Transcriptional regulation of the rat eIF4E gene in cardiac muscle cells: the role of specific elements in the promoter region

Gene 267 (2001) 1±12

www.elsevier.com/locate/gene

Transcriptional regulation of the rat eIF4E gene in cardiac muscle cells: the role of speci®c elements in the promoter region Antoine A. Makhlouf, Aryan M.S. Namboodiri, Paul J. McDermott* Department of Medicine and the Gazes Cardiac Research Institute, Medical University of South Carolina, and the Ralph H. Johnson Department of Veterans Affairs Medical Center, Charleston, SC, USA Received 12 July 2000; received in revised form 30 January 2001; accepted 19 February 2001 Received by A. Dugaiczyk

Abstract Eukaryotic initiation factor 4E (eIF4E) binds to the 7-methylguanosine cap of mRNA and facilitates binding of mRNA to the 40 S ribosome, a rate-limiting step in translation initiation. The expression of eIF4E mRNA and protein increases during growth of cardiac muscle cells (cardiocytes) in vitro. To examine transcriptional regulation of the rat eIF4E gene, 2.1 kB of the rat eIF4E promoter region was cloned and the contribution of speci®c elements in regulating transcription was determined in primary cultures of rat cardiocytes and in a murine C2C12 myoblast cell line. Sequence analysis of the rat eIF4E promoter revealed 80% sequence similarity with human eIF4E. A putative distal E-box was found at 2230 bp and a proximal E-box was located at 277 bp upstream of the transcription start site. Consensus AP-1 motifs were found at 2839 and 2901 bp and designated as the proximal AP-1 site and distal AP-1 site, respectively. Transfection of reporter gene constructs into cardiocytes showed that deletion of the region between 2633 and 2318 bp produced a 3-fold increase in basal transcription as compared to the 2.1 kB eIF4E promoter construct. Further deletion of the distal E-box region had no effect on transcription as compared with the 2.1 kB promoter, but deletion of both E-boxes eliminated transcriptional activity. Similar results were obtained in C2C12 myoblasts. To further investigate transcriptional regulation, point mutations were made in the 2.1 kB eIF4E promoter. Mutation of either the distal or proximal E-box had minimal effects on activity in either cell type, but mutation of the distal AP-1 site signi®cantly reduced eIF4E promoter activity by 66 ^ 4% in cardiocytes. In C2C12 myoblasts, mutating the distal AP-1 site reduced activity by 30 ^ 4% We conclude that both Eboxes are required for maximal basal activity of the eIF4E promoter, and that the distal AP-1 motif may activate transcription. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Translation; Protein synthesis; Initiation factors; Hypertrophy

1. Introduction Eukaryotic initiation factor 4F (eIF4F) has a central role in regulating translational initiation by catalyzing the binding of mRNA to the 40 S ribosome subunit (Gingras et al., 1999). eIF4F is a protein complex that consists of three primary components: eIF4E which binds to the 7-methylguanosine cap (7m-Gppp) cap of the mRNA, eIF4A which functions as an ATP-dependent RNA helicase to unwind mRNA secondary structure, and eIF4G, which is a scaffolding protein that contains binding sites for eIF4E and eIF4A. Abbreviations: AP-1, Activating Protein 1; BES, N, N-bis-(2-Hydroxyethyl)-2-aminoethanesulfonic acid; dCTP, 2 0 -deoxyctosine 5 0 -triphosphate; eIF, eukaryotic initiation factor; MEM, Minimal essential medium; PCR, Polymerase chain reaction; 7m-Gppp, 7-methylguanosine cap1 * Corresponding author. Tel.: 11-843-577-5011, ext. 6839; fax: 11-843876-5068. E-mail address: [email protected] (P.J. McDermott).

Other proteins such as poly(A) binding protein (Pab1p) and Mnk-1 and Mnk-2 (MAP kinase signal-integrating kinases) bind to eIF4G and modify the activity of eIF4F (Gingras et al., 1999; Sachs and Varani, 2000). In order for each of the eIF4F components to function, prior assembly of the complex is required. Several determinants affect eIF4F assembly. First, eIF4E is the least abundant of the 4F proteins and therefore is a limiting component for eIF4F assembly (Hershey, 1994). Second, the accessibility of eIF4E is regulated by eIF4E binding proteins (4E-BP) that compete with eIF4G for a common binding site on eIF4E and sequesters it from assembling into eIF4F complexes (Mader et al., 1995). Third, covalent modi®cations of eIF4E and/or eIF4G may regulate eIF4F assembly or stabilize the eIF4F complex (Morino et al., 2000; Bu et al., 1993). Collectively, it is evident that controlling the amount and/or accessibility of eIF4E is pivotal for regulating eIF4F complex formation.

0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00399-7

2

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

A large body of evidence indicates that eIF4E expression is upregulated in response to growth promoting stimuli, although mostly in the context of mitotic growth. When eIF4E is overexpressed in HeLa or NIH 3T3 cells, there is a loss of growth control and malignant transformation can occur (De Benedetti and Rhoads, 1990; Rosenwald, 1996). Depletion of eIF4E by expression of antisense RNA in HeLa cells decreased the rate of protein synthesis and slowed the rate of growth (De Benedetti et al., 1991). The relationship between proliferative growth and eIF4E expression is underscored by studies showing that eIF4E is increased in a wide variety of transformed cell lines (Miyagi et al., 1995b). Although the exact mechanism has not been elucidated, it has been hypothesized that an increase in eIF4E levels in transformed cells selectively enhances the translational ef®ciency of mRNAs encoding proteins that are critically involved in proliferative growth (De Benedetti and Harris, 1999). For example, mRNAs such as ®broblast growth factor 2 (FGF-2), cyclin D1 and ornithine decarboxylase require the helicase activity of the eIF4F complex to melt excessive secondary structure in the 5 0 -untranslated region and thereby remove inhibitory constraints for translation. These ®ndings have been extended to malignant transformation in humans; eIF4E expression is increased in tumors derived from squamous cell carcinomas and in lymphomas (De Benedetti and Harris, 1999; Haydon et al., 2000; Nathan et al., 1997; Wang et al., 1999). Further evidence suggests that detection of increased eIF4E expression in the surgical margins following tumor removal may be a useful predictor of the incidence of recurrence (Nathan et al., 1997). eIF4E expression is controlled by transcriptional mechanisms (Rosenwald et al., 1993). The regulatory elements of both the human and murine eIF4E gene have been cloned and the minimal promoter region has been de®ned (Jones et al., 1996). The core promoter lacks a TATA box, but a unique pyrimidine rich element has been identi®ed that is necessary for activity (Johnston et al., 1998). The element binds two novel transcription factors present in nuclear extracts termed eIF4E-regulatory factors (eIF4E-RFs). In addition, the core promoter contains a conserved pair of E-box consensus sequences CACGTG that correspond to the canonical c-myc binding sequence (Jones et al., 1996). Mutations in these sequences indicate their necessity for maximal activation of the core promoter (Jones et al., 1996; Schmidt, 1999). The eIF4E gene is a target of the cmyc protein, a conclusion supported by data showing that eIF4E expression correlates with c-myc levels following growth induction and that overexpression of c-myc in rat embryo ®broblasts led to the up-regulation of eIF4E expression (Rosenwald et al., 1993). Furthermore, c-myc may control the expression of eIF4E indirectly by regulating the expression of eIF4E-RFs. (Johnston et al., 1998). In this study, we examined the promoter elements that control the activity of the eIF4E gene in neonatal rat cardiocytes in primary culture. Sustained growth of cardiocytes

is associated with an increase in eIF4E mRNA and protein levels that correlates with an increase in the ribosome pool and accelerated rates of protein synthesis (Makhlouf and McDermott, 1998). Because the mRNA pool is not ratelimiting for protein synthesis, eIF4E levels may be a critical determinant of the ef®ciency of protein synthesis in cardiocytes as individual mRNAs must compete for a limited pool of ribosomes to initiate translation. As indicated above, the regulation of eIF4E promoter activity has been examined by using transformed cell lines. Since cardiocytes withdraw from the cell cycle and become terminally differentiated, we tested whether speci®c elements that regulate transcriptional activity of the eIF4E promoter in mitotically-competent cells are functional in cardiocytes. Our approach was to isolate the promoter region of the rat eIF4E gene and characterize its activity by transfecting eIF4E reporter gene constructs into cardiocytes and C2C12 myoblasts. These studies show that both E-box motifs are required for maximal basal activity of the eIF4E promoter in cardiocytes, and that a functional Activating Protein 1 (AP-1) motif may be required to activate transcription. Given that AP-1 factors stimulate gene expression in hypertrophying cardiocytes (Bishopric et al., 1992; Harsdorf et al., 1997), the results indicate that increasing eIF4E expression may involve a mechanism by which AP-1 directly activates transcription of the eIF4E gene.

2. Materials and methods 2.1. Cloning of the eIF4E gene The eIF4E gene was cloned from a rat genomic library in l-FIX II vector (Stratagene, LaJolla, CA). The initial screening was carried out using probes derived from sequences encoding exons 1, 2 and 3 of the eIF4E gene. The cDNA probes were generated by the polymerase chain reaction (PCR) using 32P-a-dCTP and a full length eIF4E cDNA clone isolated from a l-Zap II cDNA library. The probe for exon 1 was made using the following primers: 5 0 -CCTCTCGCCCCCCCTTCAG-3 0 and 5 0 -TTCCGGTTCCACAGTCGCCAT-3 0 , which resulted in the ampli®cation of bases 1 through 69 of rat eIF4E cDNA (Miyagi et al., 1995a). Probe for exons 2 and 3 was made by amplifying bases 114 through 669 using primers: 5 0 -GCAATCTAATCAGGAGGTTGC-3 0 and 5 0 -GCTCTTAGTAGCTGTGTCTGCG-3 0 . For screening of the eIF4E promoter, a probe corresponding to bases 2143 to 195 of the human eIF4E gene was prepared as follows: DNA was ampli®ed from the human genomic library by PCR using the following primers: 5 0 -AAGCCTCTCGTTACTCACGC-3 0 and 5 0 -AGTCAGAAGGAAGACGGAGC-3 0 . The resulting fragment was subcloned into pT7 blue vector (Novagen, Madison, WI) and sequenced to con®rm its identity. This subclone was used as a template in PCR reactions for generating radiolabeled cDNA probes for the eIF4E gene.

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

2.2. Subcloning of the bacteriophage clone Positive plaques were subjected to a second and third round of screening to obtain a bacteriophage clone. The lDNA was puri®ed and partially digested with SacI to produce overlapping fragments. The fragments were subcloned into the SacI site of pGEM3Zf- (Promega, Madison, WI) and 14 subclones were screened for the presence of eIF4E exons by complete digestion with SacI, followed by Southern blotting and hybridization to the cDNA probes. A subclone containing exon 1 and 2.1 kB of the 5 0 upstream region was identi®ed and called H10S10. Mapping of this subclone was performed by restriction enzyme digestion. For sequencing, the corresponding fragments were subcloned into pBlueScript (Stratagene, LaJolla, CA). 2.3. Preparation of reporter gene constructs For creation of the eIF4E-luciferase reporter gene constructs, we took advantage of the unique ClaI site in the ®rst eIF4E exon at 16 of the open reading frame. A cDNA fragment containing the 5 0 upstream region and portion of the ®rst exon was excised by digestion with EcoRI and ClaI and subcloned into pBlueScript to generate pEC4E. To produce the deletion constructs p4E2106L, p4E1337L, p4E1037L, p4E633L and p4E318L, the promoter fragments were excised from pEC4E using XhoI together with either SmaI, SnaBI, XbaI, KpnI or SacI respectively, and ligated into the multiple cloning site of pGL2 (Promega, Madison, WI) at compatible sites. (The sites were SmaI for p4E2106L and p4E1337L, NheI for p4E1037L, KpnI for p4E638L and SacI for p4E318L). For the deletion constructs shorter than 300 bp, the promoter fragment was ampli®ed by PCR using pEC4E as template, an oligonucleotide for the T7 promoter as reverse primer and oligonucleotide primers with KpnI or SacI linkers at the 5 0 end. The sequences of the oligonucleotides are shown in Table 1. The PCR-generated fragments were cut with XhoI and either KpnI or SacI, and ligated into pGL2 (Promega, Madison, WI). All of the deletion constructs were con®rmed by DNA sequencing. Lastly, for the construct containing the

3

600 bp intron, cDNA fragment was ampli®ed via PCR from H10S10 using speci®c primers with BamHI sites appended at their 5 0 ends and ligated into the BamHI enhancer site of pGL2 to form p4E 1 616. 2.4. Mutagenesis of the eIF4E promoter The QuickChange mutagenesis kit (Stratagene, LaJolla, CA) was used to generate site directed mutations in the eIF4E promoter using the primers shown in Table 1. The full length promoter construct p4E2106L was used as the template. All mutations were con®rmed by DNA sequencing. 2.5. Preparation of primary neonatal cardiocytes Cardiocytes were isolated from minced ventricular myocardium of 2 to 4 day-old rats by a combination of mechanical stirring and enzymatic digestion as described before (McDermott and Morgan, 1989). The isolated cells were enriched for cardiocytes by differential adhesion and plated at a density of 100,000 cells/cm 2 in minimal essential medium (MEM) (GibcoBRL, Grand Island, NY) supplemented with 10% newborn calf serum. Following an overnight incubation, the cardiocytes were rinsed and maintained in serum-free media as described before (McDermott and Morgan, 1989). 2.6. Transient transfection assays Basal transcription was measured by transient transfection of the eIF4E-luciferase reporter constructs and normalized for transfection ef®ciency by co-transfection of pON249, a plasmid consisting of the b-galactosidase gene driven by the human cytomegalovirus (CMV) promoter. Cardiocyte cultures were maintained for 2 days and prepared for transfection by a 4 h incubation in MEM supplemented with 4% horse serum. To each 60 mm culture dish, 500 ml of a solution containing 16 mg of pON249, 16 mg of one of the eIF4E-luciferase reporter constructs, 0.25 M CaCl2 and 25 mM N,N-bis-(2-Hydroxyethyl)-2aminoethanesulfonic acid (Calbiochem, SanDiego, CA)

Table 1 Oligonucleotide primers for generating eIF4E-luciferase reporter gene constructs Promoter construct

Sequence (5 0 ±3 0 )

p4E281L p4E207L p4E149L p4E101L p4E69L p4E 1 616L

CCTAAAACGAGCTCTGCAGGAAGTGCGGGC CGTGATCACTTGGTACCTTGGGAGAAAAAACTTCC TTTTCGGTACCGATCACTTTTTTTTTTTTTTGGGAG CTTGCGCAGGCGGTACCAGGGCCAAACGGACACGTC CCGTCCAGGTACCAGGAGCCGGCCAATCC GTTACAGGATCCGTGAGTATTGCCTTCGGCATGACGGATCCGTGCTCTCCACTCAACGCCA

p4E-mAP(901) p4E-mAP(839) p4E-mE(230) p4E-mE(77)

CGCCTAAGGAGCAGGTACCAACGTCAAGAGCTCTTGACGTTGGTACCTGCTCCTTAGGCG CAGTCCAGGGCGGTACCAGCGGAGCCCGGGCTCCGCTGGTACCGCCCTGGACTG CTCGCCAGCGACACTCTGATCACTTTTTTTTTTTAAAAAAAAAAAGTGATCAGAGTGTCGCTGGCGAG GACACGTCCGTACTCTGGGCAGGAGCCGCCTCCTGCCCAGAGTACGGACGTGTC

4

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

was added. For enhanced transfection, 50 ml/well of CalPhos optimizer (Clontech, Palo Alto, CA) was added. The cardiocytes were incubated in 3% CO2 atmosphere and then rinsed with serum-free medium until a precipitate was no longer visible under phase contrast microscopy. The cells were maintained in serum-free medium for 48 h after transfection. Luciferase activity was measured using a commercial luciferin assay kit (Promega, Madison, WI). b-galactosidase activity was determined colorimetrically using the O-nitrophenyl-3-d-galactopyranoside method (Knowlton et al., 1991). The myoblast cell line C2C12 was maintained in DMEM supplemented with 20% fetal calf serum. Subcon¯uent C2C12 cultures were transfected as follows: 4.5 mg of eIF4E-luciferase reporter and 1.5 mg pON249 were mixed with Superfect Reagent (Qiagen, Valencia, CA) in MEM. After incubation at room temperature, the solution was brought to 2.1 ml with MEM and 700 ml aliquots were applied in triplicate onto 35 mm culture dishes. Following a 3 h incubation, the transfection mixture was removed and regular growth media was added. The cells were harvested after 48 h for measurements of luciferase and b-galactosidase activity.

3. Results and discussion 3.1. Cloning of the rat eIF4E gene To investigate how eIF4E expression is regulated in neonatal rat cardiocytes, a rat genomic library was screened to isolate the promoter region of the eIF4E gene. Initial screening of the bacteriophage l rat genomic library with probes corresponding to eIF4E cDNA sequences yielded several candidate clones that were subcloned and partially sequenced. DNA isolated from three different subclones was used for Southern blotting with eIF4E cDNA probes, and their sequences matched with rat cDNA. However, all three subclones did not possess any introns in the coding region, but instead included one or more mutations that disrupted the open reading frame. These data suggest that at least three distinct eIF4E pseudogenes might exist in rats. None of these pseudogenes displayed any sequence similarity to the 5 0 upstream region of the recently discovered human eIF4E2 gene (Gao et al., 1998). To circumvent the problem of eIF4E pseudogenes, the library was screened again with a probe corresponding to a partial clone of the human eIF4E promoter that was ampli®ed by PCR from a human genomic library. Two rounds of screening yielded a candidate clone from which 14 subclones of overlapping regions of the bacteriophage insert were obtained (Fig. 1A). A low resolution restriction map indicated an approximate size of 20 kB for the bacteriophage clone. Sequencing of the 5 0 and 3 0 ends of the largest subclone revealed the presence of the multiple cloning sites of the l-FixII vector, indicating that the whole

bacteriophage insert was subcloned into pGEM3Zf-. To con®rm the presence of eIF4E exons, the subclones were digested with SacI and probed by Southern blotting for different regions of the eIF4E cDNA sequence. As shown in Fig. 1B, one fragment of approximately 2.1 kB in length hybridized to the cDNA probe. Mapping and sequencing demonstrated the presence of the 5 0 ¯anking sequence and ®rst exon of the eIF4E gene, with the remainder of the fragment consisting of intron 1 (Fig. 1C,D). Since the cDNA probe failed to hybridize to any other fragments, this indicated a minimum length of 15 kB for the ®rst intron of the eIF4E gene. This ®nding is consistent with the structure of the human eIF4E gene whose ®rst intron is greater than 10 kB in size. Failure of the probe to detect exon 2 was not due to unsuitable hybridization conditions since it was able to hybridize to a full length eIF4E cDNA plasmid (data not shown). 3.2. Characterization of the rat eIF4E gene Sequence analysis of the 5 0 upstream region is shown in Fig. 2. The 35 base sequence designated as exon 1 matched the rat eIF4E cDNA sequence exactly (Miyagi et al., 1995a). As compared to the human eIF4E promoter, the exon 1 sequence matched 34 out of 35 bases and has the same consensus splice donor sequence ACCGGTGAGT at the boundary between exon 1 and the ®rst intron. The transcription start site in the murine and human eIF4E promoter is between 216 and 219 of the initiation codon (Jaramillo et al., 1991; Jones et al., 1996). Given that the region preceding the AUG codon in the rat gene is virtually identical to other mammalian species, this study uses the same numbering scheme as that used for the human eIF4E promoter (Jones et al., 1996). The MatInspector computer algorithm (Version 2.2) was used to identify sequences in the eIF4E promoter region corresponding to consensus DNA motifs targeted by vertebrate transcription factors (Quandt et al., 1995). The cut off for core sequence homologies was set at 0.75. As shown in Fig. 2, the underlined sequences are antisense homologies, and the overlined sequences represent sense homologies. The eIF4E gene does not possess an initiator sequence or TATA box, but it has a consensus CCAAT box at 259 from transcription start site (Mantovani, 1998). In addition, the rat eIF4E gene contains the pyrimidine rich element 5 0 -TCTCGCCCCCCCTT-3 0 from 230 to 217, which is required for maximal promoter activity and functions as a binding site for eIF4E-RFs (Johnston et al., 1998). Comparison of the 5 0 ¯anking sequences of rat eIF4E (21040 to 1215) with the human eIF4E promoter (21041 to 1220) reveals 81% sequence similarity and the presence of conserved motifs (Fig. 3A). The same region of the mouse eIF4E promoter is 92% similar to the rat gene. The two E-boxes (CACGTG) that were identi®ed in both the mouse and human eIF4E promoters are conserved in the rat eIF4E gene at 277 and 2230 relative to exon 1 (Fig. 3B).

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

5

Fig. 1. Mapping of the eIF4E genomic clone. (A) Agarose gel electrophoresis of 12 subclones digested with SacI. (B) Southern blot of the agarose gel with a cDNA probe corresponding to exons 1 through 3. The hybridized fragment is indicated by the arrow. (C) Low resolution map of the eIF4E phage clone. The relative positions of the SacI sites were determined by comparison of the fragments obtained in A. The orientation was determined by sequencing of the 5 0 and 3 0 ends, 5 0 FS ˆ 5 0 ¯anking sequence. (D) Higher resolution map of region surrounding the ®rst exon (indicated by the arrow). The restriction sites used to generate the 5 0 truncation constructs are indicated.

The region extending from 21043 to 2800 exhibits high sequence similarity, including two AP-1 consensus motifs (TGA G/CTCA) in the rat promoter at 2901 and 2839. These motifs correspond to an AP-1 motif at 2907 and an AP-1-like site at 2845 in the human 5 0 ¯anking sequence, respectively. Similar to human eIF4E, exon 1 is 35 bp long. Furthermore, the ®rst intron is larger than 15 kB, in agreement with previous ®ndings showing that the human eIF4E gene spans 50 kB, at least 10 kB of which consists of intron

1 (Gao et al., 1998). This conservation of gene structure extends through the coding sequence which is 95% similar between humans and rodents at the amino acid level. The similarity remains high for X. laevis, but drops to 43% with D. melanogaster. Interestingly, most of the differences between species occur in the region encoded by exons 1 and 2, which does not include the cap binding region. The Drosophila gene encodes 2 proteins through alternative splicing of the 5 0 end, and it has been suggested that exon 1

6

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

Fig. 2. Sequence of the rat eIF4E promoter. The sequence numbers are from the transcription start site. The ®rst exon is boxed. Putative transcription factor binding sites are indicated (the name of the transcription factor is given). These were matched by the MatInspector computer algorithm against the TRANSFAC vertebrate database of binding matrices. Matches occurring on the minus strand are also included. Matches to transcription factors that are not expressed in the heart were excluded.

could be an evolutionary addition in vertebrates (Lavoie et al., 1996). 3.3. Analysis of the eIF4E deletion mutants To examine transcriptional regulation of the eIF4E

promoter in neonatal rat cardiocytes, a series of deletion mutants were made and ligated into luciferase reporter gene constructs. As shown in Fig. 4, successive deletions of the eIF4E promoter region from 22106 to 2633 did not signi®cantly affect basal transcriptional activity in the cardiocytes. Deletion of the region between 2633 and 2318

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

resulted in a 3-fold increase in activity (p4E318L), indicating that inhibitory sequences are present in the contiguous region upstream of the distal E-box. Successive deletions

7

downstream to 269 (p4E69L) caused signi®cant reductions in basal transcription to levels slightly above background as measured by transfection of the promoter-less pGL2

Fig. 3. Sequence comparison of the human and rat eIF4E promoters. (A) Sequence alignment of the human and rat eIF4E genes including the promoter region, exon1 and part of the ®rst intron. Positions are from the transcription start site (indicated by arrow). (B) Schematic illustration comparing the position and sequence of the conserved CCAAT, AP-1 and E-Box elements in the rat and human eIF4E promoters.

8

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

Fig. 4. Functional analysis of the rat eIF4E promoter by transient transfection of deletion constructs into neonatal rat cardiocytes. The deletion mutants are presented schematically. E ˆ E-boxes, A ˆ AP-1. The luciferase/b-galactosidase values are expressed as % activity relative to the activity of p4E2106L, which is set at 100%. The data represent the mean ^ SE from at least three experiments. *P , 0:05 compared to p4E2106L as determined by a two-tailed, paired t-test.

construct. This loss of transcriptional activity coincides with deletion of the proximal E-box element, although p4E69L contains the consensus CCAAT box and the eIF4E-RF binding site. Lastly, no signi®cant change in activity was detected in cardiocytes when the 600 bp intron region was tested for the presence of enhancer elements by ligating it into the enhancer cloning site of the pGL2. Taken together, the results indicate that the proximal Ebox is required for basal transcription of the eIF4E promoter in the cardiocyte, and that both E-box elements are required

for maximal promoter activity. This conclusion is consistent with previous results showing that the proximal 400 bp region of the human eIF4E promoter is suf®cient for maximal activity in transformed cell lines (Jones et al., 1996). The minimal eIF4E promoter region in cardiocytes contains several possible regulatory elements including the proximal E-box, a CCAAT box, the pyrimidine rich eIF4E-RF binding site, and putative binding sites for nuclear factor 1 (NF1). It has been reported that an E-box and an NF-1 like element are required for the activation of a TATA-less mini-

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

9

Fig. 5. Functional analysis of the rat eIF4E promoter by transient transfection of deletion constructs into murine C2C12 cells. The deletion mutants are presented schematically. E ˆ E-boxes, A ˆ AP-1. The luciferase/b-galactosidase values are expressed as % activity relative to the activity of p4E2106L, which is set at 100%. The data represent the mean ^ SE from at least three experiments. *P , 0:05 compared to p4E2106L as determined by a two-tailed, paired t-test.

mal promoter (Miyagoe et al., 1994), while the proximity of the CCAAT box to the transcription start site in eIF4E is typical of TATA-less promoters (Mantovani, 1998). In contrast to studies of the human eIF4E promoter, the eIF4E-RF binding site in the rat eIF4E promoter (230 to 217) does not appear to be suf®cient for basal transcription in cardiocytes because the deletion construct p4E69L has no activity. However, we have not examined the necessity of the eIF4E-RF element by mutating it in the context of the 2.1 kB promoter construct. In control experiments, the transcriptional activity of the wild-type p4E2106L reporter

construct was compared directly with the Atrial Natriuretic Factor (ANF) promoter, a 638 bp luciferase reporter construct whose activity is well documented in neonatal rat cardiocytes (Knowlton et al., 1991; Makhlouf and McDermott, 1998). To normalize for transfection ef®ciency, the cardiocytes were co-transfected with pON249, a plasmid which consists of the b-galactosidase gene driven by the constitutively active CMV promoter. Luciferase activity (RLU) normalized b-galactosidase activity was :032 ^ 007 in cardiocytes transfected with the ANF reporter gene, and :053 ^ 014 upon transfection with p4E2106L

10

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

(n ˆ 5). Thus, transcriptional activity of the eIF4E promoter was actually higher than ANF, although the difference did not achieve statistical signi®cance. The deletion constructs were also tested in the murine myoblast cell line C2C12 in order to examine the regulation of the eIF4E promoter in muscle cells that maintain the capacity to divide. As shown in Fig. 5, the regulatory elements that control basal transcription in C2C12 cells appear to be similar to those in terminally differentiated cardiocytes. In particular, the region between 2633 and 2318 had an inhibitory effect on basal activity, and deletion of both E-boxes resulted in a signi®cant loss of activity. These results show that: (1) the rat eIF4E promoter is activated in murine cells and (2) the regulatory elements in the rat eIF4E promoter that are required for basal transcription are the same in mitotically-competent skeletal myoblasts.

did not affect basal activity. However, the effect of mutating the proximal E-box was small, suggesting that it is not required for basal promoter activity. In the human eIF4E promoter, the E-box motifs have a more prominent role as a linker scanning mutation in the proximal element showed that it is essential for activity (Johnston et al., 1998). Considering the extent of sequence similarity, the reason for this discrepancy has not been determined. One possibility is the context in which the point mutations of the Eboxes were examined. The E-Boxes were mutated in the p4E-2106L construct, which contains 2.1 kB of the rat eIF4E promoter and includes a third consensus E-box motif at 21228. In contrast, the human eIF4E promoter was examined by mutating elements in a 230 bp minimal promoter. Given the number of potential regulatory motifs in p4E-2106L, it is logical to assume that some of these

3.4. Analysis of the eIF4E point mutants To further investigate transcriptional regulation of the eIF4E gene in cardiocytes, point mutations were made in the p4E2106L reporter construct (Fig. 6A). The proximal and distal E-boxes were mutated by replacing the CACGTG core motif with a sequence of ACTCTG. Mutation of the distal E-box (p4E-mE230) had no effect on basal activity, while mutation of the proximal E-box (p4E-mE77) resulted in small, but statistically signi®cant, loss of activity. To investigate the role of the distal AP-1 site, the corresponding sequence at 2940 was mutated from TGAGTCA to the sequence GGTACCA (p4E-mAP901). A similar mutation has been shown to abolish AP-1 binding in cardiocytes (Harsdorf et al., 1997). This point mutation signi®cantly reduced promoter activity by 66 ^ 4%, even though basal activity was not affected by deleting the eIF4E gene down to 2633. The reason for this discrepancy has not been determined. Successive deletions of the eIF4E promoter may have eliminated regulatory sequences that are capable of suppressing transcription of the eIF4E gene in the absence of a functional AP-1 site. In contrast, mutating the proximal AP-1 from TGAGTCA to GGTACCA (p4E-mAP839) produced a 65 ^ 24% increase in activity that did not achieve statistical signi®cance. Because this mutation inadvertently introduced an SP-1 site just upstream of the AP-1 site, another site directed mutant with the sequence AGTGCCA was tested. No signi®cant change in activity was detected (data not shown). In Fig. 6B, the same point mutants were tested by transfection into C2C12 myoblasts. The results were similar to Fig. 6A except that mutating the distal AP-1 site caused a more modest reduction of 30 ^ 4%. The sequence of the conserved E-boxes in eIF4E (CACGTG) is speci®cally targeted by the basic helixloop-helix transcription factors myc, max and USF (Upstream Stimulatory Factor). Point mutations indicate that only the proximal E-box contributes to eIF4E promoter activity in cardiocytes, while mutation of the distal E-box

Fig. 6. Mutational analysis of AP-1 and E-box elements in the rat eIF4E promoter by transient transfection of luciferase reporter plasmids. (A) Neonatal rat cardiocytes transiently transfected with the point mutations as indicated. (B) Murine C2C12 cells transfected with the same plasmids. The mutations are indicated by the letters mAP for mutated AP-1 and mE for the mutated E-Boxes, respectively. The location of the mutation is indicated in parenthesis. The luciferase/b-galactosidase values are expressed as % activity relative to the activity of p4E2106L, which is set at 100%. The data represent the mean ^ SE from at least three experiments. *P , 0:05 compared to p4E2106L as determined by a two-tailed, paired ttest.

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

elements compensated for the functional loss of the Eboxes. Activating Protein 1 (AP-1) is a group of transcription factors composed of homodimers or heterodimers of c-jun, c-fos, or ATF (Activating Transcription Factor) family proteins (Faisst and Meyer, 1992). During hypertrophic growth of cardiocytes, AP-1 factors are activated by increasing the expression of c-fos and c-jun or by increasing the speci®c activity of c-jun via Jun N-terminal kinase (Komuro et al., 1996; Yamazaki et al., 1995). AP-1 factors regulate the expression of several classes of genes associated with cardiac hypertrophy and remodeling (Bishopric et al., 1992; Harsdorf et al., 1997). The present study indicates that a conserved AP-1 element increases activity of the eIF4E promoter in neonatal rat cardiocytes. These studies suggest that the increase in eIF4E expression observed in hypertrophying cardiocytes may involve a mechanism by which AP-1 directly activates the transcription of the eIF4E gene. In summary, 2.1 kB of the rat eIF4E promoter has been cloned and shown to have a high degree of sequence similarity as compared with mouse and human eIF4E. Transient transfections of eIF4E reporter gene constructs indicate that maximal transcriptional activity is obtained using the proximal 318 bp of the promoter region, and deletion of the proximal and distal E-boxes coincide with the loss of basal activity. Point mutations in the 2.1 kB eIF4E promoter indicate that other regulatory elements may compensate for the loss of the E-box boxes. Mutation of a consensus AP-1 site causes a signi®cant loss of transcriptional activity, suggesting that it may have a role in regulating transcription of the eIF4E gene in rat cardiocytes. By regulating eIF4E expression, these elements may be a critical component of the growth response in cardiocytes. Acknowledgements This work was supported by a Merit Review Award from the Research Service of the Department of Veterans Affairs. References Bishopric, N.H., Jayasena, V., Webster, K.A., 1992. Positive regulation of the skeletal alpha-actin gene by Fos and Jun in cardiac myocytes. J. Biol. Chem. 267, 25535±25540. Bu, X., Haas, D.W., Hagedorn, C.H., 1993. Novel phosphorylation sites of eukaryotic initiation factor-4F and evidence that phosphorylation stabilizes interactions of the p25 and p220 subunits. J. Biol. Chem. 268, 4975±4978. De Benedetti, A., Harris, A.L., 1999. eIF4E expression in tumors: its possible role in progression of malignancies. Int. J. Biochem. Cell Biol. 31, 59±72. De Benedetti, A., Rhoads, R.E., 1990. Overexpression of eukaryotic protein synthesis initiation factor 4E in HeLa cells results in aberrant growth and morphology. Proc. Natl. Acad. Sci. USA 87, 8212±8216. De Benedetti, A., Joshi-Barve, S., Rinker-Schaeffer, C., Rhoads, R.E.,

11

1991. Expression of antisense RNA against initiation factor eIF-4E mRNA in HeLa cells results in lengthened cell division times, diminished translation rates, and reduced levels of both eIF-4E and the p220 component of eIF-4F. Mol. Cell. Biol. 11, 5435±5445. Faisst, S., Meyer, S., 1992. Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res. 20, 3±26. Gao, M., Rychlik, W., Rhoads, R.E., 1998. Cloning and characterization of human eIF4E genes. J. Biol. Chem. 273, 4622±4628. Gingras, A., Raught, B., Sonenberg, N., 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev. Physiol. 68, 913±963. Harsdorf, R., Edwards, J.G., Shen, Y.T., Kudej, R.K., Dietz, R., Leinwand, L.A., Nadal-Ginard, B., Vatner, S.F., 1997. Identi®cation of a cis-acting regulatory element conferring inducibility of the atrial natriuretic factor gene in acute pressure overload. J. Clin. Invest. 100, 1294±1304. Haydon, M.S., Googe, J.D., Sorrells, D.S., Ghali, G.E., Li, B.D.L., 2000. Progression of eIF4E ampli®cation and overexpression in benign and malignant tumors of the head and neck. Cancer 88, 2803±2810. Hershey, J.W.B., 1994. Expression of initiation factor genes in mammalian cells. Biochimie 76, 847±852. Jaramillo, M., Pelletier, J., Edery, I., Nielsen, P.J., Sonenberg, N., 1991. Multiple mRNAs encode the murine translation initiation factor eIF-4E. J. Biol. Chem. 266, 10446±10451. Johnston, K.A., Polymenis, M., Wang, S., Branda, J., Schmidt, E.V., 1998. Novel regulatory factors interacting with the promoter of the gene encoding the mRNA cap binding protein (eIF4E) and their function in growth regulation. Mol. Cell. Biol. 18, 5621±5633. Jones, R.M., Branda, J., Johnston, K.A., Polymenis, M., Gadd, M., Rustgi, A., Callanan, L., Schmidt, E.V., 1996. An essential E box in the promoter of the gene encoding the mRNA cap- binding protein (eukaryotic initiation factor 4E) is a target for activation by c-myc. Mol. Cell. Biol. 16, 4754±4764. Knowlton, K.U., Baracchini, E., Ross, R.S., Harris, A.N., Henderson, S.A., Evans, S.M., Glembotski, C.C., Chien, K.R., 1991. Co-regulation of the atrial natriuretic factor and cardiac myosin light chain-2 genes during alpha-adrenergic stimulation of neonatal rat ventricular cells. Identi®cation of cis sequences within an embryonic and a constitutive contractile protein gene which mediate inducible expression. J. Biol. Chem. 266, 7759±7768. Komuro, I., Kudo, S., Yamazaki, T., Zou, Y., Shiojima, I., Yazaki, Y., 1996. Mechanical stretch activates the stress-activated protein kinases in cardiac myocytes. FASEB J. 10, 631±636. Lavoie, C.A., Lachance, P.E.D., Sonenberg, N., Lasko, P., 1996. Alternatively spliced transcripts from the Drosophila eIF4E gene produce two different Cap-binding proteins. J. Biol. Chem. 271, 16393±16398. Mader, S., Lee, H., Pause, A., Sonenberg, N., 1995. The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4g and the translational repressors 4E-binding proteins. Mol. Cell. Biol. 15, 4990±4997. Makhlouf, A.A., McDermott, P.J., 1998. Increased expression of eukaryotic initiation factor 4E during growth of neonatal rat cardiocytes in vitro. Am. J. Physiol. 274, H2133±H2142. Mantovani, R., 1998. A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res. 26, 1135±1143. McDermott, P.J., Morgan, H.E., 1989. Contraction modulates the capacity for protein synthesis during growth of neonatal heart cells in culture. Circ. Res. 64, 542±553. Miyagi, Y., Kerr, S., Sugiyama, A., Asai, A., Shibuya, M., Fujimoto, H., Kuchino, Y., 1995a. Abundant expression of translation initiation factor EIF-4E in post-meiotic germ cells of the rat testis. Lab. Invest. 73, 890± 898. Miyagi, Y., Sugiyama, A., Asai, A., Okazaki, T., Kuchino, Y., Kerr, S.J., 1995b. Elevated levels of eukaryotic translation initiation factor eIF-4E mRNA in a broad spectrum of transformed cell lines. Cancer Lett. 91, 247±252.

12

A.A. Makhlouf et al. / Gene 267 (2001) 1±12

Miyagoe, Y., Galibert, M.D., Georgatsou, E., Fourel, G., Meo, T., 1994. Promoter elements of the mouse complement C4 gene critical for transcription activation and start site location. J. Biol. Chem. 269, 8268± 8279. Morino, S., Imataka, H., Svitkin, Y.V., Pestova, T.V., Sonenberg, N., 2000. Eukaryotic translation initiation factor 4E (eIF4E) binding site and the middle one-third of eIF4GI constitute the core domain for cap-dependent translation, and the C-terminal one-third functions as a modulatory region. Mol. Cell. Biol. 20, 468±477. Nathan, C.A., Liu, L., Li, B.D., Abreo, F.W., Nandy, I., De Benedetti, A., 1997. Detection of the proto-oncogene eIF4E in surgical margins may predict recurrence in head and neck cancer. Oncogene 15, 579± 584. Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T., 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23, 4878± 4884. Rosenwald, I.B., 1996. Upregulated expression of the genes encoding trans-

lation initiation factors eIF-4E and eIF2a in transformed cells. Cancer Lett. 102, 113±123. Rosenwald, I.B., Rhoads, D.B., Callanan, L.D., Isselbacher, K.J., Schmidt, E.V., 1993. Increased expression of eukaryotic translation initiation factors eIF- 4E and eIF-2 alpha in response to growth induction by cmyc. Proc. Natl. Acad. Sci. USA 90, 6175±6178. Sachs, A.B., Varani, G., 2000. Eukaryotic translation initiation: there are (at least) two sides to every story. Nat. Struct. Biol. 7, 356±361. Schmidt, E.V., 1999. The role of c-myc in cellular growth control. Oncogene 18, 2988±2996. Wang, S., Rosenwald, I.B., Hutzler, M.J., Pihan, G.A., Sava, L., Chen, J.J., Woda, B.A., 1999. Expression of the eukaryotic translation initiation factors 4E and 2a in non-hodgkins lymphomas. Am. J. Pathol. 155, 247±255. Yamazaki, T., Komuro, I., Yazaki, Y., 1995. Molecular mechanism of cardiac cellular hypertrophy by mechanical stress. J. Mol. Cell. Cardiol. 27, 133±140.