of Nox1. At least two independent promoter regions

272

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

were here identified as acting as significant repressors of expression; however, these remain to be characterized further. Nox1 expression and cell density Striking differences in the levels of Nox1 mRNA expression were found here in cultured Caco-2 cells, dependent on whether they were in confluent or sparsely plated cultures. Thus, low-density cultures of Caco-2 cells expressed significantly higher levels of Nox1 mRNA than confluent cultures. The difference in Nox1 expression, however, only became apparent when the cells were plated at very low densities (see Fig. 1). The signal for this ‘‘cell-density effect’’ on Nox1 expression was also shown not to be transduced by a soluble factor(s). For these reasons we believe that cell-cell contact may be necessary for the downregulation of Nox1 transcription in these cells. Caco-2 cells at low densities are highly motile [52] and will readily migrate toward each other in culture to form cell clusters. Only when plated at very low densities (10% or less) were the cells found to be still dissociated from each other, 24 h after plating. It may therefore be the case that the increased Nox1 mRNA observed in these cultures is a reflection of cellular migration, or a lack of cell-cell contacts, rather than proliferation. We hypothesized that the increase in Nox1 expression in the sparsely plated cultures might be the result of a partial derepression of transcription, mediated by the more distal, negatively acting elements identified here. In our transfection experiments, however, we were able to show that expression driven by the 306-bp proximal promoter region was as sensitive to cell density as that effected by the 4722-bp construct. In both cases, activity of the luciferase reporter gene increased approximately twofold in the less dense cultures. There are many potential mechanisms whereby extracellular cues, such as cell-cell contact, may effect cell-densitydependent alterations in gene expression. Previous studies have shown that members of the RhoA family, which are key regulators that can link membrane receptors to cytoskeletal organization and gene transcription, may potentiate the transcriptional activation of GATA factors [53 –56]. It is therefore possible that the cell-density-dependent transcriptional regulation of the Nox1 promoter might be mediated through the direct or indirect binding of a GATA factor to a site within the proximal promoter. Accordingly, we tested whether mutation of the 130/135 GATA-binding site would reduce or abolish the increase in Nox1 promoter activity in the less dense cells, but this was found not to be the case. The transcriptional mechanisms responsible for cell-density-dependent regulation therefore clearly require further investigation. In summary, we have undertaken the first analysis of the Nox1 promoter in human colon epithelial cells. Our main findings are that the Nox1 promoter in these cells is subject to both positive and negative regulatory cues, and that direct binding of a GATA factor(s), probably GATA-6, to the proximal promoter may be involved in the intestinal-specific expression of Nox1.

Acknowledgments We are grateful to Dr. Lewis Mahadevan, for providing the pEF pLINK II 4.9 expression vector, and to Dr. Edward Morrisey for providing mouse pcDNAG4 and pcDNAG5 expression clones. This work was supported by the British Heart Foundation. References [1] Bokoch, G. M.; Knaus, U. G. NADPH oxidases: not just for leukocytes anymore! Trends Biochem. Sci. 28:502 – 508; 2003. [2] Griendling, K. K.; Sorescu, D.; Ushio-Fukai, M. NAD(P)H oxidase : role in cardiovascular biology and disease. Circ. Res. 86:494 – 501; 2000. [3] Lambeth, J. D. Nox enzymes and the biology of reactive oxygen. Nat. Rev. Immunol. 4:181 – 189; 2004. [4] Lassegue, B.; Clempus, R. E. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285:R277 – R297; 2003. [5] Cai, H.; Griendling, K. K.; Harrison, D. G. The vascular NAD(P)H oxidases as therapeutic targets in cardiovascular diseases. Trends Pharmacol. Sci. 24:471 – 478; 2003. [6] Lambeth, J. D.; Cheng, G.; Arnold, R. S.; Edens, W. A. Novel homologs of gp91phox. Trends Biochem. Sci. 25:459 – 461; 2000. [7] Suh, Y. A.; Arnold, R. S.; Lassegue, B.; Shi, J.; Xu, X.; Sorescu, D.; Chung, A. B.; Griendling, K. K.; Lambeth, J. D. Cell transformation by the superoxide-generating oxidase Mox1. Nature 401:79 – 82; 1999. [8] Teshima, S.; Kutsumi, H.; Kawahara, T.; Kishi, K.; Rokutan, K. Regulation of growth and apoptosis of cultured guinea pig gastric mucosal cells by mitogenic oxidase 1. Am. J. Physiol. Gastrointest. Liver Physiol. 279:G1169 – G1176; 2000. [9] Banfi, B.; Malgrange, B.; Knisz, J.; Steger, K.; Dubois-Dauphin, M.; Krause, K. H. NOX3: A superoxide-generating NADPH oxidase of the inner ear. J. Biol. Chem. M403046200; 2001. [10] Cheng, G.; Cao, Z.; Xu, X.; Meir, E. G. V.; Lambeth, J. D. Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene 269:131 – 140; 2001. [11] Shiose, A.; Kuroda, J.; Tsuruya, K.; Hirai, M.; Hirakata, H.; Naito, S.; Hattori, M.; Sakaki, Y.; Sumimoto, H. A Novel superoxide-producing NAD(P)H oxidase in kidney. J. Biol. Chem. 276:1417 – 1423; 2001. [12] Banfi, B.; Molnar, G.; Maturana, A.; Steger, K.; Hegedus, B.; Demaurex, N.; Krause, K. H. A Ca2+-activated NADPH oxidase in testis, spleen, and lymph nodes. J. Biol. Chem. 276:37594 – 37601; 2001. [13] Banfi, B.; Clark, R. A.; Steger, K.; Krause, K. H. Two novel proteins activate superoxide generation by the NADPH oxidase NOX1. J. Biol. Chem. 278:3510 – 3513; 2003. [14] Geiszt, M.; Lekstrom, K.; Witta, J.; Leto, T. L. Proteins homologous to p47phox and p67phox support superoxide production by NAD(P)H oxidase 1 in colon epithelial cells. J. Biol. Chem. 278:20006 – 20012; 2003. [15] Takeya, R.; Ueno, N.; Kami, K.; Taura, M.; Kohjima, M.; Izaki, T.; Nunoi, H.; Sumimoto, H. Novel human homologues of p47phox and p67phox participate in activation of superoxide-producing NADPH oxidases. J. Biol. Chem. 278:25234 – 25246; 2003. [16] Cheng, G.; Lambeth, J. D. NOXO1, Regulation of lipid binding, localization, and activation of Nox1 by the Phox homology (PX) domain. J. Biol. Chem. 279:4737 – 4742; 2004. [17] Lassegue, B.; Sorescu, D.; Szocs, K.; Yin, Q.; Akers, M.; Zhang, Y.; Grant, S. L.; Lambeth, J. D.; Griendling, K. K. Novel gp91phox homologues in vascular smooth muscle cells : nox1 mediates angiotensin ii-induced superoxide formation and redox-sensitive signaling pathways. Circ. Res. 88:888 – 894; 2001. [18] Szocs, K.; Lassegue, B.; Sorescu, D.; Hilenski, L. L.; Valppu, L.; Couse, T. L.; Wilcox, J. N.; Quinn, M. T.; Lambeth, J. D.; Griendling, K. K.

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29] [30]

[31]

[32]

[33]

[34]

[35]

[36]

Upregulation of Nox-based NAD(P)H oxidases in restenosis after carotid injury. Arterioscler. Thromb. Vasc. Biol. 22:21 – 27; 2002. Wingler, K.; Wunsch, S.; Kreutz, R.; Rothermund, L.; Paul, M.; Schmidt, H. H. H. W. Upregulation of the vascular NAD(P)H-oxidase isoforms Nox1 and Nox4 by the renin-angiotensin system in vitro and in vivo. Free Radic. Biol. Med. 31:1456 – 1464; 2001. Geiszt, M.; Lekstrom, K.; Brenner, S.; Hewitt, S. M.; Dana, R.; Malech, H. L.; Leto, T. L. NAD(P)H oxidase 1, a product of differentiated colon epithelial cells, can partially replace glycoprotein 91phox in the regulated production of superoxide by phagocytes. J. Immunol. 171: 299 – 306; 2003. Kawahara, T.; Kuwano, Y.; Teshima-Kondo, S.; Kawai, T.; Nikawa, T.; Kishi, K.; Rokutan, K. Toll-like receptor 4 regulates gastric pit cell responses to Helicobacter pylori infection. J. Med. Invest. 48:190 – 197; 2001. Katsuyama, M.; Fan, C.; Yabe-Nishimura, C. NADPH oxidase is involved in prostaglandin F2alpha -induced hypertrophy of vascular smooth muscle cells. induction of Nox1 BY PGF2alpha. J. Biol. Chem. 277:13438 – 13442; 2002. Chamulitrat, W.; Schmidt, R.; Tomakidi, P.; Stremmel, W.; Chunglok, W.; Kawahara, T.; Rokutan, K. Association of gp91phox homolog Nox1 with anchorage-independent growth and MAP kinase-activation of transformed human keratinocytes. Oncogene 22:6045 – 6053; 2003. Perner, A.; Andresen, L.; Pedersen, G.; Rask-Madsen, J. Superoxide production and expression of NAD(P)H oxidases by transformed and primary human colonic epithelial cells. Gut 52:231 – 236; 2003. Arbiser, J. L.; Petros, J.; Klafter, R.; Govindajaran, B.; McLaughlin, E. R.; Brown, L. F.; Cohen, C.; Moses, M.; Kilroy, S.; Arnold, R. S.; Lambeth, J. D. Reactive oxygen generated by Nox1 triggers the angiogenic switch. Proc. Natl. Acad. Sci. USA 99:715 – 720; 2002. Mitsushita, J.; Lambeth, J. D.; Kamata, T. The superoxide-generating oxidase Nox1 is functionally required for ras oncogene transformation. Cancer Res. 64:3580 – 3585; 2004. Winer, J.; Jung, C. K.; Shackel, I.; Williams, P. M. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytesin vitro. Anal. Biochem. 270:41 – 49; 1999. Horton, R. M.; Cai, Z. L.; Ho, S. N.; Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8:528 – 535; 1990. Ko, L. J.; Engel, J. D. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13:4011 – 4022; 1993. Boudreau, F.; Rings, E. H. H. M.; Swain, G. P.; Sinclair, A. M.; Suh, E. R.; Silberg, D. G.; Scheuermann, R. H.; Traber, P. G. A novel colonic repressor element regulates intestinal gene expression by interacting with Cux/CDP. Mol. Cell. Biol. 22:5467 – 5478; 2002. Fang, R.; Olds, L. C.; Santiago, N. A.; Sibley, E. GATA family transcription factors activate lactase gene promoter in intestinal Caco2 cells. Am. J. Physiol. Gastrointest. Liver Physiol. 280:G58 – G67; 2001. Gao, X.; Sedgwick, T.; Shi, Y. B.; Evans, T. Distinct functions are implicated for the GATA-4, -5a´, and -6a´ transcription factors in the regulation of intestine epithelial cell differentiation. Mol. Cell. Biol. 18:2901 – 2911; 1998. Kiela, P. R.; LeSueur, J.; Collins, J. F.; Ghishan, F. K. Transcriptional regulation of the rat NHE3 gene. Functional interactions between GATA5 and Sp family transcription factors. J. Biol. Chem. 278:5659 – 5668; 2003. Krasinski, S. D.; Van Wering, H. M.; Tannemaat, M. R.; Grand, R. J. Differential activation of intestinal gene promoters: functional interactions between GATA-5 and HNF-1{alpha}. Am. J. Physiol. Gastrointest. Liver Physiol. 281:G69 – G84; 2001. Van, S. I.; Perrais, M.; Pigny, P.; Porchet, N.; Aubert, J. P. Sequence of the 5V-flanking region and promoter activity of the human mucin gene MUC5B in different phenotypes of colon cancer cells. Biochem. J. 3:675 – 686; 2000. Divine, J. K.; McCaul, S. P.; Simon, T. C. HNF-1{alpha} and endodermal transcription factors cooperatively activate Fabpl: MODY3

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49] [50]

[51]

[52]

[53]

[54]

273

mutations abrogate cooperativity. Am. J. Physiol. Gastrointest. Liver Physiol. 285:G62 – G72; 2003. Yokoyama, H.; Harigae, H.; Takahashi, S.; Takahashi, S.; Furuyama, K.; Kaku, M.; Yamamoto, M.; Sasaki, T. Regulation of YB-1 gene expression by GATA transcription factors. Biochem. Biophys. Res. Commun. 303:140 – 145; 2003. Perkins, N. D.; Nicolas, R. H.; Plumb, M. A.; Goodwin, G. H. The purification of an erythroid protein which binds to enhancer and promoter elements of haemoglobin genes. Nucleic Acids Res. 17: 1299 – 1314; 1989. Rajagopalan, S.; Kurz, S.; Munzel, T.; Tarpey, M.; Freeman, B. A.; Griendling, K. K.; Harrison, D. G. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone. J. Clin. Invest. 97:1916 – 1923; 1996. Grote, K.; Flach, I.; Luchtefeld, M.; Akin, E.; Holland, S. M.; Drexler, H.; Schieffer, B. Mechanical stretch enhances mRNA expression and proenzyme release of matrix metalloproteinase-2 (MMP-2) via NAD(P)H oxidase-derived reactive oxygen species. Circ. Res. 92: 80e – 886e; 2003. Wassmann, S.; Laufs, U.; Muller, K.; Konkol, C.; Ahlbory, K.; Baumer, A. T.; Linz, W.; Bohm, M.; Nickenig, G. Cellular antioxidant effects of atorvastatin in vitro and in vivo. Arterioscler. Thromb. Vasc. Biol. 22:300 – 305; 2002. Gordon, J. I.; Schmidt, G. H.; Roth, K. A. Studies of intestinal stem cells using normal, chimeric, and transgenic mice. FASEB J. 6:3039 – 3050; 1992. Traber, P. G. Differentiation of intestinal epithelial cells: lessons from the study of intestine-specific gene expression. J. Lab. Clin. Med. 123: 467 – 477; 1994. Cheng, H.; Leblond, C. P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine: III. Enteroendocrine cells. Am. J. Anat. 141:503 – 519; 1974. Cheng, H.; Leblond, C. P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. V. Unitarian theory of the origin of the four epithelial cell types. Am. J. Anat. 141:537 – 561; 1974. Ponder, B. A.; Schmidt, G. H.; Wilkinson, M. M.; Wood, M. J.; Monk, M.; Reid, A. Derivation of mouse intestinal crypts from single progenitor cells. Nature 313:689 – 691; 1985. Schmidt, G. H.; Wilkinson, M. M.; Ponder, B. A. Cell migration pathway in the intestinal epithelium: an in situ marker system using mouse aggregation chimeras. Cell 40:425 – 429; 1985. Pinto, M.; Robine-Leon, S.; Appay, M.-D.; Kedinger, M.; Triadou, N.; Dussaulx, E.; Lacroix, B.; Simon-Assmann, P.; Haffen, K.; Fogh, J.; Zweibaum, A. Enterocyte-like differentiation and polarization of the human colon carcinoma cell line CaCo-2 in culture. Biol. Cell 47: 323 – 330; 1983. Patient, R. K.; McGhee, J. D. The GATA family (vertebrates and invertebrates). Curr. Opin. Genet. Dev. 12:416 – 422; 2002. Laverriere, A. C.; MacNeill, C.; Mueller, C.; Poelmann, R. E.; Burch, J. B.; Evans, T. GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J. Biol. Chem. 269: 23177 – 23184; 1994. Morrisey, E. E. GATA-6: The proliferation stops here : cell proliferation in glomerular mesangial and vascular smooth muscle cells. Circ. Res. 87:638 – 640; 2000. Yu, C. F.; Basson, M. D. Matrix-specific FAK and MAPK reorganization during Caco-2 cell motility. Microsc. Res. Tech. 51:191 – 203; 2000. Charron, F.; Tsimiklis, G.; Arcand, M.; Robitaille, L.; Liang, Q.; Molkentin, J. D.; Meloche, S.; Nemer, M. Tissue-specific GATA factors are transcriptional effectors of the small GTPase RhoA. Genes Dev. 15:2702 – 2719; 2001. Tenhunen, O.; Sarman, B.; Kerkela, R.; Szokodi, I.; Papp, L.; Toth, M.; Ruskoaho, H. Mitogen-activated protein kinases p38 and ERK 1/2 mediate the wall stress-induced activation of GATA-4 binding in adult heart. J. Biol. Chem. 279:24852 – 24860; 2004.

274

A.C. Brewer et al. / Free Radical Biology & Medicine 40 (2006) 260 – 274

[55] Tomaru, K. i.; Arai, M.; Yokoyama, T.; Aihara, Y.; Sekiguchi, K. i.; Tanaka, T.; Nagai, R.; Kurabayashi, M. Transcriptional activation of the BNP gene by lipopolysaccharide is mediated through GATA elements in neonatal rat cardiac myocytes. J. Mol. Cell. Cardiol. 34:649 – 659; 2002.

[56] Yanazume, T.; Hasegawa, K.; Wada, H.; Morimoto, T.; Abe, M.; Kawamura, T.; Sasayama, S. Rho/ROCK pathway contributes to the activation of extracellular signal-regulated kinase/GATA-4 during myocardial cell hypertrophy. J. Biol. Chem. 277:8618 – 8625; 2002.