Transcriptomic analysis of PhoR reveals its role in regulation of swarming motility and T3SS expression in Vibrio parahaemolyticus

Journal Pre-proof Transcriptomic analysis of PhoR reveals its role in regulation of swarming motility and T3SS expression in Vibrio parahaemolyticus Yibei Zhang, Huanhuan Liu, Dan Gu, Xingxu Lu, Xiaohui Zhou, Xiaodong Xia

PII:

S0944-5013(20)30121-X

DOI:

https://doi.org/10.1016/j.micres.2020.126448

Reference:

MICRES 126448

To appear in:

Microbiological Research

Received Date:

27 January 2020

Revised Date:

21 February 2020

Accepted Date:

22 February 2020

Please cite this article as: Zhang Y, Liu H, Gu D, Lu X, Zhou X, Xia X, Transcriptomic analysis of PhoR reveals its role in regulation of swarming motility and T3SS expression in Vibrio parahaemolyticus, Microbiological Research (2020), doi: https://doi.org/10.1016/j.micres.2020.126448

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Transcriptomic analysis of PhoR reveals its role in regulation of swarming motility and T3SS expression in Vibrio parahaemolyticus

Yibei Zhang1,2, Huanhuan Liu1, Dan Gu3, Xingxu Lu4, Xiaohui Zhou2, *, Xiaodong Xia1, 5, *

1 College

of Food Science and Engineering, Sino-US Joint Research Center, Northwest A&F University, Yangling, Shaanxi,

2 Department 3

ro of

712100, China of Pathobiology and Veterinary Science, University of Connecticut, Storrs, CT 06269-3089, USA

Jiangsu Key Laboratory of Zoonosis/Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou, China.

Department of Materials Science and Engineering and Institute of Materials Science, University of Connecticut, Storrs, CT

-p

4

06269-3136, USA

School of Food Science and Technology, National Engineering Research Center of Seafood, Dalian Polytechnic University,

re

5

*Corresponding authors

lP

1 Qinggongyuan, Ganjingzi District, Dalian, Liaoning, 116034 China.

Jo

ur

na

Email address: [email protected] (X. Xia), [email protected] (X. Zhou)

1

ABSTRACT Vibrio parahaemolyticus is a common foodborne pathogen in seafood and represents a major threat to human health worldwide. In this study, we identified that PhoR, a histidine kinase, is involved in the regulation of swarming and flagella assembly. RNA sequencing analysis showed that 1122 genes were differentially expressed in PhoR mutant, including 394 upregulated and 728 downregulated genes. KEGG enrichment and heatmap analysis demonstrated that the bacterial secretion system, flagella assembly and chemotaxis pathways

ro of

were significantly downregulated in PhoR mutant, while the microbial metabolism in diverse environments and carbon metabolism pathways were upregulated in PhoR mutant. qRT-PCR further confirmed that genes responsible for the type III secretion system (T3SS), swarming

-p

and the thermostable direct hemolysin were positively regulated by PhoR. Phosphorylation

re

assays suggested that PhoR was highly activated in BHI medium compared to LB medium. Taken together, these data suggested that activated PhoR contributes to the expression of

lP

swarming motility and secretion system genes in Vibrio parahaemolyticus. Keywords: Vibrio parahaemolyticus, transcriptome, PhoR, motility, type III secretion system

Jo

ur

na

(T3SS)

2

Introduction Vibrio parahaemolyticus (V. parahaemolyticus), the leading cause of human gastroenteritis worldwide, is associated with the consumption of raw seafood, such as oysters and mussels. In the last two decades, several large-scale foodborne V. parahaemolyticus outbreaks have been reported in the Pacific Northwest region of the United States (Paranjpye et al., 2012, Turner et al., 2013). The occurrence of V. parahaemolyticus in the United States has been steadily increasing in recent years (Abanto et al., 2020). V. parahaemolyticus gastroenteritis is also

ro of

common in China. In the city of Sanya, there were 29 outbreaks of V. parahaemolyticus, resulting in 479 illnesses from 2010 to 2016 and accounting for 45% of all cases of microbiological food poisoning (Deng et al. 2017). Symptoms of V. parahaemolyticus infection

-p

can include abdominal cramping, nausea, diarrhea, vomiting, chills and fever (Raszl et al.,

re

2016). The pathogenesis processes of V. parahaemolyticus include motility, adhesion, invasion, proliferation, in vivo production of toxins, and damage to cells and tissues (Gu et al., 2019).

lP

V. parahaemolyticus has multiple lifestyles and colonization strategies. It is adept at surface colonization and excels at social activities such as swarming and biofilm formation (Enos-

na

Berlage et al., 2005, Leon-Sicairos et al., 2015). V. parahaemolyticus is highly social and motile under a variety of circumstances, and it possesses two flagellar systems adapted for movement

ur

under different circumstances. Movement in liquid environments (called swimming) is propelled by a superbly fast rotating single, sheathed polar flagellum (Fla). Growth on surfaces

Jo

or viscous environments (called swarming) induces the lateral flagella system (Lamb et al. 2019). The polar flagellum is produced continuously, whereas the synthesis of lateral flagella is induced under conditions that impede the function of the polar flagellum. Signal transduction mediated by two-component regulatory systems (TCSs) is one of the primary strategies utilized by bacteria to adapt to changing environments. The histidine kinase

3

(HK), a major component of TCSs, plays a central role in extracellular stimuli recognition and intracellular autokinase activity modulation, and the transfer of its phosphoryl group to the response regulator (RR), another component of TCSs, leads to downstream gene regulation in response to a signal (s) (Jacob-Dubuisson et al., 2018). TCSs regulate diverse signaling pathways, including motility. For example, EnvZ/OmpR is known to be involved in motility and virulence in a Acinetobacter baumannii (Tipton and Rather 2017). QseB/QseC is involved in the regulation of flagella and motility by quorum sensing in E. coli (Haque et al., 2019). The

saturated fatty acids (Lai et al., 2005, Wei et al., 2017).

ro of

RssA/RssB TCS in Serratia marcescens regulates swarming motility in response to exogenous

The PhoR histidine kinase and PhoB response regulator were some of the earliest known

-p

members of the TCS family of proteins (Bachhawat et al., 2005). PhoR/PhoB operon regulates

re

the expression of genes involved in the acquisition of phosphate (Pi) and its derivatives and the utilization of alternate sources of phosphorus, such as phosphonates (Santos-Beneit 2015).

lP

PhoR is autophosphorylated under Pi starvation conditions (forming PhoR-P), and its phosphate group is transferred to dephosphorylated PhoB. The phosphorylated PhoB

na

transcriptional factor (PhoB-P) in turn regulates the transcription of a set of gene known as the Pho regulon, which involved in phosphate homeostasis. Unlike other sensor histidine kinases,

ur

PhoR does not contain a significant periplasmic domain, but it is assumed to possess an extended cytoplasmic Per-Arnt-Sim (PAS) domain, whose proposed function is to sense

Jo

internal signals (Gardner and McCleary 2019). Apart from controlling phosphate homeostasis, the Pho regulon is part of a complex network important for bacterial virulence and stress response (Lamarche et al., 2008). The involvement of Pho regulon in the regulation of virulence is observed in many pathogens. In vivo expression experiments revealed that Pho regulon genes are induced during infection in Yersinia pestis and Mycobacterium tuberculosis (Chatterjee et al., , Chatterjee et al., 2006, Grabenstein et al., 2006). In Vibrio cholerae O1, the PhoR/PhoB 4

system contributes to oxidative stress resistance (Goulart et al. 2016). In the plant pathogen Agrobacterium tumefaciens, PhoR/PhoB enhances biofilm formation under phosphorus limitation condition (Danhorn et al. 2004). PhoR possess an asymmetric structure of the dimerization domain and is important for the virulence of Mycobacterium tuberculosis (Xing et al., 2017). PhoR is responsible for kdpFABC expression in the absence of KdpD, which is crucial for K+ homeostasis in E. coli (Schramke et al., 2017). However, the role of PhoR in Vibrio parahaemolyticus has not been studied.

ro of

The aim of this study was to assess the key role of PhoR in the regulation of V. parahaemolyticus swarming motility and global gene expression. The RNA-sequencing (RNAseq) showed that PhoR is involved in multiple cellular processes, including flagellar assembly,

-p

chemotaxis and the bacterial secretion system. These findings revealed the pathways regulated

re

by PhoR in V. parahaemolyticus, which is helpful for developing therapeutic strategies

Strains and Plasmids

lP

Materials and methods

na

The strains and plasmids used in this study are listed in Table 1. All E. coli strains were cultured in LB at 37 °C. WT V. parahaemolyticus RIMD 2210633 was grown in Luria-Bertani (LB) broth containing 1 % NaCl at 37°C. Antibiotics were used at the following concentrations: for

ur

E. coli, chloramphenicol (Cm) at 25 μg/mL; for V. parahaemolyticus, carbenicillin (Carb) at 50

Jo

μg/mL in LB.

Construction of the PhoR mutant and complemented strain The in-frame deletion mutant was generated by sacB-based allelic exchange as previously described (Hmelo et al., 2015). To construct the phoR deletion mutant (ΔPhoR), the upstream

and downstream regions flanking VP0570 (phoR) were amplified using the primer pairs pDM4-phoR-1/pDM4-phoR-2 and pDM4-phoR-3/pDM4-phoR-4, respectively (Table 2). The 5

two PCR products were cloned into XhoI-digested pDM4, resulting in plasmid pDM4::phoR. After sequencing and purification, this plasmid was transformed into SM10 λpir by electric shock and subsequently transferred into RIMD 2210633 by conjugation. Single crossover recombination was selected on LB agar plate containing Cm and Carb and double crossover recombination events were selected on LB agar plate containing 10 % sucrose. The primers phoR-outF/R were used to verify the mutant. The complementary plasmids were constructed with pMMB207 as previously described (Li et

ro of

al., 2016). The VP0570 gene was PCR amplified using primers pMMB207-phoR-F and pMMB207-phoR-R. A 6 × His tag was added at the C-terminus. The PCR product was inserted

-p

into HindIII and XbaⅠ double-digested pMMB207, resulting in plasmid pMMB207::phoR (Table 2). This plasmid was used to complement ΔPhoR mutant and to express PhoR protein

re

for the phosphorylation assay. The primers used in this study are listed in Table 2.

lP

Bacterial motility assay

An overnight culture of V. parahaemolyticus was diluted to an OD 600 of 0.5, and then 1 μL

na

of the bacterial suspension was spotted onto the LB plates containing 0.3 % agar for the swimming test or the brain heart infusion (BHI) plates containing 1.5 % agar for the swarming

ur

test.

Jo

Biofilm formation assay

Biofilm formation capacity was determined as previously described (Enos-Berlage et al. 2005). Briefly, the cultures (200 μL) were added into 96-well plates containing LB medium and incubated at 30°C without shaking for 24 h. Then, the cell suspensions were removed, and each well was washed twice with PBS. After staining by 0.1 % crystal violet for 20 min, each well

6

was rinsed with PBS followed by destaining with 33% acetic acid, the absorbance was then measured at 595 nm. RNA-seq analysis Total bacterial RNA was extracted using the RNeasy Plus Kit (Qiagen) according to the manufacturer’s instructions. The complemental DNA (cDNA) libraries of all samples were constructed and sequenced by Genewiz, Ltd. (USA) on the Illumina sequencing platform

ro of

(HiSeqTM 2500), which produced 150-bp double-end reads. Reads from Illumina sequencing were aligned to the reference genome (GCA_000196095.1) of V. parahaemolyticus using Rockhopper. Expression analysis of all samples was performed using EdgeR (Robinson et al., 2010). The absolute value of the log2 ratio ≥ 1 and p value < 0.01 were applied as threshold

-p

values to define a significant difference in gene expression levels. All differentially expressed

re

genes (DEGs) were annotated to the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database (Kanehisa et al., 2012), and the cluster Profiler R package (Yu et al., 2012)

lP

was used to perform KEGG enrichment analysis and classify the differentially expressed genes. The Pheatmap R package was used to draw heatmaps (Metsalu and Vilo 2015).

na

Transmission electron microscopy (TEM)

ur

Bacterial cultures were spotted onto the swarming plates, and incubated at 30°C for 14 h. The bacteria were collected from solid medium, washed and suspended with 0.9 % NaCl. After a

Jo

drop of suspension was spotted on the surface of 400-mesh gold grids, 1 % osmium peroxide (OsO4) was used to fix the cells for 10 min. Then, the lateral flagella were examined using a high-resolution transmission electron microscope (FEI Talos F200X S/TEM, 200 kV). The TEM study were performed in the UConn/ThermoFisher Scientific Center for Advanced Microscopy and Materials Analysis (CAMMA). Quantitative real-time PCR (qRT-PCR) 7

The WT and ΔPhoR V. parahaemolyticus strains were cultured in LB supplemented with 50 μg/mL carbenicillin or with 25 μg/mL chloramphenicol (for complementation) for 5 h. The total RNA was isolated by the RNeasy Plus Kit (Qiagen), and the DNA was digested using DNase I (Thermo Fisher Scientific). Then, equal amounts of RNA (500 ng) were used to generate cDNA using a cDNA Synthesis Kit (Bio-Rad). The cDNA was then amplified with SYBR Green qPCR Master Mix (Bimake) with specific primer pairs (Table 2) on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The average Ct values were normalized

ro of

using gyrB as the reference gene, and relative fold changes in gene expression were calculated according to the 2-ΔΔCt method. Phosphorylation Assay.

-p

In vivo phosphorylation was determined by Phos-tag assay. Bacterial strains harboring

re

pMMB207-PhoR-his vectors were grown in LB broth and BHI plates. Protein expression was induced by 1 mM IPTG for 2 h in LB broth with shaking and 12 h on BHI plates without

lP

shaking. Following treatment, whole-cell lysate was obtained by sonication and resolved in 12 % (wt/vol) SDS gels (29:1) containing 50 μM Phos-tagged acrylamide (Wako) and 100 μM

na

MnCl2. Proteins in the Phos-tagged gels were transferred onto a nitrocellulose membrane, and the protein mobility shift was determined by western blotting using an anti-His antibody.

Jo

group.

ur

Meanwhile, the protein mobility shift was also performed in regular 12 % SDS gels as a control

Results

PhoR mediates swarming motility in V. parahaemolyticus Compare to WT strain, PhoR deletion mutant did not show significant difference in swimming and biofilm formation (Fig. S2). For the swarming assay, ΔPhoR mutant showed less swarming motility compared to WT on the BHI plates. The complemented strain ΔPhoR::pPhoR restored 8

swarming motility, which confirmed the role of PhoR in swarming motility in V. parahaemolyticus (Fig. 1A). Furthermore, we observed the flagella in the ΔPhoR and WT strains by transmission electron microscopy (TEM). While the WT strain was surrounded by a significant amount of lateral flagellum (Fig. 1B&C), there are much fewer lateral flagella in ΔPhoR (Fig. 1D&E). These results indicated that PhoR regulated the lateral flagella assembly and swarming motility.

ro of

Identification of genes that are regulated by PhoR High-throughput sequencing technology has made it possible to obtain detailed transcriptomic profiles and improve our understanding of the genetic variation involved in pathogen infection and virulence (Joshi et al., 2016, Salmon-Divon et al., 2019). We performed RNA sequencing

-p

(RNA-seq) experiments to identify the PhoR regulon and further elucidate the possible

re

mechanisms of PhoR-regulated swarming motility. In these experiments, we compared the transcriptomes of WT strain and ΔPhoR mutant (log2 FC < 1, p < 0.01). We found that 1122

lP

(23 %) of the 4831 annotated V. parahaemolyticus ORFs were significantly altered in the ΔPhoR strain compared with the WT strain. As shown in Fig. 2B, the MA plot showed the

na

distribution of DEGs, and among these genes, 728 (15 %) genes were downregulated, illustrating that most of the genes are positively regulated by PhoR in LB medium. On the other

ur

hand, 394 genes were upregulated in ΔPhoR, showing that many functions are somehow normally repressed through a mechanism involving the function of PhoR (Fig. 2A and

Jo

Supplementary Data ).

KEGG analysis of genes that are regulated by PhoR KEGG pathway analysis can help to further understand the biological functions of genes. Based on the transcriptomic results, KEGG analysis was performed to elucidate the pathways regulated by PhoR. More than 20 KEGG pathways were enriched, and the top 20 upregulated

9

and downregulated pathways are listed in Fig. 3A and 3B, respectively. A total of 11 downregulated genes was assigned to the “bacterial secretion system” KEGG pathway. Notably, all these genes were associated with type III secretion system on chromosome 1 (T3SS1), including VP1662, VP1668, VP1675, and VP1696 (Fig. 3C). A total of 22 genes of the flagella system and 7 chemotaxis genes were downregulated in the PhoR mutant, indicating that PhoRmediated regulation of swarming motility was possibly due to the altered expression of lateral flagella and chemotaxis genes in V. parahaemolyticus. In addition, 23 genes were involved in

ro of

the two-component system. A total of 40 genes involved in ABC transporters, DNA replication, nitrogen metabolism and quorum sensing were significantly downregulated in the PhoR mutant. Moreover, the major upregulated DEGs identified in these two strains were commonly enriched

-p

in the pathways of microbial metabolism in diverse environments (51 genes), glyoxylate and dicarboxylate metabolism (15 genes), biosynthesis of antibiotics (44 genes) and carbon

re

metabolism (30 genes) (Fig. 3B). In addition, twenty-six genes (9 downregulated and 17

lP

upregulated) assigned to “quorum sensing” KEGG pathway were altered in ΔPhoR compared to wild-type. Furthermore, the heatmap (Fig. 3C) revealed differentially expressed genes involved in the flagella assembly, chemotaxis and type III secretion system (T3SS1) cluster.

na

Most of these genes showed reduced transcription in ΔPhoR, suggesting that PhoR positively regulate the transcription of these genes. Overall, these results indicated that PhoR plays an

ur

important role in multiple metabolic and virulence pathways in V. parahaemolyticus.

Jo

Transcriptional levels of the lateral flagellar gene in ΔPhoR RNA-seq analysis indicated that the lateral flagellar genes were downregulated in the ΔPhoR strain. Thirty-eight genes of the lateral flagellar system were divided into two clusters, with lateral flagellar cluster I containing 14 genes (flgNM, flgA, and flgBCDEFGHIJKL, from VPA0261 to VPA0274) and cluster II containing 24 genes (fliJIHGFE, lafK, motY, fliM, fliNPQR, flhBA, lafA, fliDSTKLA, and motAB, from VPA1532 to VPA1557) (Gu et al. 2019). 10

qRT-PCR demonstrated that the relative expression of VPA1539, VPA1536 and VPA1542 was reduced by 0.6-, 0.3, and 0.37-fold, respectively in PhoR mutant compared to wild-type strain (Fig. 4A). Complementation restored the gene expression. Reduced expression of both VPA0266 and VPA0269 was corroborated by qRT-PCR (0.3-fold) (Fig. 4B). Furthermore, several genes encoding chemotaxis proteins were downregulated, including VPA1557, VPA049, VPA1541, VP2827, VPA0511, VPA0842 and VPA0746 (Supplementary Data 1). Based on the results of the RNA-seq analysis and swarming assay, it is proposed that PhoR

ro of

could regulate swarming motility by modulating the expression of the lateral flagellar genes in V. parahaemolyticus. Transcriptional levels of the T3SS1 gene in ΔPhoR

-p

We next selected three T3SS1 genes as the target genes for real-time qRT-PCR analysis, and

re

the results indicated that the absence of PhoR led to reduction in the relative expression of VP1696, VP1668 and VP1662 (0.5-, 0.2- and 0.25-fold, respectively) (Fig. 4C). On the other

lP

hand, restored expression was noted after PhoR was complemented (1.5-, 0.3- and 0.6-fold, respectively) suggesting that PhoR regulates the expression of the T3SS1 genes in V.

na

parahaemolyticus. In addition, according to the transcriptomic results, the expression of VPA1509 (tdh), which encodes thermostable direct hemolysin and is considered the major

ur

virulence factor in V. parahaemolyticus, was reduced to 0.32- and 0.6-fold based on RNA-seq

Jo

and qRT-PCR, respectively (Fig. 4D). PhoR can be phosphorylated under LB and BHI conditions DNAMAN Blast indicated that V. parahaemolyticus PhoR shared 97.22 %, 96.99 %, 96.99 %, 88.89 %, 87.04 % identity with homologous proteins in Vibrio alginolyticus, Vibrio harveyi, Vibrio campbellii, Vibrio vulnificus and Vibrio cholerae, respectively (Fig. S1). Histidine kinases usually contain a conserved histidine residue that can be phosphorylated, and

11

phosphorylation of this residue is essential for its signal transducing function. We determined PhoR phosphorylation using a Phos-tag assay; in this assay, the migration of phosphorylated proteins is retarded in SDS/PAGE gels. In this experiment, we grew bacteria in LB broth and BHI plates (swarming plates), and whole-cell lysates were obtained for SDS/PAGE and Western blotting. Under the LB condition, a shifted band (PhoR-P) of PhoR_6xHis was detected when proteins were separated in Phos-tag gel (Fig. 5), indicating that PhoR was phosphorylated. When the protein was expressed in BHI media, the phosphorylation increased

ro of

compared to the LB condition, indicating that PhoR was more active in the BHI environment. Discussion

Bacteria predominantly use TCSs to adapt to changing environmental conditions. PhoR plays

-p

a crucial role in several pathogens for processing the phosphate-starvation signal and

re

modulating virulence. To illustrate the transcriptomic alterations caused by PhoR and provide a comprehensive understanding of PhoR in regulating signaling pathways, we performed RNA

lP

sequencing between wild-type and PhoR mutant strains of V. parahaemolyticus. The RNA-seq analysis showed that genes involved in multiple biosynthesis and metabolism pathways was

na

altered, and the most genes affected are related to flagellar assembly, two-component system, bacterial secretion system, and bacterial chemotaxis, which contribute substantially to in

ur

bacterial virulence. The flagella assembly and T3SS1 pathways were among the most

Jo

influenced genes (Fig. 2B & Supplementary data 1). V. parahaemolyticus causes severe diarrhea in humans by traveling through the stomach and eventually colonizing the small intestine. Motility has been shown to be an important trait for the pathogen to colonize the epithelium and cause infection of the human host. In our study, the PhoR mutant exhibited reduced swarming motility and produced fewer lateral flagella compared to the wild-type strain. At the same time, the expressions of VPA0266, VPA0269,

12

VPA1536, VPA1539 and VPA1542 (which encode flagella components) were reduced in the ΔPhoR strain. All these data suggested that PhoR positively modulates the expression of flagella assembly genes and swarming motility in V. parahaemolyticus, which agree with the results reported by Manjeet et al, who illustrate that the swarming motility of the PhoR/PhoB mutant strain is weaker than that of the wild-type strain under low phosphate conditions in Pseudomonas aeruginosa (Bains et al., 2012). On the other hand, quorum sensing was used to detect and to respond to cell population density. The lateral flagellar genes transcription can be

ro of

regulated oppositely by AphA and OpaR (quorum sensing regulators) in V. parahaemolyticus (Lu et al., 2019). It is worth noting that the transcription of 17 genes associated with quorum sensing pathway was highly induced and that of 9 genes was significantly repressed in PhoR

-p

mutant (Fig. 2B and Supplementary data 1) in our study. Thus, it is possible that PhoR regulate

re

swarming motility by modulating quorum sensing in addition to flagella genes. V. parahaemolyticus possesses various virulence factors responsible for hemolytic activity,

lP

cytotoxicity, intestinal toxicity, gastroenteritis, diarrhea and even death. At present, the main virulence factors identified so far include hemolytic toxin, adhesin, protease, outer membrane

na

protein, lipopolysaccharide, urease, and type III (T3SS) and type VI (T6SS) secretion systems (Wang et al., 2015). V. parahaemolyticus harbors two T3SSs (T3SS1 and T3SS2) encoded on

ur

chromosomes 1 and 2, respectively. T3SS1 is composed of over 40 consecutive genes (VP1656–VP1702), and it mainly contributes to the cytotoxicity of V. parahaemolyticus and

Jo

induces a series of events, including autophagy, membrane blebbing, and cell lysis (Zhang et al., 2018). In our study, VP1696 (type III secretion protein YscC), VP1668 (ATP synthase in T3SS) and VP1662 (inner membrane protein in T3SS) were selected based on RNA-seq data then subjected to qRT-PCR. Both the RNA-seq and qPCR results showed that the expression of T3SS1 genes was decreased in ΔPhoR compared to WT and was restored in the ΔPhoR::pPhoR strain. The results that PhoR regulates T3SS1 genes in V. parahaemolyticus 13

were consistent with previous study showing that PhoR/PhoB senses phosphate to regulate T3SS in Edwardsiella tarda (Chakraborty et al., 2011). Pi is the essential nutrient in the environment and essential for bacterial growth. PhoR has been reported to be phosphorylated under Pi-limited (< 4 μM) environments in E.coli. Pi starvation promotes swarming motility of Pseudomonas aeruginosa (Bains et al. 2012), while swarming events of V. parahaemolyticus can be induced in BHI media. In our study, we observed that phosphorylation increased on BHI plates and promoted swarming motility, suggesting that PhoR activation is increased duing

ro of

swarming event. Since V. parahaemolyticus is present in the aquatic environments that are generally limited for Pi, it is possible that such condition could be a stimulating signal of PhoR.

-p

Conclusions

In summary, we report the genome-wide transcriptional changes in the PhoR mutant and

re

demonstrate the key role of PhoR in potential signal recognition and virulence modulation in V. parahaemolyticus. Our data contribute to the understanding of the PhoR-regulated network

Author statement

na

lP

and its underlying mechanisms in V. parahaemolyticus.

ur

YB, HL, DG, XL performed the experiment. YB, XZ and XX wrote the manuscript.

Jo

Acknowledgements

This work was supported the scholarship from China Scholarship Council under the Grant CSC No. 201706300098 (YZ) and University of Connecticut Start-up fund (XZ).

14

References

Abanto, M., Gavilan, R. G., Baker-Austin, C., Gonzalez-Escalona, N. and Martinez-Urtaza, J., 2020. Global Expansion of Pacific Northwest Vibrio parahaemolyticus Sequence Type 36. Emerg Infect Dis 26: 323-326. Bachhawat, P., Swapna, G. V., Montelione, G. T. and Stock, A. M., 2005. Mechanism of activation for transcription factor PhoB suggested by different modes of dimerization in the inactive and active states. Structure 13: 1353-1363.

ro of

Bains, M., Fernandez, L. and Hancock, R. E., 2012. Phosphate starvation promotes swarming motility and cytotoxicity of Pseudomonas aeruginosa. Appl Environ Microbiol 78: 6762-6768.

-p

Blanco, A. G., Maria Sola, F. Xavier Gomis-Rüth and Coll, M., 2002. Tandem DNA Recognition by PhoB, a TwoComponent Signal Transduction Transcriptional Activator. Structure 10: 701-013.

re

Chakraborty, S., Sivaraman, J., Leung, K. Y. and Mok, Y.-K., 2011. Two-component PhoB-PhoR Regulatory

lP

System and Ferric Uptake Regulator Sense Phosphate and Iron to Control Virulence Genes in Type III and VI Secretion Systems ofEdwardsiella tarda. Journal of Biological Chemistry 286: 39417-39430.

na

Chatterjee, S. S., Hossain H Fau - Otten, S., Otten S Fau - Kuenne, C., Kuenne C Fau - Kuchmina, K., Kuchmina K Fau - Machata, S., Machata S Fau - Domann, E., Domann E Fau - Chakraborty, T., Chakraborty T Fau - Hain,

ur

T. and Hain, T., Intracellular gene expression profile of Listeria monocytogenes. Chatterjee, S. S., Hossain, H., Otten, S., Kuenne, C., Kuchmina, K., Machata, S., Domann, E., Chakraborty, T.

Jo

and Hain, T., 2006. Intracellular gene expression profile of Listeria monocytogenes. Infect Immun 74: 1323-1338. Danhorn, T., Hentzer, M., Givskov, M., Parsek, M. R. and Fuqua, C., 2004. Phosphorus limitation enhances biofilm formation of the plant pathogen Agrobacterium tumefaciens through the PhoR-PhoB regulatory system. J Bacteriol 186: 4492-4501. Deng, C., Deng, Y. and Jiangyuan, Y., 2017. Analysis of microbial food poisoning from 2010 to 2016 in Sanya

15

city. Hainan Medical Journal 28: 2723-2725. Enos-Berlage, J. L., Guvener, Z. T., Keenan, C. E. and McCarter, L. L., 2005. Genetic determinants of biofilm development of opaque and translucent Vibrio parahaemolyticus. Mol Microbiol 55: 1160-1182. Gardner, S. G. and McCleary, W. R., 2019. Control of the phoBR Regulon in Escherichia coli. EcoSal Plus 8. Goulart, C. L., Barbosa, L. C., Bisch, P. M. and von Kruger, W. M. A., 2016. Catalases and PhoB/PhoR system independently contribute to oxidative stress resistance in Vibrio cholerae O1. Microbiology 162: 1955-1962.

ro of

Grabenstein, J. P., Fukuto, H. S., Palmer, L. E. and Bliska, J. B., 2006. Characterization of Phagosome Trafficking and Identification of PhoP-Regulated Genes Important for Survival of Yersinia pestis in Macrophages. Infection and Immunity 74: 3727.

-p

Gu, D., Meng, H., Li, Y., Ge, H. and Jiao, X., 2019. A GntR Family Transcription Factor (VPA1701) for Swarming

re

Motility and Colonization of Vibrio parahaemolyticus. Pathogens 8.

lP

Haque, S., Yadav, D. K., Bisht, S. C., Yadav, N., Singh, V., Dubey, K. K., Jawed, A., Wahid, M. and Dar, S. A., 2019. Quorum sensing pathways in Gram-positive and -negative bacteria: potential of their interruption in abating

na

drug resistance. J Chemother 31: 161-187.

Hmelo, L. R., Borlee, B. R., Almblad, H., Love, M. E., Randall, T. E., Tseng, B. S., Lin, C., Irie, Y., Storek, K.

ur

M., Yang, J. J., Siehnel, R. J., Howell, P. L., Singh, P. K., Tolker-Nielsen, T., Parsek, M. R., Schweizer, H. P. and Harrison, J. J., 2015. Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange.

Jo

Nat Protoc 10: 1820-1841.

Jacob-Dubuisson, F., Mechaly, A., Betton, J. M. and Antoine, R., 2018. Structural insights into the signalling mechanisms of two-component systems. Nat Rev Microbiol 16: 585-593. Joshi, R. K., Megha, S., Basu, U., Rahman, M. H. and Kav, N. N., 2016. Genome Wide Identification and Functional Prediction of Long Non-Coding RNAs Responsive to Sclerotinia sclerotiorum Infection in Brassica

16

napus. PLoS One 11: e0158784. Kanehisa, M., Goto, S., Sato, Y., Furumichi, M. and Tanabe, M., 2012. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res 40: D109-114. Lai, H. C., Soo, P. C., Wei, J. R., Yi, W. C., Liaw, S. J., Horng, Y. T., Lin, S. M., Ho, S. W., Swift, S. and Williams, P., 2005. The RssAB Two-Component Signal Transduction System in Serratia marcescens Regulates Swarming Motility and Cell Envelope Architecture in Response to Exogenous Saturated Fatty Acids. Journal of Bacteriology

ro of

187: 3407-3414.

Lamarche, M. G., Wanner Bl Fau - Crepin, S., Crepin S Fau - Harel, J. and Harel, J., 2008. The phosphate regulon and bacterial virulence: a regulatory network connecting phosphate homeostasis and pathogenesis. FEMS

-p

Microbiol Rev 32: 461-473.

re

Lamb, E., Trimble, M. J. and McCarter, L. L., 2019. Cell-cell communication, chemotaxis and recruitment in

lP

Vibrio parahaemolyticus. Mol Microbiol 112: 99-113.

Leon-Sicairos, N., Angulo-Zamudio, U. A., de la Garza, M., Velazquez-Roman, J., Flores-Villasenor, H. M. and

na

Canizalez-Roman, A., 2015. Strategies of Vibrio parahaemolyticus to acquire nutritional iron during host colonization. Front Microbiol 6: 702.

ur

Li, L., Wang, Q., Zhang, H., Yang, M., Khan, M. I. and Zhou, X., 2016. Sensor histidine kinase is a β-lactam receptor and induces resistance to β-lactam antibiotics. Proceedings of the National Academy of Sciences 113:

Jo

1648-1653.

Lu, R., Tang, H., Qiu, Y., Yang, W., Yang, H., Zhou, D., Huang, X., Hu, L. and Zhang, Y., 2019. Quorum sensing regulates the transcription of lateral flagellar genes in Vibrio parahaemolyticus. Future Microbiology 14: 10431053. Metsalu, T. and Vilo, J., 2015. ClustVis: a web tool for visualizing clustering of multivariate data using Principal

17

Component Analysis and heatmap. Nucleic Acids Res 43: W566-570. Paranjpye, R., Hamel, O. S., Stojanovski, A. and Liermann, M., 2012. Genetic diversity of clinical and environmental Vibrio parahaemolyticus strains from the Pacific Northwest. Appl Environ Microbiol 78: 86318638. Raszl, S. M., Froelich, B. A., Vieira, C. R., Blackwood, A. D. and Noble, R. T., 2016. Vibrio parahaemolyticus and Vibrio vulnificus in South America: water, seafood and human infections. J Appl Microbiol 121: 1201-1222.

ro of

Robinson, M. D., McCarthy, D. J. and Smyth, G. K., 2010. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26: 139-140.

Salmon-Divon, M., Zahavi, T. and Kornspan, D., 2019. Transcriptomic Analysis of the Brucella melitensis Rev.1

-p

Vaccine Strain in an Acidic Environment: Insights Into Virulence Attenuation. Front Microbiol 10: 250.

re

Santos-Beneit, F., 2015. The Pho regulon: a huge regulatory network in bacteria. Front Microbiol 6: 402.

lP

Schramke, H., Laermann, V., Tegetmeyer, H. E., Brachmann, A., Jung, K. and Altendorf, K., 2017. Revisiting regulation of potassium homeostasis in Escherichia coli: the connection to phosphate limitation.

na

Microbiologyopen 6.

Sperandio, V., Torres, A. G. and Kaper, J. B., 2002. Quorum sensing Escherichia coli regulators B and C (QseBC):

ur

a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol Microbiol 43: 809-821.

Jo

Stock, J. B., Ninfa, A. J. and Stock, A., 1989. Protein Phosphorylation and Regulation of Adaptive Responses in Bacteria. Microbiology and Molecular Biology Reviews 53: 450-490. Tipton, K. A. and Rather, P. N., 2017. An ompR-envZ two-component system ortholog regulates phase variation, osmotic tolerance, motility, and virulence in Acinetobacter baumannii strain AB5075. Journal of bacteriology 199. Turner, J. W., Paranjpye, R. N., Landis, E. D., Biryukov, S. V., Gonzalez-Escalona, N., Nilsson, W. B. and Strom,

18

M. S., 2013. Population structure of clinical and environmental Vibrio parahaemolyticus from the Pacific Northwest coast of the United States. PLoS One 8: e55726. Wang, R., Zhong, Y., Gu, X., Yuan, J., Saeed, A. F. and Wang, S., 2015. The pathogenesis, detection, and prevention of Vibrio parahaemolyticus. Front Microbiol 6: 144. Wei, C.-F., Tsai, Y.-H., Tsai, S.-H., Lin, C.-S., Chang, C.-J., Lu, C.-C., Huang, H.-C. and Lai, H.-C., 2017. Crosstalk between bacterial two-component systems drives stepwise regulation of flagellar biosynthesis in swarming

ro of

development. Biochemical and Biophysical Research Communications 489: 70-75.

Xing, D., Ryndak, M. B., Wang, L., Kolesnikova, I., Smith, I. and Wang, S., 2017. Asymmetric Structure of the Dimerization Domain of PhoR, a Sensor Kinase Important for the Virulence of Mycobacterium tuberculosis. ACS

-p

Omega 2: 3509-3517.

lP

among gene clusters. OMICS 16: 284-287.

re

Yu, G., Wang, L. G., Han, Y. and He, Q. Y., 2012. clusterProfiler: an R package for comparing biological themes

Zhang, Y., Hu, L., Osei-Adjei, G., Zhang, Y., Yang, W., Yin, Z., Lu, R., Sheng, X., Yang, R., Huang, X. and Zhou,

na

D., 2018. Autoregulation of ToxR and Its Regulatory Actions on Major Virulence Gene Loci in Vibrio

Jo

ur

parahaemolyticus. Front Cell Infect Microbiol 8: 291.

19

Table 1 Bacterial strains and plasmids used in the study Strain or plasmid

Relevant characteristics

Reference or source

Host for π requiring plasmids,

Laboratory collection

Strains E. coli SM10 λpir

conjugal donor V. parahaemolyticus RIMD2210633

Clinical isolate. Carbr

Laboratory collection

ΔPhoR

RIMD 2210633, in-frame deletion in

This study

phoR, ΔPhoR::pPhoR

Carbr

ΔPhoR, pMMB207 expressing the

This study

Plasmids pDM4

Suicide vector, pir dependent, R6K, SacBR,

Cmr

IncQ lacIq Δbla Ptac-lac lacZa, Cmr

pDM4::phoR

Plasmid for deletion of phoR, Cmr

pMMB207::phoR

RBS and phoR sequences clones into Cmr

Jo

ur

na

lP

re

pMMB207,

Laboratory collection

Laboratory collection This study

-p

pMMB207

ro of

phoR-his gene, Carbr, Cmr

20

This study

Table 2 Primers used in this study Primers

Sequence (5'-3')

pDM4-phoR-1

GAGCTCAGGTTACCCGCATGCAAGATCTATGTTGTTGAAGACGAAGCTCCAATTC

pDM4-phoR-2

CACCAAACGAACTCATTACTCCAGAAATGGCATTG

pDM4-phoR-3

AGTAATGAGTTCGTTTGGTGGTGAAATAATGGGAC

pDM4-phoR-4

CCCTCGAGTACGCGTCACTAGTGGGGCCCTTCGCTCAAACGCTTCGATTTCTTTC

pMMB207-phoR-F

AGCTCGGTACCCGGGGATCCTCTAGTAAGGAGGTAGGATAATAGTGGTTGAAAGATT AACGTGG

pMMB207-phoR-R

TCTCATCCGCCAAAACAGCCAAGCTTTAGTGATGATGATGATGATGTTTCACCACCA AACGACTTGG AGGGGCGCGCTTTGTCTCTTAAATT

phoR-outR

TTCGCCCATTCGGCTTTTAAACCTA

gyrB-RT-F

GCGTGGGTGTTTCGGTAGTA

gyrB-RT-R

CGTATCACCCACAACCGCTA

VP1668-RT-F

TCTTGGCGTTCGCTCCATAG

VP1668-RT-R

CGCCAATCAGAGCAAGAACG

VP1662-RT-F

CACCAAAGCCAGCACTAGGA

VP1662-RT-R

TGTTTCCCACGAAGACTCGG

VP1696-RT-F

CCTAGGTACGGAATGTCGCC

VP1696-RT-R

GATCCCAGATGGTGGTGTGG

VPA1539-RT-F

AAGGGAAGGAATGGCAAGGT

VPA1539-RT-R

TAATCCAACTACCACCGGCA

VPA1536-RT-F

GCCAACAAGAGCGATTCGAT

VPA1536-RT-R

TTTACGCCTTTTGACGCCAA

VPA1542-RT-F

GCACAACAAGAGTACAGCGT

VPA1542-RT-R

CAATACCCACTAACACGCGG

VPA0266-RT-F

CCCAACGGATAAGAACAGCG

VPA0266-RT-R

ACCTTCGACATGTTCTCGGT

VPA0269-RT-F

AGATCTAGCGGTAATGGGGC

VPA0269-RT-R

GAGAAAGAGGTCGCGTTGTC

VPA1509-RT-F

CCGTCTAGAGCTTGCTCGTA

VPA1509-RT-R

ATTGAGTTGAATGCCGCTGG

Jo

ur

na

lP

re

-p

ro of

phoR-outF

21

ro of -p re lP na ur Jo Fig. 1 PhoR regulates swarming motility in V. parahaemolyticus. (A) The swarming ability of the wild-type strain, ΔPhoR mutant and ΔPhoR::pPhoR strain was determined on 1.5 % BHI agar plates. Lateral flagellar of wild-type (B&C) and ΔPhoR (D&E) V. parahaemolyticus was examined by TEM. 22

ro of -p re lP na ur

Fig. 2 Transcriptomic analysis of the PhoR regulon. (A) The pie chart shows the number of genes that were

Jo

upregulated and downregulated by PhoR (log2 ratio ≥ 1 or log2 ratio ≤ 1 and p value < 0.01). (B) MA plot shows the genes regulated by PhoR. The X-axis (A) represents the logarithm-transformed value of gene expression levels. The Y-axis (M) represents the logarithm-transformed value of expression change folds.

23

ro of -p re lP na ur

Jo

Fig. 3 KEGG pathway enrichment analysis of genes downregulated (A) and upregulated (B) by PhoR. The y-coordinate denotes the pathway name, the x-coordinate denotes the gene number, and the color of the bar corresponds to different ranges of p-adjusted values. (C) Heatmap reveals the expression of differentially expressed genes for each cluster shown in the figure. The color of the bar corresponds to different ranges of read counts.

24

ro of

Fig. 4 Real-time qRT-PCR analysis of the transcription levels of lateral flagellar genes (A&B), the T3SS1 gene (C) and tdh (VPA1509) (D). Student t-test was used for analyzing statistical difference between two

Jo

ur

na

lP

re

-p

groups. **p < 0.05 **p < 0.01. ***p < 0.001.

25

Jo

ur

na

lP

re

-p

ro of

Fig. 5 Phosphorylation of PhoR in LB and BHI media.

26