Transcriptional upregulation of human cathepsin L by VEGF in glioblastoma cells

Gene 399 (2007) 129 – 136 www.elsevier.com/locate/gene

Transcriptional upregulation of human cathepsin L by VEGF in glioblastoma cells S. Keerthivasan 1,2 , G. Keerthivasan 2,3 , S. Mittal, S.S. Chauhan ⁎ Department of Biochemistry, All India Institute of Medical Sciences, Ansari Nagar, New Delhi-110029, India Received 21 November 2006; received in revised form 21 April 2007; accepted 5 May 2007 Available online 13 May 2007 Received by A.J. van Wijnen

Abstract The role of vascular endothelial growth factor (VEGF) on cathepsin L expression was investigated in human glioblastoma cells (U87MG). Our results demonstrate the transcriptional upregulation of cathepsin L expression by VEGF. Transient transfection of U87MG cells with VEGF expression vector significantly increased cathepsin L activity. These results were further corroborated by a parallel increase in the mRNA levels and promoter activity of cathepsin L by VEGF. By deletion analysis, we identified a 47 base pair VEGF response element (VRE) in human cathepsin L promoter. Site directed mutagenesis studies demonstrated that both SP-1 and AP-4 motifs present in this region contribute to VEGF responsiveness. These results prove for the first time that over-expression of VEGF in human glioblastoma cells induces cathepsin L expression at the transcriptional level. This mechanism could be involved in the enhanced tumorogenic potential of these cells. © 2007 Elsevier B.V. All rights reserved. Keywords: U87MG; Promoter; Transfection; Site directed mutagenesis

1. Introduction The abilities of cancer cells to induce angiogenesis and invade extra-cellular matrix are two important prerequisites for tumor metastasis. Various factors like vascular endothelial

Abbreviations: VEGF; vascular endothelial growth factor; VRE; VEGF response element; SP-1; Stimulator protein-1; AP-4; Activator protein-4; bp; base pair. ⁎ Corresponding author. Room No-3009, Department of Biochemistry, All India Institute of Medical Sciences, Ansari Nagar, New Delhi-110029, India. Tel.: +91 11 26593272; fax: +91 11 26588663. E-mail addresses: [email protected] (S. Keerthivasan), [email protected] (G. Keerthivasan), [email protected] (S.S. Chauhan). 1 Present addresses: 5841 S. Maryland Ave., AMB, N005C, Department of Medicine, University of Chicago, Chicago, IL 60637, USA. Tel.: +1 773 834 4510; fax: +1 773 702 8702. 2 Both of these authors contributed equally to this work. 3 Present addresses: 924 E. 57th street, R122, The Ben May Institute for Cancer Research,University of Chicago,Chicago, IL 60637, USA. Tel.: +1 773 834 7459; fax: +1 773 702 3701. 0378-1119/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2007.05.002

growth factor (VEGF), basic fibroblast growth factor (bFGF), platelet derived growth factor (PDGF), epidermal growth factor (EGF), transforming growth factor beta (TGF-β) and hypoxia inducible factor (HIF) are known to be involved in driving the angiogenic process. Among them the most critical driver of vessel formation in human tumors is VEGF (Dvorak et al., 1995; Senger et al., 1993). Over-expression of VEGF and its receptors on cancer cells is important for the increased vascularity and rapid tumor growth (Masood et al., 2001). Inhibition of VEGF and/or its receptor mediated signaling has been demonstrated to abrogate tumor cell growth and viability (Kim et al., 2004). Metastatic tumor cells secrete a battery of proteases, which enable the digestion of extra-cellular matrix proteins resulting in the degradation of basement membrane. These proteases include MMPs (matrix mettaloproteinases), uPA (urokinase plasminogen activator) and cathepsins (Stetler-Stevenson et al., 1993; Schmitt et al., 1990; Turk et al., 2000). Cathepsin L, a lysosomal cysteine protease, is known to be over-expressed in a variety of human malignancies such as the tumors of the kidney, testicles, lung, colon, breast, adrenal gland and ovary (Chauhan

130

S. Keerthivasan et al. / Gene 399 (2007) 129–136

et al., 1991). The expression of cathepsin L is up regulated by several growth factors (Asanuma et al., 2002; Prence et al., 1990; Nilsen-Hamilton et al., 1991; Waguri et al., 1995; Lemaire et al., 1997) and tumor promoters (Gottesman and Sobel, 1980). This protease is very potent in degrading collagen, elastin (Mason et al., 1986), laminin, fibronectin (Ishidoh and Kominami, 1995) and other components of extracellular matrix. It also activates other proteases involved in tumor spread (Goel and Chauhan, 1997). A major proportion of the cathepsin L synthesized by cultured malignant cells is secreted into the medium, for which its intact carboxy terminal is essential (Chauhan et al., 1998). It has been demonstrated that switch from non-metastatic to metastatic phenotype of human melanoma cells is directly related to the secretion of procathepsin L (Rousselet et al., 2004). Further, antibody mediated blockage of its secretion inhibited angiogenesis induced by metastatic melanoma cells. Thus both cathepsin L and VEGF are over-expressed in several human tumors. Both promote angiogenesis, tumor cell viability and invasiveness. Therefore, in view of the concomitant over-expression of cathepsin L and VEGF, we hypothesized that VEGF mediates the upregulation of cathepsin L in malignancy. In the present study this hypothesis has been tested in U87MG cells, known to express VEGF receptors (Avramis et al., 2002). Our results, for the first time, demonstrate the induction of cathepsin L expression by VEGF in these cells. By deletion analysis of human cathepsin L (hCATL) promoter we identified a 47 bp (base pair) region, which was important for VEGF responsiveness. Site directed mutagenesis of this region revealed the involvement of SP-1 (Stimulator protein-1) and AP-4 (Activator protein-4) in inducing human cathepsin L expression by VEGF. 2. Materials and methods 2.1. Construction of pCI-Neo-VEGF expression vector We cloned VEGF 165 cDNA in pCI-Neo vector downstream to CMV promoter. Transfection of pCI-Neo-VEGF into NIH3T3 cells resulted in high-level expression of VEGF 165 (data not shown). 2.2. Cell culture and DNA transfections U87MG cells were obtained from NCCS (National Center For Cell Science), Pune and grown in Dulbecco's modified Eagle's medium with glutamine, glucose and sodium pyruvate supplemented with 10% fetal calf serum and 20 μg/ml ciprofloxacin, in a humidified atmosphere of 5% CO2 and 95% air at 37 °C. Cultured cells were plated in six-well plates (2 × 105cells/ well) one day prior to transfection. The next day, cells were washed thrice with ice cold phosphate buffered saline (Ca2+ and Mg2+ free) and transfected using Transfast Reagent (Promega Corp., Madison, USA) as per the manufacturer's protocol. 48h after transfection, the cells were harvested and lysed in cell lysis

buffer (Promega) by two cycles of freezing and thawing. After removal of cell debris by centrifugation (12,000×g for 10 min), the firefly luciferase activity was assayed in the supernatant using dual luciferase assay kit (Promega) and luminescence was recorded using a luminometer (Berthold detection systems, GmbH, Germany). Simultaneously, renilla luciferase activity was also measured and used to normalize for the efficiency of transfection. 2.3. Cell Labeling and Immunoprecipitation Forty-eight hours after transfection the cells were metabolically labeled with 100 μCi/ml of 35S methionine (TC&L, BRIT, Mumbai, India) for 30 min. Then the cells were lysed and cell lysates were subjected to immunoprecipitation using a polyclonal anti human cathepsin L antibody (Athens Research and Technology Lab, GA, USA). The immunoprecipitates were resolved on SDS-PAGE followed by autoradiography. The details of metabolic cell labeling, immunoprecipitation, SDSPAGE and autoradiography have been described earlier (Chauhan et al., 1998). 2.4. Immunoprecipitation and enzyme assay U87MG cells were transfected with pCI-Neo-VEGF. After 48 h of transfection, cells were washed with ice cold PBS and incubated in fresh serum free DMEM to study secretion of cathepsin L into the media. After 6 h, the conditioned media was collected and used to immunoprecipitate secreted cathepsin L using polyclonal anti human cathepsin L antibody as described earlier (Arora and Chauhan, 2002). The immunoprecipitated cathepsin L was further assayed for enzymatic activity using CBZ-Phe-Arg-Nmec, a synthetic fluorogenic substrate (Sigma-Aldrich, St. Louis, MO, USA) as described earlier (Divya et al., 2002). Excitation wavelength of 370 nm and emission wavelength of 440 nm were used to record the fluorescence. 2.5. Real time RT-PCR U87MG cells were induced with different concentrations of recombinant VEGF 165 (Peprotech, NJ, USA) for 48 h in serum free DMEM containing 0.1% BSA. Total RNA was isolated from these cells using Tri reagent (SigmaAldrich). 3 μg of total RNA was reverse transcribed using MuMLV RT (MBI Fermentas, Vilnius, Lithuania) and random hexamers according to the manufacturer's protocol. An aliquot containing 150 ng of the total cDNA was subjected to PCR using specific human cathepsin L primers DR-16 (sense): 5′CAGTGAAGAATTCAGGCAGG 3′ and SSC-30 (antisense): 5′ ACAGTTGCAACTG CCTTC 3′ on a Bio-Rad i-cycler (Bio-Rad, Hercules, CA). The PCR reactions were carried out in 25 μl total volume containing 2 mM Magnesium chloride, 20 μM of each primers, 0.2 mM dNTP mix, 1U Taq Polymerase (Invitrogen Corporation, California, USA), 1× PCR Buffer (Invitrogen) and 1× SYBER green (Invitrogen). The PCR conditions comprised of 40 cycles of denaturation at

S. Keerthivasan et al. / Gene 399 (2007) 129–136

94 °C for 30 s, annealing at 60 °C for 45 s, extension at 72 °C for 1 min and fluorescence recording at 80 °C for 30 s. Similarly GAPDH cDNA was also amplified using primers 7F (sense):5′CCAAGGTCATCCATGACAACTTTGGT3′ and 8R (antisense): 5′TGTTGAAGTCAGAGGAGACCACCTG3′ and served as the internal control. Melting curve analysis confirmed no primer–dimer formation for human cathepsin L or GAPDH cDNAs under the above-mentioned conditions. The expected sizes of the PCR products were confirmed after running on agarose gel

131

(1.5%). Cycle threshold (Ct) values were calculated for each PCR and relative fold change was calculated using 2−▵▵ Ct method (Livak and Schmittgen, 2001). 2.6. Luciferase promoter constructs and site directed mutagenesis The construction of hCATL promoter reporter plasmids (pRB1.75, pRB9, pRB8, pRB4.75, pRB5, pRB14 and pRB13) by cloning different lengths of hCATL promoter fragments, varying in their 5′ ends, upstream to the luciferase gene in the pGL-3 basic vector (Promega) has been described earlier (Bakhshi et al., 2001). Same plasmids were used in the present study for deletion mapping of VEGF response elements. The consensus sequence of putative SP-1 and AP-4 binding motifs present in the promoter region of the construct pRB5 were either mutated alone (pSP-1M and pAP-4M) or in combination (pSAPM) by PCR using the following sense primers containing the mutated motifs (shown in lowercase) and a Kpn-I restriction site (boldfaced): pSP-1M: AAG GTA CCG CCA GGG ATC AGA GCA CCC AGA GTC CCC Gaa CAG CTG C; pAP-4M: AAG GTA CCG CCA GGG ATC AGA GCA CCC AGA GTC CCC GCC CcG CgG CCG GC; pSAPM: AAG GTA CCG CCA GGG ATC AGA GCA CCC AGA GTC CCC Gaa CcG CgG CCG GC. A common antisense primer AAT TAA GCT TTC CTG CTG CGG T containing Hind III restriction site (boldfaced) was used in combination with the above-mentioned sense primers. The PCR amplified Kpn-IHind III digested fragments were used to replace the corresponding wild type fragment in pRB5. Accuracy of mutations in the resulting constructs were confirmed by double stranded DNA sequencing.

Fig. 1. Induction of cathepsin L expression by VEGF. (A) U87MG cells transfected with pCI-Neo-VEGF (VEGF induced) or the empty vector (control) were labeled for 30 min with 35S methionine after 48 h of transfection. The cell lysates containing equal TCA precipitable counts (1 × 106 cpm) were used for immunoprecipitation using rabbit polyclonal anti human cathepsin L antibody. The immunoprecipitates were resolved on 12% SDS-PAGE and subjected to autoradiography. Simultaneously mouse fibroblast cells (NIH3T3) were radiolabelled and processed similarly and served as negative control (− Control). In U87MG cells a specific 42 kDa (human procathepsin L) and an approximately 100 kDa non-specific band were detected. However in the negative control lane only non-specific band was detectable. Each experiment was performed thrice and a representative autoradiogram is shown in (A). (B) The radiolabelled procathepsin L bands shown in (A) were quantitated densitometrically. The densitometric values of the cathepsin L band were normalized for equal loading with the non-specific reference band. Values are mean ± SE from three independent experiments. The results were analyzed by Students ‘t’ test and values significantly different (P b 0.05) compared to control are indicated by ‘a’. (C) U87MG cells transfected with pCI-Neo-VEGF (VEGF induced) or the empty vector (control) were fed with fresh serum free media (containing 0.1% BSA) 48 h posttransfection. After another 6 h, the conditioned media was collected and used for immunoprecipitating human cathepsin L using a polyclonal antibody. Specific enzyme activity of cathepsin L was then determined using 5 μM fluorogenic substrate, CBZ-Phe-Arg-Nmec as described in Section 2.4.Specific activity of cathepsin L was expressed as arbitrary units per μg of protein. Values are mean ± SE from at least three independent experiments. The results were analyzed by Students ‘t’ test and values significantly different (P b 0.05) compared to control are indicated by ‘a’.

132

S. Keerthivasan et al. / Gene 399 (2007) 129–136

2.7. Statistical analysis Paired t-test was applied for comparison between two groups of data. For comparing three or more groups, one-way ANOVA, followed by Tukey–Kramer multiple comparisons test was performed to calculate P values. P values ≤ 0.05 were considered significant. 3. Results 3.1. Induction of human cathepsin L expression by VEGF 165 To investigate the effect of VEGF on the expression of human cathepsin L, we transiently transfected U87MG cells with VEGF 165 expression vector, pCI-Neo-VEGF or the empty vector, pCI-Neo and studied the synthesis and secretion of this protease. In this study, we measured cathepsin L levels in VEGF induced and control cells by quantitatively immunoprecipitating radiolabelled cathepsin L (Fig. 1A) (U87MG cells transfected/cotransfected with pCI-neo-VEGF or empty vector have been designated as ‘VEGF induced’ or ‘Control’ cells respectively). The immunoprecipitates were resolved on SDSPAGE followed by autoradiography. 42 kDa bands were detected in control and VEGF induced cells and was not detected in mouse fibroblast (NIH3T3) cells (Fig. 1A, negative control). Indicating that the antibody used in the present study was specific for human cathepsin L and does not cross react with mouse cathepsin L. However, a non-specific band of approximately 100 kDa was detected in both mouse and human cells. In order to compare cathepsin L expression in VEGF induced and control cells, we quantitated 42 kDa band (procathepsin L) densitometrically (Fig. 1B). The non-specific 100 kDa band was used for normalization. As evident from this figure the level of cathepsin L in VEGF induced cells was found

Fig. 3. Transcriptional activation of human cathepsin L promoter by VEGF. (A) Human cathepsin L promotor reporter plasmid (pRB1.75) was constructed by cloning a 1875 bp fragment containing 1.8 kb of promoter region along with 75 bp of first exon upstream to the luciferase reporter gene in pGL-3 basic. Further details have been described in Section 2.6.This construct was used to study the role of VEGF on the promoter of cathepsin L. (B) PRB1.75 was cotransfected with pCI-Neo-VEGF (VEGF induced) and pRL null into U87MG cells. Cotransfections with empty vector served as control. After 36– 48 h, the cells were harvested and lysed using Promega's dual luciferase assay kit. Renilla luciferase activity was used as internal control to normalize for the transfection efficiencies. The normalized luciferase activity is expressed as folds over pGL3 basic. Values are mean ± SE from at least three independent experiments. Values significantly different (P b 0.001) compared to control are indicated by ‘a’.

to be significantly higher (1.7 fold, P b 0.05) compared to control cells. Elevated expression of cathepsin L by cultured cells has previously been shown to result in its secretion into the medium (Chauhan et al., 1998). Since VEGF significantly increased cathepsin L expression, we also assessed its effect on secretion of this protease into the medium. For this purpose we immunoprecipitated cathepsin L from the conditioned media and assayed its protease activity. Our results revealed that VEGF induced cells secreted significantly (1.9 fold, P b 0.05) higher levels of cathepsin L (Fig. 1C). 3.2. Transcriptional regulation of cathepsin L by VEGF 165 Fig. 2. Increase in human cathepsin L mRNA levels by VEGF treatment. U87MG cells (80% confluent) plated in six-well plates were serum starved for 12 h. Then different concentrations of recombinant VEGF 165 were added to these cells in fresh serum free DMEM containing 0.1% BSA. After 48 h of VEGF treatment, total RNA was isolated from these cells and real time RT-PCR was performed as described in Section 2.5. mRNA levels are shown as fold increase over untreated cells (control). Values are mean ± SE from at least three independent experiments. Values significantly different (P b 0.05) compared to control are indicated by ‘a’.

The above-mentioned results clearly demonstrated that VEGF induced cells exhibited significantly increased synthesis and secretion of cathepsin L. To further confirm this induction we quantitated hCATL mRNA levels in U87MG cells treated with recombinant VEGF 165 by real time RT-PCR. Treatment of the cells with 40ng/ml of VEGF resulted in a 2.5 fold (P b 0.01) increase in cathepsin L mRNA levels compared to control cells (Fig. 2). Since the cells were treated with recombinant

S. Keerthivasan et al. / Gene 399 (2007) 129–136

VEGF in serum free DMEM, the role of serum derived growth factors on cathepsin L elevation was ruled out. Thus it can be concluded that the above-mentioned increase in cathepsin L synthesis and secretion in VEGF induced cells (Fig. 1A and B) was only due to VEGF. These results also indicate that VEGF elicits its effect at the transcriptional level. To further confirm the transcriptional regulation of hCATL by VEGF, the promoter activity of pRB1.75 (vector containing 1.8kb long hCATL promoter cloned upstream to luciferase gene in pGL3 basic) in VEGF induced and control cells was assayed (Fig. 3A). Compared to the control, VEGF induction led to a dramatic increase (19.2 fold, P b 0.001) in the activity of pRB1.75 (Fig. 3B). These results further corroborate transcriptional upregulation of cathepsin L by VEGF and suggest the presence of VEGF response element (VRE) in hCATL promoter. 3.3. Identification of VRE in hCATL promoter In an earlier study, a series of promoter reporter deletion constructs were generated to characterize the hCATL promoter (Bakhshi et al., 2001). The promoter activities of these deletion constructs in VEGF induced and control cells were compared. Our results show (Fig. 4), that VEGF resulted in a statistically significant induction (P b 0.001) of the promoter activities in case of pRB1.75 (19.2 fold), pRB9 (6.4 fold), pRB8 (11.7 fold), pRB4.75 (6.2 fold) and pRB5 (7.9 fold). But the activities of pRB14 in VEGF induced and control cells were observed to be comparable (Fig. 4). However, in VEGF induced cells, activity of pRB14 was significantly lower (16.5 folds; P b 0.001) compared to pRB5. Thus the dramatic induction of hCATL promoter activity by VEGF observed in pRB5 was found to be absent in pRB14. As the latter construct (pRB14)

133

lacking 47 bp (− 133 to − 87 bp) was unresponsive to VEGF, we concluded that these bases include the VEGF response element (VRE). 3.4. Characterization of VRE In eukaryotes, DNA binding proteins play a critical role in mediating the response of transcription regulating agents. These proteins bind to specific motifs and alter the rate of transcription. The TRANSFAC analysis of the 47 bp VRE revealed the presence of SP-1, AP-4, MyoD (Myoblast determining factor), ADR1 (alcohol dehydrogenase gene regulator 1) and MZF1 (myeloid zinc finger 1) motifs in this region (Fig. 5A). Since MZF1 and MyoD are only expressed in hematopoietic progenitor and myoblast cells respectively, we did not attempt to study the role of these motifs. We assessed the involvement of SP-1 and AP-4 motifs of this region in conferring VEGF responsiveness by site directed mutagenesis. Therefore, variants of pRB5 harboring mutations in SP-1 (pSP-1M), AP-4 (pAP-4M) and both SP-1 and AP-4 motifs (pSAPM) were generated (Fig. 5A). As shown in Fig. 5B, pSP1-M exhibited 32% reduction compared to pRB5 in control cells. This reduction was not significant. However, in VEGF induced cells the reduction was observed to be significant (58%; P b 0.001). On the other hand, mutagenesis of AP-4 binding motif alone (pAP4M) could reduce the promoter activity of pRB5 by 68% (P b 0.01) in control and by 72% (P b 0.001) in VEGF induced cells. Simultaneous mutation of SP-1 and AP-4 motifs (pSAPM) resulted in 63% reduction (P b 0.01) in control and 84% (P b 0.001) in VEGF induced cells. Further it was observed that the dual mutation (pSAPM) reduced VEGF induced promoter activity to a level similar to that observed in case

Fig. 4. Deletion mapping of the VEGF response element/s in hCATL promoter. Various hCATL promoter reporter constructs (pRB1.75, pRB9, pRB8, pRB4.75, pRB5, pRB14) containing different lengths of hCATL promoter as described in Section 2.6were transfected into U87MG cells along with pRL null and pCI-Neo-VEGF (VEGF induced) or the empty vector (control). After 48 h, cells were lysed and assayed for luciferase activities as described above. The luciferase activity was normalized for the efficiency of transfection and expressed as fold over the activity of promoterless reporter construct (pGL3 basic). Fold activity of each construct in VEGF induced and control cells are shown in the figure. Putative NF-AT binding sites in the promoter region have been shown by filled circles (•). The cross mark (x) represents AP-1 consensus binding sites.

134

S. Keerthivasan et al. / Gene 399 (2007) 129–136

Fig. 5. SP-1 and AP-4 element act cooperatively to confer VEGF responsiveness to the cathepsin L promoter. (A) Nucleotide sequence of human cathepsin L VRE element from −133 to −87 is shown. The putative transcription factor binding motifs on hCATL promoter analyzed by TRANSFAC database have been underlined. PSP-1M, pAP-4M and pSAPM are constructs, which harbor mutation in the respective elements. The consensus sequence of the motifs is shown in boldface and the mutated bases in lowercase. (B) Plasmids with mutations in AP-4 (pAP-4M), SP-1 (pSP-1M) and both (pSAPM) (as shown in (A)) were transfected into U87MG cells either alone (control) or in combination with VEGF expression plasmid (VEGF induced). After 48 h cells extracts were prepared and assayed for luciferase activities. Fold activities of each construct in the VEGF induced and control cells are shown in the figure. Filled boxes represent the mutated motifs. Values are mean ± SE of three independent experiments. a — significantly different with respect to pRB5 in VEGF induced cells (P b 0.001); b — significantly different with respect to pRB5 in control cells (P b 0.01).

of pRB5 in control cells. Thus it was concluded that these two motifs together play a major role in conferring VEGF responsiveness to hCATL promoter. 4. Discussion Neoangiogenesis is crucial for tumor growth and metastasis. It is regulated by a variety of angiogenic factor(s) such as VEGF. It has been demonstrated under hypoxic conditions that metastatic cells produce copious amount of VEGF. Further the metastatic potential of tumor cells has been correlated with VEGF levels (Koshikawa et al., 2003). A

similar correlation between the expression of cathepsin L and metastatic potential of tumor cells has also been reported (Chao et al., 2001; Eppenberger-Castori et al., 2002; Hunter and Moreno, 2002). Several growth factors are known to increase cathepsin L levels, however there are no reports on the influence of VEGF on the expression of cathepsin L. Hence the aim of the present study was to investigate the role of VEGF on human cathepsin L expression in non-endothelial cells. We have used U87MG cells as they are known to express both VEGF receptors and cathepsin L (Avramis et al., 2002; Sivaparvathi et al., 1996; Guo et al., 2001). We have used VEGF 165 isoform in our study as it has been reported to

S. Keerthivasan et al. / Gene 399 (2007) 129–136

induce rapid growth of U87MG cells and augment neovascularization (Guo et al., 2001). Several proteases and their inhibitors (uPA, PAI, MMP etc.) involved in tumor invasion and metastasis are elevated by VEGF (Behzadian et al., 2003; Zucker et al., 1998; Munaut et al., 2003). We observed that cathepsin L expression is significantly increased in U87MG cells following transfection with VEGF expression vector (Fig. 1). Treating these cells with recombinant VEGF 165 confirmed that the observed elevation was solely due to VEGF (Fig. 2). Compared to controls, VEGF induced cells secreted significantly higher levels of cathepsin L. It has been previously reported that over-expression of this protease in cultured cells results in its secretion into the media (Chauhan et al., 1998). The secreted protease degrades extracellular matrix proteins thereby facilitating invasion of tumor cells. Our results demonstrate that VEGF induces synthesis and secretion of cathepsin L in glioblastoma cells that may potentially enhance their invasive ability. Cotransfection of the full-length hCATL promoter (pRB1.75) with VEGF expression vector resulted in a dramatic increase (19.2 fold) in the promoter activity (Fig. 3B), establishing that VEGF upregulates the expression of cathepsin L at the level of transcription and the hCATL promoter contains VEGF response element (VRE). Deletion mapping of the promoter region has been previously used for identification of IL-6 response elements in gamma fibrinogen gene promoter (Zhang et al., 1995), bone morphogenetic protein responsive regions in the Homeobox (Zhang et al., 2002) and drosophila Mad genes (Kusanagi et al., 2000) respectively. In the present study, we employed this strategy for the identification of VRE in hCATL promoter. For this, various deletion constructs of hCATL promoter used in an earlier study (Bakhshi et al. 2001) were cotransfected with VEGF expression vector or the empty vector. Upon cotransfections with empty vector, fulllength promoter and all deletion constructs exhibited a trend in the promoter activity (Fig. 4), which was similar to that observed by us earlier (Bakhshi et al., 2001). We observed that deletion of bases till − 133 in the pRB5 construct retained the responsiveness to VEGF. However, further deletion of 47 bp (pRB14 construct) completely abolished the VEGF induced activity (Fig. 4, pRB5 vs pRB14). Hence, we concluded that the above-mentioned 47 bp (− 133 to − 87) contained the VEGF response element. Previous studies have reported the involvement of transcription factors AP-1 and NF-AT in mediating the VEGF response on tissue factor promoter in human endothelial cells (Armesilla et al., 1999). Both these motifs were found in hCATL promoter sequence by TRANSFAC analysis (Bakhshi et al., 2001). Interestingly, deletion of these NF-AT elements did not affect the responsiveness of hCATL promoter to VEGF (Fig. 4, pRB9 vs pRB4.75). These results suggested the non-involvement of these motifs in conferring VEGF responsiveness to hCATL promoter. Flanagan et al. (1991) reported that cyclosporin A, an established immunosuppressive agent, could block the nuclear translocation of NF-AT and thereby blocking its transcriptional activity. The role of NF-AT in the present study was further ruled out by the fact that no change in VEGF

135

induced activity of hCATL promoter was observed in the presence of cyclosporin A (data not shown). Similarly, promoter reporter construct pRB14 which contained intact AP-1 motif but lacked the VRE region (− 133 to − 87) did not exhibit VEGF responsiveness (Fig. 4). Thus, we concluded that NF-AT and AP-1 transcription factors are not involved in the VEGF mediated cathepsin L induction. Analysis of the nucleotide sequence of VRE (−133 to −87) for putative transcription factor binding motifs revealed the presence of SP-1, AP-4, MZF1, MyoD and ADR1 motifs in this region (Fig. 5A). MyoD and MZF1 are tissue specific motifs, hence were not investigated. The role of remaining two motifs, namely SP-1 and AP-4, was examined in VEGF induced hCATL promoter activity. Site directed mutagenesis was employed as this method has been extensively used for the functional analysis of transcription factor binding motifs (Bontempi et al., 2007; Bayele et al., 2006; Hong et al., 2006). For this, we mutated those bases in the above motifs of the VRE, which have been reported to abolish binding of these transcription factors (Jean et al., 2002; Aranburu et al., 2001). The consensus sequence of AP-4 motif was mutated from ‘CAGCTG’ to ‘CcGCgG’ (pAP-4M) and that of the SP-1 motif was mutated from ‘GCCCAG’ to ‘GaaCAG’ (pSP-1M). The percentage reduction in the activity of pAP-4M construct was found to be comparable in control vs VEGF induced cells. However, mutation in the SP-1 motif (pSP-1M) construct resulted in a significant decrease in the VEGF induced promoter activity by 58%. Further, when both of the motifs were mutated simultaneously (pSAPM), we observed the maximal reduction in its activity (84%). This reduction was similar to the activity of pRB5 in control cells. Thus we conclude that both SP-1 and AP-4 motifs were involved in mediating maximal response to VEGF. The present study is the first report demonstrating VEGF induced increase in cathepsin L expression in human glioblastoma cells. VEGF has been shown to play a central regulatory role in both physiological and pathological angiogenesis (Ferrara and Davis-Smyth, 1997). The process of angiogenesis also requires proteases in order to degrade the basement membrane and facilitate the invasion of endothelial cells into the stroma of the neighboring tissue. Cathepsin L is potent in degrading several components of basement membrane and hence capable of playing an important role in angiogenesis. A recent report demonstrates that cathepsin L plays a critical role in endothelial progenitor cell mediated neovascularization (Urbich et al., 2005). In addition, blocking the secretion of human procathepsin L by highly metastatic melanoma cells could abolish the angiogenesis induced by them (Rousselet et al., 2004). These studies support the concept of involvement of cathepsin L in angiogenesis. In view of the above, we suggest that VEGF mediated cathepsin L upregulation observed may play an important role in augmenting tumor neoangiogenesis, invasion and metastasis. Acknowledgements This study was supported by grants from Department of Science and Technology and Department of Biotechnology, Govt. of India, New Delhi. S. Mittal is a recipient of Senior

136

S. Keerthivasan et al. / Gene 399 (2007) 129–136

Research Fellowship from Indian Council of Medical Research, Govt. of India, New Delhi. References Aranburu, A., Carlsson, R., Persson, C., Leanderson, T., 2001. Transcription factor AP-4 is a ligand for immunoglobulin-kappa promoter E-box elements. Biochem J. 354, 431–438. Armesilla, A.L., Lorenzo, E., Gomez del Arco, P., Martinez-Martinez, S., Alfranca, A., Redondo, J.M., 1999. Vascular endothelial growth factor activates nuclear factor of activated T cells in human endothelial cells: a role for tissue factor gene expression. Mol. Cell. Biol. 19, 2032–2043. Arora, S., Chauhan, S.S., 2002. Identification and characterization of a novel human cathepsin L splice variant. Gene 293, 123–131. Asanuma, K., Shirato, I., Ishidoh, K., Kominami, E., Tomino, Y., 2002. Selective modulation of the secretion of proteinases and their inhibitors by growth factors in cultured differentiated podocytes. Kidney Int. 62, 822–831. Avramis, I.A., et al., 2002. In vitro and in vivo evaluations of the tyrosine kinase inhibitor NSC 680410 against human leukemia and glioblastoma cell lines. Cancer Chemother. Pharmacol. 50, 479–489. Bakhshi, R., Goel, A., Seth, P., Chhikara, P., Chauhan, S.S., 2001. Cloning and characterization of human cathepsin L promoter. Gene 275, 93–101. Bayele, H.K., McArdle, H., Srai, S.K., 2006. Cis and trans regulation of hepcidin expression by upstream stimulatory factor. Blood. 108, 4237–4245. Behzadian, M.A., Windsor, L.J., Ghaly, N., Liou, G., Tsai, N.T., Caldwell, R.B., 2003. VEGF-induced paracellular permeability in cultured endothelial cells involves urokinase and its receptor. FASEB J. 17, 752–754. Bontempi, S., Fiorentini, C., Busi, C., Guerra, N., Spano, P., Missale, C., 2007. Identification and characterization of two nuclear factor-kB sites in the regulatory region of the dopamine D2 receptor. Endocrinology 148, 2563–2570. Chao, C., Al-Saleem, T., Brooks, J.J., Rogatko, A., Kraybill, W.G., Eisenberg, B., 2001. Vascular endothelial growth factor and soft tissue sarcomas: tumor expression correlates with grade. Ann. Surg. Oncol. 8, 260–267. Chauhan, S.S., Goldstein, L.J., Gottesman, M.M., 1991. Expression of cathepsin L in human tumors. Cancer Res. 51, 1478–1481. Chauhan, S.S., Ray, D., Kane, S.E., Willingham, M.C., Gottesman, M.M., 1998. Involvement of carboxy-terminal amino acids in secretion of human lysosomal protease cathepsin L. Biochemistry 37, 8584–8594. Divya, Chhikara, P., Mahajan, V.S., Datta Gupta, S., Chauhan, S.S., 2002. Differential activity of cathepsin L in human placenta at two different stages of gestation. Placenta 23, 59–64. Dvorak, H.F., Brown, L.F., Detmar, M., Dvorak, A.M., 1995. Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am. J. Pathol. 146, 1029–1039. Eppenberger-Castori, S., et al., 2002. Age-associated biomarker profiles of human breast cancer. Int. J. Biochem. Cell Biol. 34, 1318–1330. Ferrara, N., Davis-Smyth, T., 1997. The biology of vascular endothelial growth factor. Endocr. Rev. 18, 4–25. Flanagan, W.M., Corthesy, B., Bram, R.J., Crabtree, G.R., 1991. Nuclear association of a T-cell transcription factor blocked by FK-506 and cyclosporin A. Nature 352, 803. Goel, A., Chauhan, S.S., 1997. Role of proteases in tumor invasion and metastasis. Indian J. Exp. Biol. 35, 553–564. Gottesman, M.M., Sobel, M.E., 1980. Tumor promoters and Kirsten sarcoma virus increase synthesis of a secreted glycoprotein by regulating levels of translatable mRNA. Cell 19, 449–455. Guo, P., et al., 2001. Vascular endothelial growth factor isoforms display distinct activities in promoting tumor angiogenesis at different anatomic sites. Cancer Res. 61, 8569–8577. Hong, S.J., Huh, Y., Chae, H., Hong, S., Lardaro, T., Kim, K.S., 2006. GATA-3 regulates the transcriptional activity of tyrosine hydroxylase by interacting with CREB. J. Neurochem. 98, 773–781. Hunter, S.B., Moreno, C.S., 2002. Expression microarray analysis of brain tumors: what have we learned so far. Front. Biosci. 7, c74–c82.

Ishidoh, K., Kominami, E., 1995. Procathepsin L degrades extracellular matrix proteins in the presence of glycosaminoglycans in vitro. Biochem. Biophys. Res. Commun. 217, 624–631. Jean, D., Guillaume, N., Frade, R., 2002. Characterization of human cathepsin L promoter and identification of binding sites for NF-Y, Sp1 and Sp3 that are essential for its activity. Biochem. J. 361, 173–184. Kim, L.S., Huang, S., Lu, W., Lev, D.C., Price, J.E., 2004. Vascular endothelial growth factor expression promotes the growth of breast cancer brain metastases in nude mice. Clin. Exp. Metastasis 21, 107–118. Koshikawa, N., Iyozumi, A., Gassmann, M., Takenaga, K., 2003. Constitutive upregulation of hypoxia-inducible factor-1alpha mRNA occurring in highly metastatic lung carcinoma cells leads to vascular endothelial growth factor overexpression upon hypoxic exposure. Oncogene 22, 6717–6724. Kusanagi, K., Inoue, H., Ishidou, Y., Mishima, H.K., Kawabata, M., Miyazono, K., 2000. Characterization of a bone morphogenetic protein-responsive Smad-binding element. Mol. Biol. Cell. 11, 555–565. Lemaire, R., et al., 1997. Selective induction of the secretion of cathepsins B and L by cytokines in synovial fibroblast-like cells. Br. J. Rheumatol. 36, 735–743. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408. Mason, R.W., Johnson, D.A., Barrett, A.J., Chapman, H.A., 1986. Elastinolytic activity of human cathepsin L. Biochem. J. 233, 925–927. Masood, R., Cai, J., Zheng, T., Smith, D.L., Hinton, D.R., Gill, P.S., 2001. Vascular endothelial growth factor (VEGF) is an autocrine growth factor for VEGF receptor-positive human tumors. Blood 98, 1904–1913. Munaut, C., Noel, A., Hougrand, O., Foidart, J.M., Boniver, J., Deprez, M., 2003. Vascular endothelial growth factor expression correlates with matrix metalloproteinases MT1-MMP, MMP-2 and MMP-9 in human glioblastomas. Int. J. Cancer 106, 848–855. Nilsen-Hamilton, M., et al., 1991. Regulation of the expression of mitogenregulated protein (MRP; proliferin) and cathepsin L in cultured cells and in the murine placenta. Mol. Cell. Endocrinol. 77, 115–122. Prence, E.M., Dong, J.M., Sahagian, G.G., 1990. Modulation of the transport of a lysosomal enzyme by PDGF. J. Cell Biol. 110, 319–326. Rousselet, N., Mills, L., Jean, D., Tellez, C., Bar-Eli, M., Frade, R., 2004. Inhibition of tumorigenicity and metastasis of human melanoma cells by anti-cathepsin L single chain variable fragment. Cancer Res. 64, 146–151. Schmitt, M., Janicke, F., Greff, H., 1990. Tumour-associated fibrinolysis: the prognostic relevance of plasminogen activators uPA and tPA in human breast cancer. Blood Coagul. Fibrinolysis 6, 695–702. Senger, D.R., et al., 1993. Vascular permeability factor (VPF, VEGF) in tumor biology. Cancer Metastasis Rev. 12, 303–324. Sivaparvathi, M., et al., 1996. Expression and immunohistochemical localization of cathepsin L during the progression of human gliomas. Clin. Exp. Metastasis 14, 27–34. Stetler-Stevenson, W.G., Liotta, L.A., Kleiner Jr., D.E., 1993. Extracellular matrix 6: role of matrix metalloproteinases in tumor invasion and metastasis. FASEB J. 7, 1434–1441. Turk, V., Turk, D., Turk, B., 2000. Lysosomal cysteine proteases: more than scavengers. Biochem. Biophys. Acta 1477, 98–111. Urbich, C., et al., 2005. Cathepsin L is required for endothelial progenitor cellinduced neovascularization. Nat. Med. 11206–11213. Waguri, S., et al., 1995. Cysteine proteinases in GH4C1 cells, a rat pituitary tumor cell line, are secreted by the constitutive and regulated secretory pathways. Eur. J. Cell Biol. 67, 308–318. Zhang, Z., Fuentes, N.L., Fuller, G.M., 1995. Characterization of the IL-6 responsive elements in the gamma fibrinogen gene promoter. J. Biol. Chem. 270, 24287–24291. Zhang, W., Yatskievych, T.A., Cao, X., Antin, P.B., 2002. Regulation of Hex gene expression by a Smads-dependent signaling pathway. J. Biol. Chem. 277, 45435–45441. Zucker, S., et al., 1998. Vascular endothelial growth factor induces tissue factor and matrix metalloproteinase production in endothelial cells: conversion of prothrombin to thrombin results in progelatinase A activation and cell proliferation. Int. J. Cancer 75, 780–786.