Transcriptional response of Atlantic salmon (Salmo salar) after primary versus secondary exposure to infectious salmon anemia virus (ISAV)

Molecular Immunology 51 (2012) 197–209

Contents lists available at SciVerse ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Transcriptional response of Atlantic salmon (Salmo salar) after primary versus secondary exposure to infectious salmon anemia virus (ISAV) F. LeBlanc a , J.R. Arseneau a , S. Leadbeater b , B. Glebe b , M. Laflamme a , N. Gagné a,∗ a b

Department of Fisheries & Oceans Canada, Gulf Fisheries Center, Moncton, NB, Canada Department of Fisheries & Oceans Canada, St. Andrews Biological Station, St. Andrews, NB, Canada

a r t i c l e

i n f o

Article history: Received 21 April 2011 Received in revised form 5 March 2012 Accepted 6 March 2012 Available online 3 April 2012 Keywords: Salmo salar ISAV resistance Microarray Acquired immunity Secondary immune response Gene expression

a b s t r a c t Following an infection with a specific pathogen, the acquired immune system of many teleostean fish, including salmonids, is known to retain a specific memory of the infectious agent, which protects the host against subsequent infections. For example, Atlantic salmon (Salmo salar) that have survived an infection with a low-virulence infectious salmon anemia virus (ISAV) isolate are less susceptible to subsequent ISAV infections. A greater understanding of the mechanisms and immunological components involved in this acquired protection against ISAV is fundamental for the development of efficacious vaccines and treatments against this pathogen. To better understand the immunity components involved in this observed resistance, we have used an Atlantic salmon DNA microarray to study the global gene expression responses of preexposed Atlantic salmon (fish having survived an infection with a low-virulence ISAV isolate) during the course of a secondary infection, 18 months later, with a high-virulence ISAV isolate. We present global gene expression patterns in both preexposed and naïve fish, following exposure by either cohabitation with infected fish or by direct intra-peritoneal injection of a high-virulence ISAV isolate. Our results show a clear reduction of ISAV viral loads in head-kidney of secondary infected fish compared to primary infected fish. Further, we note a lower-expression of many antiviral innate immunity genes in the secondary infected fish, such as the interferon induced GTP-binding protein Mx, CC-chemokine 19 and signal transducer and activator of transcription 1 (STAT 1), as well as MHC class I antigen presentation involved genes. Potential acquired immunity genes such as GILT, leukocyte antigen transcript CD37 and Ig mu chain C region membrane-bound form were observed to be over-expressed in secondary infected fish. The observed differential gene expression profile in secondary and primary infected fish head-kidney provides great insight into immunity components involved during primary and secondary ISAV infection. © 2012 Elsevier Ltd. All rights reserved.

1. Introduction The infectious salmon anemia virus (ISAV) is a single stranded RNA virus from the Orthomyxoviridae family, which infects farmed Atlantic salmon (Salmo salar), resulting in major financial losses for salmon farmers around the world. Since its first occurrence in Norway in 1984 (Thorud and Djupvik, 1988), it has been identified in Canada (Bouchard et al., 1999; Lovely et al., 1999; Mullins et al., 1998), the United States (Bouchard et al., 2001), Scotland (Rodger and Richards, 1998; Rowley et al., 1999), the Faeroe Islands (Lyngrøy, 2003) and Chile (Kibenge et al., 2001). In recent years, improved management and husbandry practices have helped minimize the number of outbreaks in many of these countries, although the possibility of new outbreaks, such as the ongoing outbreak in

∗ Corresponding author at: Department of Fisheries & Oceans Canada, 343 University Ave., NB, Canada E1A 9B6. Tel.: +1 506 851 7478; fax: +1 506 851 2079. E-mail address: [email protected] (N. Gagné). 0161-5890/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2012.03.021

Chile (Godoy et al., 2008), is a looming threat to the entire industry and re-enforces the need for the development of economically feasible solutions against this pathogen. Over the past decade, appreciable amounts of information related to ISAV have been gained, notably the characterization of its genome (Clouthier et al., 2002) as well as the identification of numerous isolates exhibiting varying degrees of virulence (Mjaaland et al., 2005; Ritchie et al., 2009). To aid in the development of vaccines, treatments, as well as for the identification of potential ISAV resistant Atlantic salmon families, various groups have studied the host–pathogen interactions between Atlantic salmon and ISAV, at the transcriptional level, during the course of an infection (Jørgensen et al., 2007a; LeBlanc et al., 2010; Schiøtz et al., 2008; Workenhe et al., 2009). As is the case in most host–pathogen interactions, the perceived resistance of the host is highly dependent on both the virulence of the pathogen and the host’s innate capacity to mount an effective immune response against the pathogen. Data gathered from the Atlantic salmon–ISAV interactions studies, performed in vitro using

198

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

various salmonid cell lines (Jensen and Robertsen, 2002; Kileng et al., 2007; Schiøtz et al., 2008; Workenhe et al., 2009) and in vivo in Atlantic salmon infected with different ISAV isolates (Jørgensen et al., 2007a, 2007b; Kileng et al., 2007; LeBlanc et al., 2010), have all shown an appreciable up-regulation of many innate immunity genes during the course of the infection. Despite this strong antiviral response, the vast majority of fish succumb to infections with high-virulence ISAV isolates. The lack of protection offered by the innate immune system against ISAV is thought to be in part due to virulence factors in the virus, which permit the virus to evade the innate surveillance of the host (Garcia-Rosado et al., 2008; McBeath et al., 2006). As such, viral replication is essentially uninhibited and viral loads quickly spread to critical organs causing massive cellular damage before the host can mount an effective cell-mediated and humoral acquired response, which is believed to be crucial for virus clearance and host survival. On the other hand, studies done by Falk and Dannevig (1995) as well as Ritchie et al. (2009) have shown that Atlantic salmon having survived an infection with ISAV acquired some sort of immune memory that protected them against subsequent infections (Falk and Dannevig, 1995; Ritchie et al., 2009). A greater understanding of the mechanisms and immunity components that are activated and that confer resistance to secondary infections is critical to the development of new and highly effective vaccines. To interrogate the protective secondary immune response in preexposed fish, we used fish that had survived for over 18 months following an intra-peritoneal (ip) injection with a low-virulence ISAV isolate, and re-challenged these fish with a high-virulence ISAV isolate, either by cohabitation with infected (trojan) fish, or with an ip injection of the virus. Global gene expression patterns were measured with DNA microarrays using RNA extracted from head-kidney. Head-kidney was chosen based on this tissue’s proposed function as primary lymphoid organ with roles in both the innate and adaptive immune system including phagocytosis, antigen presentation and antigen specific memory lymphocyte production (Tort et al., 2003). A subset of genes of interest identified by microarray analysis was validated by RT-qPCR. 2. Materials and methods 2.1. ISAV viral cultures The low-virulence ISAV EU-HPR5 isolate (RPC/NB 04-085-1) used was kindly provided by the Research and Productivity Council (RPC) in Fredericton, Canada, while the high-virulence ISAV NAHPR4 isolate (CCBB) used during this experiment was cultured from Atlantic salmon head-kidney tissue obtained from a previous study (Ritchie et al., 2009) and replicated in vitro on monolayers of Salmon Head-Kidney (SHK) cells. The titer was determined according to the Spearman–Kärber method (Hierholzer and Killington, 1996) and the lysate was frozen until the challenge.

maintained in freshwater at 13 ◦ C and fed once per day to visual satiation until the second challenge, approximately 18 months later. These fish are herein referred to as “H5R”, for HPR5 resistant, whereas the naïve, sham-injected fish are referred to as “N”. Prior to the second challenge, 118 of the remaining H5R fish from Tank 1 and Tank 2, as well as the N fish from Tank 3 were moved to natural sea water tanks and left for 3 weeks to acclimatize. On November 25th 2008, the second challenge was performed using the high-virulence ISAV NA-HPR4 isolate. Before the start of the challenge, 5 N fish and 10 H5R fish were sampled, and head-kidney sections were removed aseptically from each fish, placed in individual tubes of RNAlater (Ambion, CA, USA) and stored at −20 ◦ C until RNA extractions. The second challenge consisted of ip injecting 40 H5R fish with 0.1 mL of 105 TCID50 mL−1 of ISAV and dividing them in two new (1000 L) tanks (Tank 4 and Tank 5) kept at a temperature of 13 ◦ C. These fish are herein referred to as H5Rip fish. To measure the infection response following a more natural route of infection, a cohabitation experiment was also setup. Briefly, 60 new naïve Atlantic salmon smolts were ip injected with 0.1 mL of 105 TCID50 mL−1 of the ISAV NA-HPR4 isolate and divided equally in the 2 tanks (trojan fish). Thirty N fish were then divided equally in both tanks (herein referred to as Naïve cohabitant (Nc) fish) along with 68 H5R fish, herein referred to as H5R cohabitant (H5Rc) fish. The N fish remaining in Tank 3 were left unchallenged. An overview of the experimental design can be found in Fig. 1. Sampling of fish tissues was done from 3 H5Rip fish per tank (6 total) at 6 h, 24 h, 3, 10 and 20 days post challenge (dpc). For the Nc and H5Rc fishes, 3 fish per tank were sampled starting at 20 dpc when the first mortalities of trojan fish were observed, then again at 23, 29 and 41 dpc. At 63 dpc, all the surviving H5Rip, Nc and H5Rc fish from Tanks 4 and 5 as well as 6 N fish from the Tank 3 left unchallenged were sampled. AquacalmTM (Syndel, BC, Canada) was used to sedate fish prior to killing them. At 41 and 63 dpc the number of Nc fish sampled was reduced to 4 and 3, respectively, instead of 6 because of the minimal amount of fish remaining in the tanks due to mortalities. Head-kidney sections were removed aseptically from each fish as described above. 2.3. RNA extraction Total RNA from RNAlater preserved salmon head-kidney samples was extracted using TRI reagent (Molecular Research Center, OH, USA) followed by column purification using the NucleoSpin RNA II kit (Macherey-Nagel, PA, USA) and following the manufacturer’s protocol. An on-column DNase digestion step was performed on each sample. RNA quantification was performed using a NanoDrop 8000 (Thermo Scientific, DE, USA) and RNA quality and integrity were assessed with the Experion automated electrophoresis system (Bio-Rad, TX, USA). Only RNA samples with RNA Quality Indicator (RQI) values above 8 were used for analysis. RNA extracts were stored at −70 ◦ C in DEPC treated water containing an RNase inhibitor (Qiagen, ON, Canada) until needed.

2.2. Fish and ISAV challenges

2.4. RNA amplification and labeling

On June 21, 2007, 175 Atlantic salmon parr (mean weight = 30 g) were intra-peritoneally (ip) injected with 0.1 mL of 105 TCID50 mL−1 of the ISAV EU-HPR5 isolate suspended in L15 culture medium and divided into two 1000 L freshwater tanks (Tank 1 and Tank 2) in the quarantine laboratory at St. Andrews Biological Station (NB, Canada). An additional 150 Atlantic salmon parr were ip injected with 0.1 mL of sham solution (L15 culture medium) and placed in a third freshwater tank (Tank 3). AquacalmTM (Syndel, BC, Canada) was used to sedate fish prior to the injections following manufacturer’s recommendation. Fish mortalities were noted and morts were removed from the tanks while the survivors were

RNA amplification and labeling for microarray was performed using the one-color Low Input Quick Amp Labeling kit (Agilent, CA, USA) following the manufacturer’s recommendations. Briefly, 200 ng of each RNA sample was reverse transcribed, amplified and labeled to obtain Cy3 labeled amplified RNA (aRNA). Purification of the labeled aRNA was performed using NucleoSpin RNA clean up columns (Macherey-Nagel, CA, USA) following the manufacturer’s recommendations. Following purification, labeled aRNA samples were quantified using the NanoDrop 8000 to verify the yield of aRNA and the labeling efficiency. Purified aRNA was prepared for hybridization using the fragmentation step described in Agilent’s

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

199

Fig. 1. Overview of the experimental design. Tanks 1 and 2 contain fish ip injected with the low-virulence ISAV EU-HPR5 isolate (H5R fish). Tank 3 contains naïve fish ip injected with saline (N fish). Tanks 4 and 5 contain H5R fish ip injected with the high-virulence ISAV NA-HPR4 isolate (H5Rip fish), H5R fish infected by cohabitation with the high-virulence ISAV NA-HPR4 isolate (H5Rc fish), naïve fish infected by cohabitation with the high-virulence ISAV NA-HPR4 isolate (Nc fish) and new naïve fish ip injected with the high-virulence ISAV NA-HPR4 isolate (trojan fish).

Low Input Quick Amp labeling kit protocol. Briefly, each aRNA was fragmented by mixing 1.65 ␮g of aRNA in a volume of 22.8 ␮L, with 6 ␮L of 10× blocking agent and 1.2 ␮L of 25× fragmentation buffer and heating the mix at 60 ◦ C for 30 min.

on more than half of the slides used in each group. Median intensity value minus background for each spot remaining after filtering were log2 transformed and normalized using a median centering approach.

2.5. Microarray hybridization and image analysis

2.6. Statistical analysis

Microarray hybridizations were performed using Agilent’s 4 × 44K Atlantic salmon microarray slides containing 4 grids with the same ∼44 000 features (Design ID 020938) and a one-color approach. Detailed information about the microarray slides can be found on Agilent’s array website (https://earray.chem.agilent.com/earray). All hybridizations, including washes and drying steps were carried out on a HS4800 automated hybridization station using quad chambers (Tecan, Männedorf, Switzerland). Slides were initially washed with Agilent’s aOligo aCGH Prehybridization buffer for 60 s at 65 ◦ C and injected with 60 ␮L of hybridization mix containing 30 ␮L of fragmentation mix and 30 ␮L of Agilent’s 2× GEx hybridization Buffer Hi-RPM per chamber. The injected material was hybridized for 17 h at 65 ◦ C. Following hybridization, slides were washed twice with Agilent’s gene expression wash buffer 1 at 23 ◦ C for 60 s, twice with Agilent’s gene expression wash buffer 2 with 0.01% wash buffer additive at 37 ◦ C for 60 s and dried under nitrogen. Microarray slides were scanned at a resolution of 5 ␮m using a ScanArray Gx microarray scanner (Perkin Elmer, MA, USA) with the laser power set at 90%. For each slide, PMT settings were set to 60. The resulting TIFF images were quantified using the SpotReader feature extraction software (Niles Scientific, CA, USA). Numerical intensities from each spot were extracted and descriptive statistics were calculated and exported to a GenePix Results (GPR) file. Features that did not meet defined criteria in SpotReader were flagged as bad. These criteria included spots that had more than 50% of saturated pixels, spots less than 8 pixels in diameter and spots with high background The bad flag values computed were then used to filter out genes with missing values (−50, −75, −100 GPR flag values)

During this study, naïve fish infected by cohabitation (Nc) as well as preexposed fish reinfected by cohabitation (H5Rc) sampled at 20, 23, 29, 41 and 63 dpc were all compared to non-infected naïve fish (N). The N fish used consisted of 3 non-infected fish sampled before the challenge and 3 non-infected fish sampled on the last day of the challenge. Preexposed fish reinfected by IP injection (H5Rip) sampled at 6 h, 24 h, 3, 10, 20 and 63 dpc were also compared to the N fish. Finally, naïve fish infected by cohabitation (Nc) were directly compared to preexposed fish reinfected by cohabitation (H5Rc), while preexposed fish (H5R) sampled before the second challenge were compared to non-infected naïve fish (N). The gene expression responses were compared using the Significance Analysis of Microarray (SAM) test found in BRB-ArrayTool version 4.1.0 Beta 2 Release (developed by Dr. Richard Simon and BRB-ArrayTools Development Team). For each time-point investigated, the mean gene expression value of each gene in the H5R, Nc, H5Rc or H5Rip fish (n ∼ 6) was compared to the mean gene expression value of the similar gene in the N fish (n ∼ 6). In addition, the mean gene expression value of each gene in the Nc fish was compared to H5Rc fish. Genes significantly differentially expressed were identified using a False Discovery Rate (FDR) of 0.05 and a 95% confidence level. Only genes at least 1.5 fold were kept for further analysis. All of the genes that were found to be differentially expressed in at least one comparison were merged into a single gene list. Functional annotations associated to these genes, which includes gene descriptions (blastx hit), UniGene numbers and biological process Gene Ontology (GO) terms were taken from the combined (GRASP and Agilent) annotation file (version of August 11, 2009) found

200

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

on the cGRASP website (http://web.uvic.ca/grasp). The annotation information was used to cluster genes in functional groups linked to various biological processes. Further, a functional annotation clustering analysis (using UniGene numbers) found on the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 website was used to help cluster genes in the various functional groups (Huang da et al., 2009a, 2009b). The raw and normalized data resulting from this experiment have been deposited in the NCBI Gene Expression Omnibus (GEO) database (series record GSE28357) following MIAME guidelines (Brazma et al., 2001). 2.7. ISAV confirmation by RT-PCR and RT-qPCR Reverse transcription (RT) of purified RNA samples was performed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, CA, USA) following manufacturer’s protocol (Applied Biosystems, CA, USA). Briefly, 1 ␮g of total RNA was denatured at 95 ◦ C for 5 min and transferred to ice. The enzyme mix containing 2 ␮L of 10× random primers, 2 ␮L of 10× RT buffer, 0.8 ␮L of 25× dNTP mix and 1 ␮L of MultiScribe TM Reverse transcriptase was added to the tubes, for a total of 20 ␮L, and incubated according to manufacturer’s instructions. Resulting cDNA samples were diluted twofold with water. Quantitative polymerase chain reaction (qPCR) was performed to confirm ISAV infection in sampled fish using primers 404F and RA3, which target segment 8 of the ISA virus (Table 1). The qPCR assays were performed using an Mx3000P instrument (Stratagene, CA, USA) and the 2× Taq Man Universal Enzyme Mix (Applied Biosystems, CA, USA). Each assay was done in 25 ␮L volumes comprising 8.8 ␮L of DEPC treated water, 12.5 ␮L of 2× Taq Man Universal Enzyme mix, 2 ␮L (∼50 ng) of cDNA, 480 nM of each primer and 200 nM of the 491 ISAV probe (Table 1). Cycling conditions consisted of an initial hold at 50 ◦ C for 2 min, 95 ◦ C for 10 min, followed by 40 cycles at 95 ◦ C for 30 s, 60 ◦ C for 30 s and 72 ◦ C for 30 s, with fluorescence reading at the end of each elongation cycle. Specific amplification of the ISAV EU-HPR5 isolate was accomplished by conventional RT-PCR using primers 847F-ISA-seg6 and 1130R-ISA-seg6, which specifically target segment 6 of this isolate (Table 1). The 2× Brilliant II QPCR Master Mix (Agilent, CA, USA) was used following manufacturer’s instructions. Each assay was done in 25 ␮L volumes comprising 9.7 ␮L of DEPC treated water, 12.5 ␮L of 2× Brilliant II QPCR Master Mix, 2 ␮L (∼50 ng) of cDNA (obtained from the reverse transcription of 1 ␮g of total RNA) and 320 nM of each primer. Cycling parameters consisted of an initial hold at 95 ◦ C for 10 min, followed by 45 cycles at 95 ◦ C for 30 s, 48 ◦ C for 30 s and 72 ◦ C for 30 s. Resulting PCR products were run on 2% agarose gel, purified and sent for sequencing at Northwoods DNA Sequencing Service (Solway, MN, USA) to confirm the HPR genotype. Specific quantification of the ISAV NA-HPR4 isolate in sampled fish was achieved by RT-qPCR using primers 793F ISA-S6 and 1009R ISA-S6, which specifically target segment 6 of the ISAV NAHPR4 isolate (Table 1). The assays were performed using the Power SybrGreen kit (Applied Biosystems, CA, USA). Briefly, each reaction was composed of 12.5 ␮L of 2× Power SybrGreen PCR master mix, 320 nM of forward and reverse primers, 2 ␮L (∼17 ng) of cDNA template and completed to 25 ␮L with DEPC treated water. Thermocycler conditions were set at 95 ◦ C for 10 min, followed by 40 cycles at 95 ◦ C for 30 s, 60 ◦ C for 30 s and 72 ◦ C for 30 s. Both melting curves and 2% agarose gels were used to verify the specificity of reactions. 2.8. RT-qPCR validation of microarray results Quantitative RT-PCR was used to validate a list of 6 genes that were differentially expressed by microarray analysis in at least one

of the time-points investigated. Genes were selected based on their putative roles in either innate and/or acquired immune responses. Primer pairs targeting each gene were designed to amplify regions of approximately 150 bp using Primer Express (Applied Biosystems, CA, USA) (Table 1). Total RNA samples were normalized to a concentration of 70 ng/␮L using a CAS1200N liquid handling robot (Corbett Life Science, Australia). One microgram of RNA was reverse transcribed to cDNA using the High Capacity cDNA kit following the manufacturer’s recommendations. Resulting cDNA samples were diluted 1/6 and used as templates for RT-qPCR. Assays were performed on an Mx3000P instrument (Agilent Technologies, CA, USA) using the Power SybrGreen kit (Applied Biosystems, CA, USA). Briefly, each reaction was composed of 12.5 ␮L of 2× Power SybrGreen PCR master mix, 320 nM of forward and reverse primers, 2 ␮L (∼17 ng) of cDNA template and completed to 25 ␮L with DEPC treated water. Thermocycler conditions were set at 95 ◦ C for 10 min, followed by 40 cycles at 95 ◦ C for 30 s, 60 ◦ C for 30 s and 72 ◦ C for 30 s. Each sample was run in duplicate and both melting curves and 2% agarose gels were used to verify the specificity of the reactions. Efficiency (E = 10[−1/slope] ) for each primer pair was calculated by doing 10 fold serial dilutions of the cDNA from 10−1 to 10−8 in duplicate. The mean Ct values from each duplicate sample were normalized against the mean Ct value of a reference gene (betatubulin) also in duplicate. Relative quantification (fold change) of each gene was obtained by using the Pfaffl method and the REST 2008 software, which takes into account a reference gene and PCR efficiency. A randomization analysis (10,000 iterations) included in the REST 2008 software was used as a significance test (P < 0.05) (Pfaffl et al., 2002). Correlation between viral load and the gene expression response of the 6 selected genes were also determined using the CORREL function found in Excel 2007.

3. Results 3.1. ISAV challenge and viral detection by RT-qPCR The mortality rate of Atlantic salmon after the initial ip challenge with the ISAV EU-HPR5 isolate was low. Morts were removed daily but were not tested to confirm the presence of ISAV. At 18 months post-challenge, 67% of the 175 fish initially injected had survived. The first mortalities following the second challenge occurred in the trojan fish, and started at 20 days post challenge (dpc). Hence, twenty days post-injection was chosen as time-point 0 h for the sampling of fish in cohabitation with these trojans, namely the H5Rc and the Nc fish. Ninety-three percent of trojan fish had died within 30 dpc. Mortality data for the H5Rip, H5Rc and Nc fish were also noted during the challenge, with cumulative mortality of 5%, 9% and 26.5%, respectively, although we note most of the fish in each group were sampled for microarray analysis before it was possible to know if they would have survived the challenge. Quantitative PCR assays targeting ISAV was performed on all sampled fish prior to the second challenge. Interestingly, 5 of 10 of these fish tested positive for ISAV. To investigate this further, we designed an assay to specifically amplify the ISAV EU-HPR5 isolate that was used in the initial challenge. Sequencing of the resulting amplicon (∼284 bp) confirmed the ISAV genotype as HPR5, and was 100% identical to the isolate (RPC/NB 04-085-1) injected nearly 18 months earlier. PCR assays performed on H5R fish challenged with the ISAV NA-HPR4 isolate also showed the presence of the ISAV EUHPR5 isolate in 12 of the 54 preexposed fish tested and collected at different time-points during the second challenge. Quantitative PCR assays designed to measure the ISAV NA-HPR4 isolate specifically were performed on each fish sampled during the challenge. All of the head-kidneys collected from the mortalities in the trojan group at 20 dpc had detectable quantities of the ISAV

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

201

Table 1 Primer sequences and list of genes assayed by RT-PCR or RT-qPCR. Gene

Primer or probes

ISAV segment 8

404F RA3 491 ISAV probe 847F-ISA-seg6 1130R-ISA-seg6 797F-ISA-seg6 1009R-ISA-seg6 166F-Ssa-B-t 434R-Ssa-B-t 221F-Ssa-B2 370R-Ssa-B2 217F-Ssa-Chem 366R-Ssa-Chem 114F-Ssa-Mx 263R-Ssa-Mx 1910F-Ssa-STAT1 2059R-Ssa-STAT1 94F-Ssa-Cath-D 243R-Ssa-Cath-D 105F-Ssa-C1q 254R-Ssa-C1q

ISAV HPR5 segment 6 ISAV HPR4 segment 6 Beta-tubulin Beta-2 microglobulin precursor CC-chemokine 19 Interferon induced Mx protein STAT1 Cathepsin D C1q a

Efficiency

79% 89.7% 95% 90.1% 97.2% 83.2% 104.5%

Sequence 5 –3

GenBank #

TGGGCAATGGTGTATGGTATGA GAAGTCGATGAACTGCAGCGAa (6-Fam) cag gat gca gat gta tgc-MGB ATTGACATGCCCAGACATTGAC ACAGAGCAATCCCAAAACCTGC TCTTCACGGCTCTGCTTCGA AATGTTTCTGCCAAGTTTACCAATC GGMGCCAAGTTCTGGGAGGT TAGTGGCCCTTGGCCCAG ACATCAGCATCCAGCTCCTGAA GGCGGACTCTGCAGGTGTAC GTCAAGGCTGCTCCATCGA GTTTAGCCTTGAAGTTGGTTTCG CGCTCCCTTGGCGTAGAGA CAGCTCGAGAGGGCATCGT TGCCCAGGCACGTTCTTG AGGCAGAGAGACGGCAGACA TCCGAATTCCGTTGAGGAAGT GGGTTTCTGGAGTGGGTCCAT GCGGTGAGTACTGCAGTTCGA TGCCCCGTTATGGCTCATC

EU118822

AY963263 AF404342 BT060170 NM 001123699 DW571080 NM 001123690 NM 001123654 BT043515.1 EG845608

Devold et al. (2001).

Table 2 qPCR results of ISAV NA-HPR4 in the Nc, H5Rc, and H5Rip fish sampled at the various time-points following the start of the challenge. Group

Time-points

Positive fisha

Ct value (mean + SD)b

Fold change (mean)c

Nc

20 dpc 23 dpc 29 dpc 41 dpc 63 dpc

6/6 5/6 6/6 4/4 3/3

27.69 (±3.10) 26.77 (±5.28) 21.25 (±3.72) 28.15 (±7.20) 37.41 (±1.26)

978.55 1640.24 36054.83 760.70 4.26

H5Rc

20 dpc 23 dpc 29 dpc 41 dpc 63 dpc

2/6 2/6 4/6 5/6 3/6

36.21 (±1.27) 37.06 (±1.41) 31.78 (±2.05) 34.68 (±4.65) 36.21 (±3.55)

8.34 5.18 99.49 19.63 8.34

H5Rip

6h 24 h 3 dpc 10 dpc 20 dpc 63 dpc

0/6 0/6 2/6 5/5 6/6 1/6

NA NA 34.01(±1.00) 31.34 (±7.59) 31.05 (±1.33) 37.18

NA NA 28.48 126.98 149.63 4.85

a b c

Number of fish testing positive for ISAV/total number of fish used for microarray. Mean Ct value of the positive fish + SD. Relative quantity of ISAV compared to a set Ct value of 40 and adjusted for PCR efficiency using REST 2008.

NA-HPR4 isolate. Some fish tested negative for ISAV in the Nc, H5Rc and H5Rip fish sampled at the various time-points. Interestingly, in the ISAV positive H5Rc and H5Rip fish, viral loads were much lower than in Nc fish at most time-points, and the peak ISA values were much greater in Nc fish than in H5Rc or H5Rip fish (Table 2). 3.2. Microarray analysis Total RNA was isolated from head-kidney and used to study global gene expression responses in naïve salmon infected by cohabitation (Nc) and ISAV EU-HPR5 preexposed salmon reinfected by cohabitation (H5Rc) or by ip injection (H5Rip) with the goal of identifying immune pathways activated in Atlantic salmon during primary and secondary infection with ISAV. Microarrays were performed using all samples from each group and time-points independently of their infectivity status and viral loads. In total, between 3885 and 11,399 genes remained following filtering criteria and were used for the various analysis (Table 3). Firstly, we compared the global gene expression responses of Nc fish sampled at 20, 23, 29, 41 and 63 dpc versus N fish, which represents the primary response to ISAV in Atlantic salmon infected by

cohabitation. Between 6 and 1223 genes were found to be significantly differentially expressed at the time-points between 20 and 41 dpc, using a FDR of 0.05 and a 95% confidence level (Table 3). By 63 dpc, no genes were found to be significantly differentially expressed between the N and three surviving Nc fish. When comparing global gene expression responses of H5Rc fish sampled at 20, 23, 29, 41 and 63 dpc versus N fish, which represents the secondary response to ISAV in Atlantic salmon infected by cohabitation, no genes were found to be differentially expressed at 29 and 41 dpc while between 210 and 496 genes were found to be significantly differentially expressed at the other 3 time-points (Table 3). Although we believe cohabitation models more closely approximate natural infections, ip injections were also used in an attempt to minimize inter-replicate variability at the different time-points. Thus, the gene expression response of H5Rip fish was also compared with that of N fish for each time-point sampled (6 h, 24 h, 3, 10, 20 and 63 dpc). At 6 h, no genes were differentially expressed, while between 44 and 376 genes were found to be significantly differentially expressed at the remaining time-points (Table 3). When comparing Nc fish to H5Rc fish sampled at the different time-points (20, 23, 29, 41 and 63 dpc), which directly compares primary versus

202

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

Table 3 Number of genes left after filtering criteria and number of genes significant at least 1.5-fold for each statistical comparison performed. Statistical comparison

Time-points

Genes left after filtering

Significant genes FDR = 0.05, 95% conf

Up-regulated

Down-regulated

Nc vs N

20 dpc 23 dpc 29 dpc 41 dpc 63 dpc

7928 9021 10,107 5354 3939

278 370 1223 6 0

267 203 623 6 NA

11 167 600 0 NA

H5Rc vs N

20 dpc 23 dpc 29 dpc 41 dpc 63 dpc

8735 9209 9519 10,283 9723

210 240 0 0 496

175 208 NA NA 401

35 32 NA NA 95

H5Rip vs N

6h 24 h 3 dpc 10 dpc 20 dpc 63 dpc

10,269 7993 11,399 10,752 10,293 10,986

0 376 137 248 165 44

NA 181 39 140 127 41

NA 195 98 108 38 3

Nc vs H5Rc

20 dpc 23 dpc 29 dpc 41 dpc 63 dpc

7465 8794 9894 5374 3885

187 80 574 0 4

153 58 333 0 0

34 22 241 0 4

H5R vs N

0 dpc

10,395

167

61

106

secondary immune responses, 187, 80 and 574 genes were significantly differentially expressed at 20, 23 and 29 dpc, respectively, while only 4 genes were significantly differentially expressed at 63 dpc, and none at 41 dpc (Table 3). Finally, H5R fish were compared to N fish to measure the gene expression changes resulting from the pre-exposure to the low-virulence ISAV isolate. In all, 167 genes were significantly differentially expressed (Table 3). 3.3. Clustering of genes into functional groups All of the genes significantly differentially expressed in at least one of the comparisons were merged into a single gene list and the associated gene expression values for Nc, H5Rc and H5Rip versus N fish as well as Nc versus H5Rc and H5R versus N fish are presented in Supplemental Table S1. The merged list contained 2808 genes of which 58% had functional annotations and 450 were matched to biological process GO terms. Using associated gene annotations and biological process GO terms as well as a functional annotation clustering analysis found in DAVID, genes were clustered into four functional groups representing immune-related processes. The four functional groups are: (1) innate immunity and cytokines, (2) MHC antigen presentation, (3) acquired humoral and cellular immunity and (4) apoptosis. The expression response of selected genes found in each functional group are represented in Fig. 2, while the complete list of all genes clustered in the various functional groups can be found in Supplemental Table S2. 3.3.1. Group 1: innate immunity and cytokines The first functional group included 87 genes with roles in non-specific innate immunity and antiviral responses such as the interferon-induced GTP-binding protein Mx, various IFN regulatory factors and IFN induced genes (e.g. STAT1), as well as other immunomodulating cytokines such as CC-chemokine 19. In general, genes in this cluster were more highly expressed in Nc fish than in H5Rc and H5Rip fish from 20 to 29 dpc. Peak expression of this group of genes in H5Rc and H5Rip fish was relatively low, and occurred in the later time points. Nuclear factor interleukin-3-regulated protein, peroxiredoxin-5 mitochondrial precursor, ATP-binding cassette sub-family F member 1 and stabilin 1 precursor were, for their part, under-expressed in many time-points in Nc, H5Rc and H5Rip fish compared to N fish, while

other genes such as CC-chemokine 13 and tumor necrosis factor (TNF) receptor superfamily member 1B precursor were underexpressed only in the H5Rc fish at 20 dpc and in the Nc and H5Rc fish at 23 dpc. The gene matrix metalloproteinase-9 precursor showed an under-expression in Nc and H5Rc fish at various time-points, while being over-expressed at the early time-points in H5Rip fish. 3.3.2. Group 2: MHC antigen presentation This functional group included 88 genes with known or putative roles in antigen presentation via MHC class I or II molecules. Beta2-microglobuline precursor and class I histocompatibility antigen F10 alpha chain precursor, which form the MHC class I complex and present antigens to CD8+ cytotoxic T cells, were both over-expressed in the Nc, H5Rc and H5Rip fish. HLA class I histocompatibility antigen B35 alpha chain precursor was for its part under-expressed in Nc and H5Rc fish. Antigen peptide transporter 1 and calreticulin precursor, which are involved in antigen loading on MHC class I molecules, were also up-regulated in Nc and H5Rip fish, while only antigen peptide transporter 1 was up-regulated in H5Rc fish. Regarding genes with putative roles in MHC class II antigen presentation to CD4+ helper T cell, some were found to be differentially expressed. Among them, cathepsin B precursor and cathepsin D precursor were over-expressed in Nc and H5Rip fish, while gamma-interferon inducible lysosomal thiol reductase precursor (GILT) was over-expressed at 24 h in H5Rip fish only. Various proteasome subunits and genes involved in the ubiquitylation process with roles in general protein tagging and degradation as well as in antigen processing mechanisms were also over-expressed in Nc, H5Rc and H5Rip fish. A larger number, however, were overexpressed in Nc fish compared to the H5Rc and H5Rip. 3.3.3. Group 3: acquired humoral and cellular immunity This functional group included 49 genes involved in phagocytosis as well as cellular and humoral responses (T/B cells, antibodies, complement). Genes annotated as immunoglobulins such as the Ig mu chain C region membrane-bound form were under-expressed at 23 dpc in Nc fish, although they had higher expression levels at 41 and 63 dpc. In the H5Rc fish, this group of transcripts was under-expressed at most time-points, while in H5Rip fish they were over-expressed at 24 h but then under-expressed at the later time-points. The gene immunoglobulin V-set domain, for its part,

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

203

Fig. 2. List of selected genes clustered in each of the four functional groups. Underlined genes are >1.5 fold and significant using an FDR = 0.05 and a 95% confidence level. In many cases, individual genes are represented by multiple distinct probes on the array. In these cases, we chose to include only a single value, which was the most representative of the group.

showed a general down-regulation in all groups. For genes involved in the complement response, such as C1q and C6, the expression responses were similar or lower in Nc, H5Rc and H5Rip fish when compared to the N fish for most time-points, with the exception of 29 dpc when C1q was up-regulated in Nc fish. Various genes such as B cell receptor CD 22 precursor and Myeloperoxidase precursor were under-expressed at most time-points in Nc, H5Rc and H5Rip fish. The TNF receptor superfamily member 5 precursor, which is present on antigen presenting cells and helps macrophage and B cell activation, was over-expressed in primary infected fish only. The T-cell acute lymphocytic leukemia protein 1 homolog was under-expressed in Nc fish, with the exception of 23 dpc, while being over-expressed in H5Rc fish. 3.3.4. Group 4: apoptosis This functional group contained 24 genes with known or presumed roles in apoptosis. In primary infected fish, the highest number of differentially expressed genes occurred at 29 dpc. Pro-apoptosis genes such as diablo homolog mitochondrial precursor was over-expressed at 29 dpc, while the inhibitor of apoptosis baculoviral IAP repeat-containing protein 5 as well as BCL2/adenovirus E1B 19 kDa protein interacting protein-3 like were under-expressed. Meanwhile, in secondary cohab and ip infected fish, genes related to pro-apoptotic states were up regulated at many time-points, especially at 63 dpc. 3.4. Validation of microarray results by RT-qPCR Quantitative PCR assays were performed in order to validate the gene expression response of six selected genes that

were differentially expressed in at least one of the time-points investigated by microarray. The assays were performed on the genes signal transducer and activator of transcription 1 (STAT 1), interferon-induced GTP-binding protein Mx (Mx), CC-chemokine 19 (CC-chem), cathepsin D (Cath-D), complement C1q like protein (C1q) and beta-2-microglobulin precursor (B-2-M). Relative expressions (fold changes) of each gene were calculated for each time-point sampled by comparing the gene expression response of Nc, H5Rc and H5Rip fish versus N fish. The results obtained concorded, for the most part, with microarray results (Figs. 3 and 4). For example, the genes STAT1, MX and CC-Chem, were all overexpressed at 20, 23 and 29 dpc and dropped in expression at 40 and 63 dpc in Nc fish compared to N fish, while having similar expression response to N fish in H5Rc and H5Rip fish at the early time-points and over-expressed at the latter time-points as was seen by microarray. The gene cathepsin D, for its part, showed results that were not always in accordance when using both techniques. For example, when comparing H5Rip fish to N fish at 24 h, cathepsin D was significantly over-expressed by microarray while being significantly down-regulated by qPCR.

3.5. Correlation between viral loads and gene expression We wished to test if a correlation existed between viral loads and expression response for the genes whose expression had been measured by RT-qPCR. Using the CORREL function in Excel 2007, we determined that CC-chem (r = 0.75) and Mx (r = 0.74) were the only to 2 genes showing a strong correlation between viral load and gene expression. Conversely STAT 1 (r = 0.50), Cath-D (r = 0.44) and

204

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

Fig. 3. RT-qPCR validation of 6 genes found to be differentially expressed by microarray in Nc versus N fish and H5Rc versus N fish. Data is presented as the ratio + SE of (1) Nc samples (n ∼ 6) relative to N samples (n ∼ 6) found by microarray, (2) Nc samples (n ∼ 6) relative to N samples (n ∼ 6) found by qPCR normalized against beta-tubulin and adjusted for PCR efficiency, (3) H5Rc samples (n ∼ 6) relative to N samples (n ∼ 6) found by microarray, (4) H5Rc samples (n ∼ 6) relative to N samples (n ∼ 6) found by qPCR normalized against beta-tubulin and adjusted for PCR efficiency. Genes with (*) are >1.5-fold differentially expressed and significant by microarray (FDR = 0.05, 95% confidence level) or by qPCR (P < 0.05). The values for cathepsin D and C1q in Nc fish at 63 dpc were omitted from this figure as there was insufficient data to meet our inclusion criteria.

B-2-M (r = 0.43), showed moderate correlations, while C1q (r = 0.30) had weak to negligible correlation. By comparison, the expression of a reference gene, beta-tubulin, which was used to normalize expression values of the selected genes, was not correlated with viral load (r = 0.11).

4. Discussion Vaccination of fish against various pathogens, including the infectious salmon anemia virus (ISAV), is considered one of the most cost effective methods of protection against these diseases

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

205

Fig. 4. RT-qPCR validation of 6 genes found to be differentially expressed genes by microarray in H5Rip fish versus N fish. Data is presented as the ratio + SE of (1) H5Rip samples (n ∼ 6) relative to N samples (n ∼ 6) found by microarray and (2) H5Rip samples (n ∼ 6) relative to N samples (n ∼ 6) found by qPCR normalized against beta-tubulin and adjusted for PCR efficiency. Genes with (*) are >1.5-fold differentially expressed and significant by microarray (FDR = 0.05, 95% confidence level) or by qPCR (P < 0.05).

and attached financial losses resulting from infection. In the case of ISAV, several vaccines have been tested and some commercialized (Jones et al., 1999). However, some limitations remain in their use, thus novel vaccines are extensively and continuously being researched. In this study, the use of functional genomics tools enabled us to identify several immune components, which are either activated or repressed in both primary and secondary ISAV infections.

Previous studies looking at mortality rates in Atlantic salmon infected with ISAV have shown that survivors of a primary infection were less susceptible to a secondary infection and had increased survival. For example, Falk and Dannevig (1995) showed that Atlantic salmon preexposed to ISAV and re-infected had a cumulative mortality of only 5%, while naïve controls had a cumulative mortality of 40% after 30 d. Similarly, Ritchie et al. (2009) demonstrated that Atlantic salmon that had survived an infection with

206

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

the low-virulence ISAV EU-HPR5 (RPC/NB 04-085-1) isolate had a cumulative mortality of only 6% when re-infected (∼2 months later) by cohabitation with the high-virulence ISAV NA-HPR4 isolate. In comparison, naïve fish infected by cohabitation with the same isolate had a cumulative mortality of 92%. This large increase in survival strongly suggested that some sort of memory and crossimmunity components were present, permitting salmon initially infected with a European viral isolate to be protected against a North-American viral isolate. This was perhaps expected as amino acid sequence comparisons of viral segments 5 and 6 in these isolates show 84% and 83% identity, respectively, and these specific segments are believed to play an important role in virulence (Kibenge et al., 2007). The present study used the same ISAV isolates as in Ritchie et al. (2009), however, the period between the initial infection and secondary infection was much longer (18 months rather than 2 months), which falls in the range of time spent in ocean cages by cultured Atlantic salmon (http://www.mainstreamcanada.ca/ aquaculture/salmon-production-cycle.php). Using an RT-qPCR assay to measure ISAV NA-HPR4 viral loads in primary and secondary infected fish, we were able to show that the number of fish infected and the viral loads in the infected fish were considerably higher at the various time-points in infected naïve fish (Nc fish) than in preexposed fish, which had been re-infected by either cohabitation (H5Rc) or ip injection (H5Rip). In a recent study, Lauscher et al. (2011) showed that Atlantic salmon vaccinated with inactivated ISAV showed a reduction in viral load in the heart, gills and headkidney relative to non-vaccinated fish following an infection with ISAV. Our results show similar reduced viral loads in secondary infected fish suggesting long term protection (at least 18 months) against ISAV, for fish that survived the primary infection. A highly efficacious vaccine, which would persist for a prolonged period and would be capable of protecting farmed Atlantic salmon until they reach market size, would be extremely valuable. It is noteworthy that ISAV viral segments from the low-virulence EU-HPR5 isolate were still detectable by RT-PCR a full 18 months following the primary infection. This suggests that Atlantic salmon able to survive an infection can remain long time carriers of the virus, albeit at very low levels. The viral persistence could be related to distinct evolutionary strategies among the various ISAV strains. For example, the less virulent strains may not trigger immune responses of sufficient intensity to completely clear the virus, or alternatively, these strains might evade the fish immune system. It is known that various salmonids can be asymptomatic carriers of ISAV (Devold et al., 2000). These may provide good models to better understand how the virus can persist over long periods of time in asymptomatic fish. Further, it is also well known that fish infected with other types of viruses such as the infectious pancreatic necrosis virus (IPNV), can remain carriers for a very long time (Bootland et al., 1991), indicating this may be a fairly common viral survival strategy or a host immune mechanism used to help keep a long term memory of the pathogen. At this point we cannot determine if the presence of viral RNA 18 months post-infection stems from a maintained, active basal replication of ISAV that is not cleared by the immune system or if long lived cell types such as melanomacrophages, memory lymphocytes or other cells are able to retain RNA segments and antigens for a long period of time. As we favor the former hypothesis, it will be very important to verify whether asymptomatic, carrier fish can transmit infectious viral particles to non-immunized healthy individuals. As is the case in all teleost fish, salmonid head-kidneys serves no renal function, but rather are the main site for B lymphogenesis (Irwin and Kaattari, 1986; Kaattari and Irwin, 1985; Murayama et al., 2006) and are made up mostly of lymphoid tissue. Supporting this view, antibody secreting cells have been detected in the

head-kidney of rainbow trout (Bromage et al., 2004; Zwollo et al., 2005). We thus chose head-kidney as the focus of this study on immune functions in primary and secondary ISAV infected Atlantic salmon. A total of 2808 genes were found to be differentially expressed in at least one of the comparisons made and genes were clustered in four functional groups linked to defense responses such as innate immunity and cytokines, MHC antigen presentation, acquired cellular and humoral responses and apoptosis. Genes involved in innate antiviral responses that are activated following recognition of viral particles by pattern recognition receptors were for the most part over-expressed in Nc, H5Rc and H5Rip fish compared to N fish. Gene expression levels were, however, higher in primary infected fish than in secondary infected fish. Similarly, a high expression level of many innate immunity genes has been reported in other gene expression studies, which were interrogating primary ISAV infection. Despite the activation of these genes, the fish benefited from little to no protection and high levels of mortality were observed (Jensen and Robertsen, 2002; Jørgensen et al., 2007a, 2007b; Kileng et al., 2007; LeBlanc et al., 2010; Schiøtz et al., 2008; Workenhe et al., 2009). In the secondary cohab infected fish, innate response involved genes were also observed to be differentially expressed, although at a later time-point in the infection process. The gene expression patterns in the secondary ip infected fish are similar to those of the H5Rc group in terms of intensity, but the timing is not directly comparable between the cohabitation and injection challenges. The matrix metalloproteinase 9 precursor gene was also interesting since it was only over-expressed in secondary ip infected fish while being under-expressed in secondary cohab infected fish and primary infected fish. This gene, which has been shown to play a role in the early induction of an inflammatory response in Atlantic salmon during infections (Chadzinska et al., 2008), could be a result of the injection process. Regarding the delayed response observed in the H5Rc fish relative to the Nc fish at matching time-points, we believe that this could result from the decreased viral loads, due to memory mechanisms such as neutralizing antibodies or cellular mediated T cell responses active in the head-kidney or in other lymphoid tissues found in other parts of the fish. In support of this hypothesis, we note that the antiviral genes Mx (r = 0.74), CCchem (r = 0.75) and STAT1 (r = 0.50), whose expression levels were measured by RT-qPCR, showed good correlations with viral loads. Other studies looking at secondary immune responses in salmonid having survived an infection with Yersinia ruckeri or having been vaccinated with inactivated ISAV antigens and re-infected with the same pathogen have also showed that reduced viral loads during secondary infections correlated to a lower expression response of various innate immunity genes in the spleen and in the heart, headkidney and gills, respectively (Raida and Buchmann, 2008; Lauscher et al., 2011). It thus seems likely that secondary infected fish have lower viral loads as a result of reduced viral replication due to memory mechanisms in these fish such as neutralizing antibodies or cellular mediated T cell responses. Indeed, Atlantic salmon are known to produce neutralizing antibodies against ISAV, although titers are generally low (Falk and Dannevig, 1995; Mikalsen et al., 2005). Lauscher et al. (2011) have also detected ISAV specific antibodies following vaccination of salmon with inactivated ISAV particles. For their part, cell mediated cytotoxic responses are believed to be important for viral clearance in general, and specifically, are thought to play a major role during ISAV infections based on primary infection studies showing the activation of genes involved in MHC class I antigen presentation (Jørgensen et al., 2007b; LeBlanc et al., 2010). The activation of MHC class I and II molecules, which present viral antigens to CD8+ cytotoxic and CD4+ helper T cells, respectively, are needed for the development of a specific acquired response and memory against a pathogen. Once activated, antigen

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

specific CD4+ and CD8+ T cells as well as B cells mature into antigen specific effector cells or memory cells, which enable a rapid and strong response immediately upon pathogen recognition during a secondary encounter. Accordingly, we note that genes linked to antigen processing and presentation via MHC class I molecules such as beta-2-microglobuline precursor, class I histocompatibility antigen F10 alpha chain precursor, as well as calreticulin, antigen peptide transporter 1, various proteasome subunits and genes involved in the ubiquitylation process were over-expressed in primary infected fish during the first few-time points and expression levels peaked in these fish at 29 dpc when viral loads were at their highest. In both secondary cohab and ip infected fish, MHC class I genes were not differentially expressed in the initial timepoints. This is potentially due to the reduced viral loads observed in the head-kidney of immunized fish at those time-points. Conversely, a set of genes related to MHC class II antigen presentation, which are usually expressed in specialized antigen presenting cells (APC), such as dendritic cells, were over expressed in both primary and secondary ip infected fish, although their apparition occurred much sooner in secondary ip infected fish than in primary infected fish. For example, cathepsin B and D, which are essential for endogenous and exogenous antigen degradation, were significantly over-expressed in Nc fish at 29 dpc, whereas in H5Rip fish they were over-expressed as early as 24 h and 3 dpc. Regarding the over-expression of cathepsin D at 24 h, it is important to note that qPCR result differed from that of the microarray. This discrepancy in the results could show a false positive in the microarray results, however, when looking at the various genes linked to MHC class II antigen presentation, cathepsin D was not the only one over-expressed. Since primers were not always designed using the specific oligos used for the microarray, as was the case for cathepsin D, it is possible that differential results were obtained due to the quantification of different transcripts or splice variants. The gene gamma-interferon inducible lysosomal thiol reductase precursor (GILT) colocalizes with cathepsin B and D and plays a role in antigen processing and presentation via MHC class II antigen molecules (Norton and Haque, 2009); it was significantly over-expressed exclusively in secondary ip infected fish at 24 h. Interestingly, these genes were not differentially expressed at any time-points in secondary cohab infected fish. Similarly, genes with roles in humoral and B cell responses, such as the Ig mu chain C region membrane-bound form and the Ig kappa chain V, which are needed for viral antigen recognition (Solem and Stenvik, 2006), were under-expressed in primary infected fish at 29 dpc, and only showed signs of up-regulation at later time-points. Interestingly, the gene Ig mu chain C region membrane-bound was also downregulated in H5Rc fish and H5R fish, which shows that preexposed fish already had a reduced expression of this gene. In the secondary ip infected fish, these genes were over-expressed as early as 24 h post injection, and had a reduction in expression in the later time-points. Other genes linked to specific acquired immune responses, such as the genes T-cell acute lymphocytic leukemia protein 1 homolog and T-cell leukemia translocation-altered gene protein homolog, were over-expressed in secondary cohab infected fish at different time-points and in H5Rip fish at 10 dpc, showing their potential importance in secondary responses. The gene leukocyte CD marker CD 37, which is part of the tetraspannin protein family and has numerous roles in immunity including lymphocyte B–lymphocyte T interactions (Knobeloch et al., 2000), was over-expressed exclusively in secondary ip infected fish at 24 h. Some genes involved in apoptosis, which is an important mechanism for viral clearance and lymphocyte regulation (Walsh and Edinger, 2010), were also differentially expressed during the primary and secondary response to ISAV. In primary infected fish, many pro-apoptosis genes were over-expressed at 29 dpc when viral loads were at their peak, while in secondary cohab infected fish

207

pro-apoptosis genes were up-regulated mainly at 63 dpc. We could thus speculate that this was to reduce T cell activity in the late stage of the infection when viral loads were on their way down. Taken together, these data show that acquired MHC class II and humoral response genes are activated early-on in secondary ip infected fish even when viral loads were low or absent. This observation could result from a quick response by the immune system, such as the proliferation of B cells in the head-kidney, which then migrate out to intercept the virus at entry sites or during primary and secondary viremia stages resulting in a reduction of the expression of those genes in latter time-points. In the present study, it is not possible to determine whether the observed changes in gene expression result from changes in the expression of cells that reside primarily in the head-kidney, or if an influx or outflux of migrating leukocytes from or to other parts of the fish might produce the observed changes. In support of the latter hypothesis, we note that Hetland et al. (2010) have studied cell migration following a primary cohabitation infection with ISAV. They observed that MHC class II-marked cells decreased in the head-kidney, suggesting a migration toward viral entry sites. Future studies looking at specific cell types rather than tissue-types, would certainly help our understanding of these processes. With regards to the differential response observed in secondary cohab and ip infected fish, it is important to note once again that times are not directly comparable between cohabitation and ip samplings. It is thus possible that the apparent differences observed occur simply by chance due to the sampling time-points chosen rather than due to the variability of the infection mechanisms. On the other hand, it is also possible that viral entry sites, either ip or cohab, might affect the response observed in the head-kidney. For example, it has been shown that Atlantic salmon gills contain an intraepithelial lymphoid tissue containing an aggregation of lymphocyte cells, which could play a crucial role in immune surveillance and quick secondary responses to infections starting in the gills (Haugarvoll et al., 2008). As such, it is possible that the secondary cohab infected fish were protected by an active surveillance system at the level of the gills. Furthermore, the secondary ip infected fish were exposed to a single large dose of virus, in a manner that completely bypasses the gills. It is thus possible that additional immune organs play crucial roles in enabling protection during the course of secondary infection. In support of this view, Tort et al. (2003) suggested that the presence of primary lymphoid tissues such as the spleen, thymus and mucosa-associated lymphoid tissues, may play roles in T lymphocyte production and storage, as well as B cell antibody production (Tort et al., 2003). Further, Cuesta and Tafalla (2009) demonstrated that rainbow trout vaccinated against VHSV and then infected one month later did not over-express genes normally associated with a specific immune response at the level of the head-kidney. Similarly, Lauscher et al. (2011) have shown that Atlantic salmon vaccinated against ISAV and infected 6 weeks later showed little to no differentially expressed genes at the head-kidney level. All these data suggest an elaborate immune system in fish, which might begin at the gill level, but includes a specific tissue trophism including the head-kidney. Further, the comparison of fish groups based on viral loads, rather than time post-exposure should be considered in future studies to help minimize experimental variability and improve the power of these assays. In conclusion, although our sampling regime was such that we can not exclude the possibility that some preexposed fish, which were re-infected with the high-virulence ISAV isolate could have eventually succumbed to infection, comparisons with the naïve fish by visual inspections, RT-qPCR measurement of viral load and by transcriptional profiling analysis strongly suggest these fish had significant protection against the high-virulence ISAV isolate, 18 months after their initial exposure. Given that fish were still

208

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209

carrying the original virus at low levels, it seems that the long term exposure resulting from the persistent infection could act as a continual booster to the immune system. If this is the case, an argument could be made for the use of either attenuated or DNA-based vaccines against ISAV, which would provide longer term exposure to the antigens than the inactivated virus vaccines, and may act in a similar way as an actual infection with a low-virulence ISAV isolate. Based on the transcriptional profiling results it also seems possible that a variety of lymphoid organs in the fish play roles in protecting fish against secondary viral infections. In future experiments, it would be interesting to conduct in situ studies along with gene expression studies in order to determine a “timeline” of immune response in a cell type and tissue type specific manner. Acknowledgments Funding for this project was provided by the Genome Research & Development Initiative. We would like to thank Linda Boston for kindly providing the high-virulence ISAV NA-HPR4 isolate, as well as the staff at the Toxicology laboratory at Environment Canada, Moncton, NB, for the use of their microarray equipment. We would also like to thank the anonymous reviewers for the critical reading of this manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molimm.2012.03.021. References Bootland, M.L., Dobos, P., Stevenson, M.W.R., 1991. The IPNV carrier state and demonstration of vertical transmission in experimentally infected brook trout. Diseases of Aquatic Organisms 10, 13–21. Bouchard, D., Keleher, W., Opitz, H.M., Blake, S., Edwards, K.C., Nicholson, B.L., 1999. Isolation of infectious salmon anemia virus (ISAV) from Atlantic salmon in New Brunswick, Canada. Diseases of Aquatic Organisms 35, 131–137. Bouchard, D.A., Brockway, K., Girai, C., Keleher, W., Merril, P.L., 2001. First report of infectious salmon (ISA) in the United States. Bulletin of the European Association of Fish Pathologists 21, 86–88. Brazma, A., Hingamp, P., Quackenbush, J., Sherlock, G., Spellman, P., Stoeckert, C., Aach, J., Ansorge, W., Ball, C., Causton, H., Gaasterland, T., Glenisson, P., Holstege, F., Kim, I., Markowitz, v., Matese, J., Parkinson, H., Robinson, A., Sarkans, U., Schulze-Kremer, S., Stewart, J., Taylor, R., Vilo, J., Vingron, M., 2001. Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nature Genetics 29, 365–371. Bromage, E.S., Kaattari, I.M., Zwollo, P., Kaattari, S.L., 2004. Plasmablast and plasma cell production and distribution in trout immune tissues. Journal of Immunology 173, 7317–7323. Chadzinska, M., Baginski, P., Kolaczkowska, E., Savelkoul, H.F., Kemenade, B.M., 2008. Expression profiles of matrix metalloproteinase 9 in teleost fish provide evidence for its active role in initiation and resolution of inflammation. Immunology 125, 601–610. Cuesta, A., Tafalla, C., 2009. Transcription of immune genes upon challenge with viral hemorrhagic septicemia virus (VHSV) in DNA vaccinated rainbow trout (Oncorhynchus mykiss). Vaccine 27, 280–289. Clouthier, S.C., Rector, T., Brown, N.E.C., Anderson, E.D., 2002. Genomic organization of infectious salmon anaemia virus. Journal of General Virology 83, 421–428. Devold, M., Falk, K., Dale, O.B., Krossoy, B., Biering, E., Aspehaug, V., Nilsen, F., Nylund, A., 2001. Strain variation based on the haemaglutinin gene, in Norwegian ISA virus isolates collected from 1987 to 2001: indication of recombination. Diseases of Aquatic Organisms 47, 119–128. Devold, M., Krossoy, B., Aspehaug, V., Nylund, A., 2000. Use of RT-PCR for diagnosis of infectious salmon anaemia virus (ISAV) in carrier sea trout Salmo trutta after experimental infection. Diseases of Aquatic Organisms 40, 9–18. Falk, K., Dannevig, B.H., 1995. Demonstration of a protective immune response in infectious salmon anemia (ISA)-infected Atlantic salmon Salmo salar. Diseases of Aquatic Organisms 21, 1–5. Garcia-Rosado, E., Markussen, T., Kileng, O., Baekkevold, E.S., Robertsen, B., Mjaaland, S., Rimstad, E., 2008. Molecular and functional characterization of two infectious salmon anaemia virus (ISAV) proteins with type I interferon antagonizing activity. Virus Research 133, 228–238. Godoy, M.G., Aedo, A., Kibenge, M.J.T., Groman, D.B., Yason, C.V., Grothusen, H., Lisperguer, A., Calbucura, M., Avendano, F., Imilan, M., Jarpa, M., Kibenge, F.S.B., 2008. First detection, isolation and molecular characterization of infectious

salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) in Chile. BMC Veterinary Research 4, doi:10.1186/1746-6148-4-28. Haugarvoll, E., Bjerkas, I., Nowak, B.F., Hordvik, I., Koppang, E.O., 2008. Identification and characterization of a novel intraepithelial lymphoid tissue in the gills of Atlantic salmon. Journal of Anatomy 213, 202–209. Hetland, D.L., Jorgensen, S.M., Skjodt, K., Dale, O.B., Falk, K., Xu, C., Mikalsen, A.B., Grimholt, U., Gjoen, T., Press, C.M., 2010. In situ localisation of major histocompatibility complex class I and class II and CD8 positive cells in infectious salmon anaemia virus (ISAV)-infected Atlantic salmon. Fish & Shellfish Immunology 28, 30–39. Hierholzer, J.C., Killington, R.A., 1996. Viral isolation and quantitation. In: Mahy, B.W.J., Kangro, H.O. (Eds.), Virology Methods Manual. Academic Press, London, pp. 35–37, http://www.mainstreamcanada.ca/aquaculture/ salmon-production-cycle.php, November 3, 2011. Huang da, W., Sherman, B.T., Lempicki, R.A., 2009a. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research 37, 1–13. Huang da, W., Sherman, B.T., Lempicki, R.A., 2009b. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols 4, 44–57. Irwin, M.J., Kaattari, S.L., 1986. Salmonid B lymphocytes demonstrate organ dependent functional heterogeneity. Veterinary Immunology and Immunopathology 12, 39–45. Jensen, I., Robertsen, B., 2002. Effect of double-stranded RNA and interferon on the antiviral activity of Atlantic salmon cells against infectious salmon anemia virus and infectious pancreatic necrosis virus. Fish & Shellfish Immunology 13, 221–241. Jones, S.R.M., MacKinnon, A.M., Salonius, K., 1999. Vaccination of freshwater-reared Atlantic salmon reduces mortality associated with infectious salmon anaemia virus. Bulletin of the European Association of Fish Pathologists 19, 98–101. Jørgensen, S.M., Afanasyev, S., Krasnov, A., 2007a. Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality. BMC Genomics 9, 179. Jørgensen, S.M., Hetland, D.L., Press, C.M., Grimholt, U., Gjøen, T., 2007b. Effect of early infectious salmon anemia virus (ISAV) infection on expression of MHC pathway genes and type I and II interferon in Atlantic Salmon (Salmo salar L.) tissues. Fish & Shellfish Immunology 23, 576–588. Kaattari, S.L., Irwin, M.J., 1985. Salmonid spleen and anterior kidney harbor populations of lymphocytes with different B cell repertoires. Developmental and Comparative Immunology 9, 433–444. Kibenge, F.S., Garate, O.N., Johnson, G., Arriagada, R., Kibenge, M.J., Wadowska, D., 2001. Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Diseases of Aquatic Organisms 45, 9–18. Kibenge, F.S., Kibenge, M.J., Wang, Y., Qian, B., Hariharan, S., McGeachy, S., 2007. Mapping of putative virulence motifs on infectious salmon anemia virus surface glycoprotein genes. Journal of General Virology 88, 3100–3111. Kileng, O., Brundtland, I., Robertsen, B., 2007. Infectious salmon anemia virus is a powerful inducer of key genes in the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish & Shellfish Immunology 23, 378–389. Knobeloch, K.P., Wright, M.D., Ochsenbein, A.F., Liesenfeld, O., Lohler, J., Zinkernagel, R.M., Horak, I., Orinska, Z., 2000. Targeted inactivation of the tetraspanin CD37 impairs T-cell-dependent B-cell response under suboptimal costimulatory conditions. Molecular and Cellular Biology 20, 5363–5369. Lauscher, A., Krossoy, B., Frost, P., Grove, S., Konig, M., Bohlin, J., Falk, K., Austbo, L., Rimstad, E., 2011. Immune response in Atlantic salmon (Salmo salar) following vaccination against infectious salmon anemia (ISA) and subsequent ISA virus infection. Vaccine 29, 6392–6401. LeBlanc, F., Laflamme, M., Gagne, N., 2010. Genetic markers of the immune response of Atlantic salmon (Salmo salar) to infectious salmon anemia virus (ISAV). Fish & Shellfish Immunology 29, 217–232. Lovely, J.E., Dannevig, B.H., Falk, K., Hutchin, L., MacKinnon, A.M., Melville, K.J., Rimstad, E., Griffiths, S.G., 1999. First identification of infectious salmon anaemia virus in North America with haemorrhagic kidney syndrome. Diseases of Aquatic Organisms 35, 145–148. Lyngrøy, C., 2003. Infectious salmon anaemia in Norway and the Faeroe Islands: an industrial approach. In: Miller, O., Cipriniano, R.C. (Eds.), International Response to Infectious Salmon Anaemia: Prevention, Control and Eradication. , pp. 97–109. McBeath, A.J., Collet, B., Paley, R., Duraffour, S., Aspehaug, V., Biering, E., Secombes, C.J., Snow, M., 2006. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Research 115, 176–184. Mikalsen, A.B., Sindre, H., Mjaaland, S., Rimstad, E., 2005. Protective effects of a DNA vaccine expressing the infectious salmon anemia virus hemagglutinin-esterase in Atlantic salmon. Vaccine 23, 4895–4905. Mjaaland, S., Markussen, T., Sindre, H., Kjoglum, S., Dannevig, B.H., Larsen, S., Grimholt, U., 2005. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo salar L.) with different infectious salmon anaemia virus isolates. Archives of Virology 150, 2195–2216. Mullins, J.E., Groman, D., Wadowska, D., 1998. Infectious salmon anaemia in salt water Atlantic salmon (Salmo salar L.) in New-Brunswick, Canada. Bulletin of the European Association of Fish Pathologists 18, 110–114. Murayama, E., Kissa, K., Zapata, A., Mordelet, E., Briolat, V., Lin, H.F., Handin, R.I., Herbomel, P., 2006. Tracing hematopoietic precursor migration to successive hematopoietic organs during zebrafish development. Immunity 25, 963–975.

F. LeBlanc et al. / Molecular Immunology 51 (2012) 197–209 Norton, D.L., Haque, A., 2009. Insights into the role of GILT in HLA class II antigen processing and presentation by melanoma. Journal of Oncology 2009, 142959. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time pcr. Nucleic Acids Research 30, e36. Raida, M.K., Buchmann, K., 2008. Development of adaptive immunity in rainbow trout, Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri. Fish & Shellfish Immunology 25, 533–541. Ritchie, R.J., McDonald, J.T., Glebe, B., Young-Lai, W., Johnsen, E., Gagné, N., 2009. Comparative virulence of Infectious salmon anemia virus isolates in Atlantic salmon, Salmo salar L. Journal of Fish Diseases 32, 157–171. Rodger, H.D., Richards, R.H., 1998. Haemorrhagic smolt syndrome: a severe anaemic condition in farmed salmon in Scotland. Veterinary Research 142, 538–541. Rowley, H.M., Campbell, S.J., Curran, W.L., Turnbull, T., Bryson, D.G., 1999. Isolation of infectious salmon anaemia virus (ISAV) from Scottish farmed Atlantic salmon, Salmo salar L. Journal of Fish Diseases 22, 483–487. Schiøtz, B.L., Jørgensen, S.M., Rexroad, C., Gjøen, T., Krasnov, A., 2008. Transcriptomic analysis of response to infectious salmon anemia virus infection in macrophage-like cells. Virus Research 136, 65–74.

209

Solem, S.T., Stenvik, J., 2006. Antibody repertoire development in teleosts – a review with emphasis on salmonids and Gadus morhua L. Developmental & Comparative Immunology 30, 57–76. Thorud, K.E., Djupvik, H.O., 1988. Infectious salmon anaemia in Atlantic salmon (Salmo salar L.). Bulletin of the European Association of Fish Pathologists 8, 109–111. Tort, L., Balasch, J.C., Mackenzie, S., 2003. Fish immune system. A crossroads between innate and adaptive responses. Immunologia 22, 277–286. Walsh, C.M., Edinger, A.L., 2010. The complex interplay between autophagy, apoptosis, and necrotic signals promotes T-cell homeostasis. Immunological Reviews 236, 95–109. Workenhe, S.T., Hori, T.S., Rise, M.L., Kibenge, M.J.T., Kibenge, F.S.B., 2009. Infectious salmon anaemia virus (ISAV) isolates induce distinct gene expression responses in the Atlantic salmon (Salmo salar) macrophage/dendritic-like cell line TO, assessed using genomic techniques. Molecular Immunology 46, 2955–2974. Zwollo, P., Cole, S., Bromage, E., Kaattari, S., 2005. B cell heterogeneity in the teleost kidney: evidence for a maturation gradient from anterior to posterior kidney. Journal of Immunology 174, 6608–6616.