Transfection of metastatic capability with total genomic DNA from human and mouse metastatic tumour cell lines

Differentiation (1W3) 54: 177-189 Ontqcsr, Nmphsim and DilTermUstiom Therapy

Q Springer-Verlag1993

Transfection of metastatic capability with total genomic DNA from human and mouse metastatic tumour cell lines Allan J. Hayle*, Dawn L. Darling, Anne R. Taylor, David Tarin Nufield Department of Pathology, John Radcliffe Hospital, University of Oxford, Headingtsm, Oxford OX3 9DU, UK Accepted in revised form March 29, 1993

Abstract. From a large series of experiments involving transfer of high molecular weight total genomic DNA from highly metastatic human and mouse tumour cell lines to other mouse tumour cell lines we have derived a few cell lines with greatly augmented metastatic properties. In one of these experiments the transfected cell line (designated AH8 Test) not only colonised the lungs but also formed secondary tumour colonies in several extrapulmonary sites including the skin, skeletal muscles, bone, liver diaphragm, spleen and heart. There were no qualitative and quantitative effects of this magnitude when we used DNA from several non-metastatic or nontumourigenic sources. Secondary transfection of metastatic capability with DNA obtained from a metastasis formed by one of the primary transfectant lines (AH8 Test) has also been accomplished. Concomitant transfer of human DNA through both transfection cycles in this experiment was confirmed by a variety of methods including Southern blot analysis, in situ hybridisation and polymerase chain reaction (PCR) amplification of DNA using primers recognising human-specific Alu repeat sequences. The findings offer opportunities for the isolation of sequences programming metastatic behaviour and we have cloned and sequenced a fragment of human DNA, which has not been previously characterised, from the transfected cells.

Introduction When Fidler and Kripke [lo] isolated tumour cell clones with greatly different metastatic capabilities from a common parent cell line, they clearly demonstrated the phenomenon of tumour cell heterogeneity and simultaneously showed that cell lineages with distinctive and

* Presenr &ess: Arnersham Corporation, 2636 S Clearbrook Drive, Arlington Heights, IL 6OOO5, USA Correspondence to: D. Tarin

heritable patterns of dissemination co-exist and propagate themselves within tumour cell populations. This was soon confirmed by many other laboratories [33, 381 and also verified for samples derived from fresh primary and secondary tumours. It follows that the capability to metastasize is an inherent property of individual tumour cells, which is reproduced with substantial reliability by their progeny in immunologically inert hosts. Normal host tissue is, however, not ent:.rely passive and can either markedly facilitate or completely abrogate the process by, as yet, poorly understood mechanisms. For example some undoubtedly metastatic tumours will metastasize only from orthotopic sites [30]and others will not form haematogenous metastatic colonies in certain organs even if the tumour cells are infused directly into their blood supplies [I 7, 54-57]. Furthermore, although the metastatic capability of a given heterogeneous (ie. polyclonal) tumour cell population rt:mains stable over many cell generations, that of any individual clone derived from it can become very varied and unpredictable [38] if it is passaged separately :.n vivo or in vitro. Recombination of such separated clones restores stable behaviour indicating that interactive processes within the tumour itself can also modulate clonal metastatic capabilities. Given then, that the propensity to metastasize is a specific feature o l some tumour cell lineages and not others and is not seen in corresponding normal cells [40], it is pertinent to ask what intrinsic circumstances, changes or abnormalities in the cells concerned generate this behaviour. The probable answer to this is provided by good evidence from many different experiments with human and animal tumours indicating that the fundamental impulse which drives tumour cells into the metastatic process is a disorder in genetic programmes governing cellular behaviour. This information is summarised below: First, data from several laboratories suggests that agents which are known to be able to modulate gene expression can stably alter metastatic behaviour: The exposure of dividing cells to the pyrimidine analogue

178

Sazacytidine, 5-aza-C) results in its incorporation in newly synthesised DNA in random substitution for normal cytidine residues; as 5-aza-C cannot be methylated, the treatment results in depression of general levels of DNA methylation. In such cells, genes that were inactive have been observed to become expressed and this led to the realisation that methylation is one means of controlling gene expression. Such alterations of expression have been found to be stable and sustained over several cell generations, as a consequence of methylation patterns being carefully copied by maintenance methylases during mitosis (see [43] for review). Exposure of weakly metastatic cells to 5-aza-C in some experiments [60] increased their capability to colonise the lungs after intravenous inoculation; other work indicates that spontaneous metastatic capability can also be increased by this treatment [22, 34, 531. In the latter experiments, 5-aza-C treated cells were injected subcutaneously and must have undergone several divisions to make a local tumour before metastasis occurred, indicating that the change of behaviour was heritable and probably caused by alterations in gene expression. Secondly, a number of studies have provided strong evidence that fusion between non-metastatic tumour cells and non-neoplastic cells of the host in vivo can result in metastatic behaviour by the hybrid [7, 14, 21, 251. This was recognised when the injected tumour cells possessed a unique genetic marker and it was found, later in the experiment, that the tumour cells composing the metastases had acquired other genotypic properties unique to the host cells. Further investigations involving fusion of tumour cells in vitro with various types of cells, followed by inoculation of the hybrids, confirmed that fusion with appropriate partners can activate metastasis and indicated that the host cells involved in conferring metastatic properties after fusion in vivo are probably macrophages, lymphocytes or others derived from the bone marrow. However, the contrary observation that inhibition of metastatic capability of some already metastatic lines may occur after fusion with normal lymphocytes [48] indicates that fusion does not ahvays result in activation of this phenotype and counsels some caution in interpretation of results. This work suggested that the genes concerned with governing the ordinary migratory behaviour of normal haematological cells may, when transferred into tumour cells, enable them to metastasise. However, this need not be the only mechanism by which metastatic cells naturally acquire their migratory capability; it could quite reasonably be argued that activation of inrrinsic, but normal quiescent, migration-related genes within a tumour cell, and subsequent metastatic behaviour, could occur wirhour fusion, the latter being merely a way of introducing a gene which is already derepressed. In recent years considerable work (reviewed by Knudson [24]) has led to the conclusion that progression to neoplasia can result from loss or inactivation of regulatory (‘suppressor’) genes controlling cell multiplication. Activation, often by point mutation or translocation, of dominantly acting oncogenes stimulating cell proliferation can also transform cells to the tumourigenic phe-

notype. If this model of balanced positive and negative regulatory interaction pertains also to the development of invasive and metastatic behaviour. it might be feasible to identify sequences which can dominantly confer metastatic properties upon tumour cells into which they are transferred. It might also be expected that research may pin-point other genes which can inhibit or suppress this phenotype (see below for further discussion). This does not necessarily imply that any of the genes concerned are among the currently identified oncogenes (see, for example [63]); only that the process governing their regulation may be comparable and that the use of similar molecular biological techniques might help in their recognition and isolation. Collectively, the above studies indicated that further investigation of the genetic constitution of metastatic tumour cells could be illuminating. We therefore resolved to attempt transfer of metastatic capability by transfection of high molecular weight DNA, from highly metastatic humar, tumour cells into non-metastatic or weakly metastatic mouse tumour cells. It was reasoned that this approach may allow easier isolation and identification of human genes involved in metastasis because, in contrast to methods such as cell fusion and chromosome transfer, each transfected cell takes up only a limited portion of the genome and selection of resulting metastatic clones can be exercised by inoculation into mice. Thus the search can be narrowed to just the incorporated human sequences in mouse tumour cells induced to be metastatic. This approach, of course, depends upon the transferred genes exerting a dominant effect and there was no way to know, short of doing the experiment, whether it would work. The results obtained in these experiments confirm that, although the transfer of metastatic capability is infrequent and laborious, it can be achieved. They also indicate that the new behaviour is actively conferred upon the recipient cells, by the incorporation of functional sequences, rather than passively induced, by disruption of the genome into which they integrated. Methods Cell lines and animals. The donor D N A used in these transfections were obtained from cell tines known to have well characterised and reproducible heavy metastatic capability. The origins of the recipient and donor cell lines and the details of their behaviour in vivo are summarised in the text below and in Table 1 and the relative or complete absence of metastatic capability of recipient cell lines was confirmed regularly. After transfection and selection of cells incorporating exogenous DNA, surviving clones were pooled and grown in mass culture. It is important to stress that in these experiments the strategy was to inoculate and assay all surviving clones and thus to identify those which had acquired metastatic capability by their behaviour in vivo. The validity of this as a screening and selection procedure for metastatic cell clones has been confirmed by separate experiments we have described elsewhere [29]. Before inoculation. cell number and viability were assessed by vital staining with fluorescein diacetate and ethidium bromide, as described previously [54].Aliquots of lo6 viable transfected tumour cells were inoculated into batches of MFl nude mice or, where appropriate. C3H/Avy mice, which are syngeneic to the P574 mammary tumour cell line. The nude mice were used to assay cells transfected with human DNA because their immuno-

179 logical incompetence would minimise rejection of transfected cells conceivably expressing human cell surface antigens. Animals inoculated intravenously were injected via the lateral tail vein and the others were inoculated subcutaneously in the flank. or in the mammary fat pads as appropriate. All animals were killed and autopsied at the times given in Table 1, to assess the distribution and number of secondary tumour deposits, if present. The lungs from all animals, whether in control groups or groups transfected with metastatic tumour DNA, were examined histologically and all macroscopically suspicious lesions in other organs were also sampled for histopathological verification of the presence of secondary tumours. Trutufecrion procedures. High molecular weight DNA ( > 50 kb) w a s extracted by standard procedures [27] from donor metastatic

a l l lines and co-transfected with plasmid pSV2ne0, which contains the bacterial gene for aminoglycoside transferase, and confers resistance to the antibiotic neomycin [49] and its analogue G418, into r-ipient tumour cells by standard procedures involving calcium phosphate precipitation [64]. A precipitate containing 30 pg of donor (metastatic) DNA and 1 pg of plasmid pSV2neo was added to log phase recipient tumour cells, seeded the previous day into two 90 mm plastic petri dishes, at 5 x 10' cells/dish. After incubation at 37" C for 16 h the cells were washed and trypsinised and the contents of each of the petri dishes seeded into five similar sized petri dishes containing Dulbecco's modification of Minimum Essential Medium supplemented with 10% foetal calf serum. Twenty four hours later the medium was changed and replaced with similar medium containing 800 pg/ml of Geneticin ((3418) and subsequently this selection medium was changed every 4 days. Colonies (clones) surviving were pooled and the cultures grown until sufficient cells were available for subcutaneous and intravendw inoculation at a dose of 1 x lo6 viable cells per inoculum. In control categories the procedures were identical except for substitution of metastatic cell DNA with either salmon sperm DNA, normal human DNA, DNA of the tumourigenic recipient cell line itself or plasmid pSV2neo on its own. Secondary transfection of metastatic capability, to fresh TR4Nu cells, utilised calcium phosphate precipitates of total genomic DNA from cell line AH8 LMC derived from metastases formed by the primary transfectant AH8 Test (see Table 1). with supplementary pSV2neo to improve chances of detecting transferred human sequences, not concatenated to the neo gene in the primary transfcctants. The procedures used were the same as described above. DNA analysisfor detection of transfected human genomic sequences. Agarose gels were loaded with 50 pg/lane of EcoR 1 digested DNA from the corresponding cell line and electrophoresed at constant voltage (25 volts) for 18 h after which they were depurinated in 0.25 N HCI for half an hour and then denatured and transferred in 0.4 M NaOH onto a Zetaprobe membrane [44].After transfer the filters were baked at 80" C for 30 rnin and prehybridised for 4 h in a solution containing 5 mg salmon sperm DNA, 1'YOsodium dodecyl sulphate (SDS) and 0.5% Blotto [20] in 1.5xSSPE (15 mM NaH,PO,. pH 7.4, 225 mM NaCI. 1.5 mM EDTA). 100 ng of gel-purified probe (300 bp BamH 1 insert from the BLUR 8 plasmid containing a human-specific Alu repeat sequence (19,461) was labelled by nick translation using four labelled nucleotides, to a specific activity of 6-8 x 10' cpm/pg). Before use, possible contaminating pBr322 sequences which could hybridisc to plasmid sequences in the transfectant DNA and so give a falsc positive signal, were removed by reassociation of the probe with 10 pg of linearised pBr322 using the method of Sealey et al. [47]. The probe was used at a concentration of 5 n g / d in hybridisation mixture consisting of 10% Dextran sulphate, 1% SDS and 0.5% Blotto in 1.5 x SSPE. Hybridisation was performed for 16 h in a shaking water bath at 65°C and the filters were then washed at room temperature in decreasing concentrations of standard saline citrate (SSC) containing 0.1% SDS to a stringency of 0.1 x SSC. The final wash was in 0.1 x SSC containing 1 % SDS at 50" C for 30 min.

Pre-flashed Kodak x-o-rnatic film was then exposed to the filters at -70" C with intensifying screens. Autoradiographs were developed after 24 h. After exposure, the filters were stripped of radioactive probe in a boiling solution of 0.1 x SSC, 0.5% SDS and agitated for 15 rnin befoo: reprobing with labelled pBr322 to exclude the possibility that any bands seen on probing with purified BLUR8 insert were due to hybridisation with contaminating vector sequences. It has been suggested by others that various oncogenes may be implicated in the induction of the metastatic phenotype. These include ras [58], myc, mos, raf. src, fes, v-erb, fms [8] and p53 [37]. To examine the possibility that human versions of these genes, might be present in the transferred human DNA and involved in the induction of experimental metastasis in AH8 Test cells, DNA from the transfectans was hybridised with probes for human ras, src, myc, fms, sis, n f , fos and v-erb. Fifty microgram amounts of EcoR ldigested DNA from AH8 Test, AH8 LMC, AH8 control and TR4 Nu cell lines were size fractionated by electrophoresis as described above and blotted onto a Zeta-Probe membrane. To exclude the possibility of false positive or false negative results lanes loaded with 50 pg digested TR4 Nu DNA, either in pure form or mixed with cmncogene DNA, at 1 genomic copy equivalent, were always included in the same gel and blotted with the other samples. The filters uere probed with the corresponding nick-translated ,'P labelled oncogenes and autoradiographed. For the detection of human sequences by the polymerase chain reaction (PCR), the human specific primer (517) described by Nelson et al. [32] and two further primers (289 and 299) selected by ourselves after comparison of published human and mouse Alu sequences as likely tc amplify human specific sequences integrated into mouse DNA were used. The nucleotide sequences of 298 and 299 are as follows: 298, AGTGCAGTGGCGCCATCCCG; 299, CATGAACCCGGGAGGCAGGA. Aliquots (500 ng) of template DNA were amplified for 36 cycles with one or other primer using 2.5 units T. aquaticus polymerase (Pcrkin-Elmer/Cctus) in 50 pI volume and the reaction conditions and times recommended by Nelson et al. [32]. Negative and positive controls consisted of tubes containing no template DNA or pure human DNA respectively. After electrophoresis, the reaction products were transferred to Zetaprobe membranm by alkaline Southern blotting, hybridised to 32P labelled gel-purified Alu insert from the BLUR8 plasmid and washed at high stringency, for confirmation of human origin by autoradiography. Detection of human nucleic acid in histological sections by nonisotopic in situ hybridisation. A modified technique of Bums et al. [5] was used to confirm incorporation of human DNA into the genome of AH8 tramfectant cells as follows. Subconfluent monolayer cultures of AH8 Test, AH8 control (transfected with pSV2neo alone) and donor AJ75M cells were removed by trypsin-EDTA treatment and, after washing once in phosphate buffered saline (PBS), cell pellets witre processed for histology. Formalin fixed (overnight fixation) sixtions of the cell pellets were screened using total genomic DNA f:om human (A375M cells and normal human lymphocytes) and mouse (TR4 Nu cells) sources as probes. Formalin-fixed parafin sections were mounted on to aminopropyl-triethoxysilane treated glass multispot slides, dried at 37" C for 30 rnin and baked sequentially at 75" C for 60 min, followed by overnight incubation at 60" C (sections could be stored indefinitely at 22" C). The sections were dewaxed by heating at 75°C for 15min and then transferred imm:diately to xylenc at 22" C, changing xylene twice (2 x 10 rnin). This was followed by 2 x 10 min washes in 99% ethanol and then washing in running tap water for 5 min. The sections were then preheated in distilled water in a coplin jar kept at 37" C in a waterbath, ;and treated with 4 mg/ml(3200 units/mg protein) pepsin (Sigma U.K.) in 0.2 N HCI for 15 min. This treatment resulted in unmasking of any human nucleic acids. After digestion, the sections wen washed thoroughly in 0.01 M phosphate containing 0.15 M NaCl pH ?.4 and dried at 37" C for 10 min. For preparation of the biotinylated probe, 2 mg of DNA was nick-translated with 0.4 mM of the biotin labelled nucleotide Bio-

180 tin-11-dUTP (Gibco B R L ) used at a final concentration of 0.02 mM. instead of the "P labelled nucleotide. After incubation at 15" C for YO min the Biotin-labelled DNA was separated from unincorporated nucleotide, by ethanol precipitation. and resuspended in 100 ml TRIS/EDTA (TE). Ten millilitre aliquots of hybridisation solution containing 10 ng of appropriate biotinylated probe were added to each well on multispot slides, covered with 14 mm diameter coverslips and placed in a sealed Terasaki plate containing a piece of damp filter paper to maintain a moist environment. The hybridisation mixture consisted of 50% formamide (Sigma U.K.), 5% Dextrdn sulphate (BDH. U.K.), 2xSSC. 0.1 mM EDTA, 0.5 mg sheared salmon sperm DNA. and 0.05 mM TRISHCI pH 7.3. The preparation was denatured at 95" C for 15 min on a solid stainless steel plate in a hot air oven, and hybridised at 42" C for 2 h. The slides were washed at low stringency in three changes of 4 x SSC at 22" C ( 5 min each change), and then soaked in blocking agent T.B.T. consisting of 0.01 M TRIS-HCI. 0.15 M NaCl pH 7.5, 0.25% (w/v) bovine serum albumin (Sigma U.K. No. A7906) and 0.05% Triton XI00 (v/v) at 22" C for 10 min. The sections were then incubated a further 30 min at 22" C in a humidifying box with a 1/25 dilution of modified avidin alkaline phosphatase conjugate (DAKO) diluted in T.B.T. Unbound conjugate was removed by washing for 2 x 5 min in 0.01 M TRIS-HCI 0.15 M NaCl pH 7.5 and the preparations incubated 30 min in substrate consisting of nitroblue tetraxolium (NBT) and 5-Bromo4-chloro-3-indolyl-phosphate(BCIP). The NBT (Sigma N6876) was dissolved in 0.2 ml dimethylformamide. and 1 ml substrate buffer (0.1 M TRIS-HCI. 0.1 M NaCI. 0.5 m M MgC12 pH 9.5) added. The solution was then added to a further 30 ml substrate buffer at 37O C. Five milligrams BCIP was dissolved in 0.2 ml dimethylformamide and the solution added dropwise to the NBT solution with continuous stirring. This final substrate was dispensed in 5 ml aliquots and stored at -20" C until required. The reaction was terminated by washing the slides in tap water for 5 min and then immersing a further 5 min in 10% formalin containing 0.15 M HCI. The final slide preparation was rinsed in distilled water, counterstained with haematoxylin and mounted in aquamount.

I n uico und in r h o growth of A H8 trunsfectunts und recipient TR4

Nu cells. To test whether the increased incidence of metastasis produced by AH8 Test transfectants could be due to an increase in growth potential of the transfected cells, their growth rate in vivo (after S.C. injection of lo6 cells in nude mice) and in vitro (in tissue culture flasks) was measured and compared with AH8 control transfectants and the untransfected TR4 Nu cells. The growth rate of the AH8 lung metastasis cell line (AHILMC) was also determined. For assessment of growth rates in vivo, caliper measurements of two orthogonal diameters of each tumour were averaged and recorded twice weekly for 7 weeks. Growth rates in vitro were measured by seeding 80 cm2 plastic flasks (Nunc) with 2 x 10' cells and subsequently counting the numbers of viable cells detached by trypsin/EDTA treatment. The mean cell number from triplicate flasks was determined daily for 9 days, for each cell line. Cell viability was evaluated using the fluorescein diacetate/ethidium bromide method [54]. with which living cells fluoresce bright green and dead ones stain red.

Results Details of behaviour of dotior and recipient tumour cell lines in vivo (Table 1 )

The numerical data pertaining to the behaviour of the cell lines used in these experiments are given in Table 1. Briefly, A375 is a cell line derived from a patient with metastatic malignant melanoma. The subline A375M obtained from pooled pulmonary metastases in a nude mouse is heavily metastatic to the lungs in 84% of our nude mice ( > 200 colonies/mouse) inoculated i. v. and occasionally to other organs. It is weakly metastatic spontaneously (30% of our animals) from a subcutane-

Table 1. Incidence of metastasis after transfection with genomic DNA from metastatic cells

Transfectant

Donor DNA

Survival time (days) (Median)

a) AH8 series: Recipient cells TR4 Nu Inoculation route i.v. AH8 Test A375M 42-56 Untransfected TR4 Nu cells AH8 control 1 AH8 control 2 AH8 control 3

-

56

TR4 Nu salmon sperm pSV2 neo

56 56

56

b) DDl series: Recipient cells P574 Inoculation route: mammary fat pad DDl M5076 180 days DD1 (control) P574 180 days Untransfected P574 cells 180 days Incidence =

Incidence of metastasis

Distribution of metastasis

Lung nodules Mean SE

21/25 (84%) (6/21 extrapulmonary) 6/59 (10%)

Lungs. liver. skin diaphragm. muscles Lungs only

170+ 14.5 1 k0.4

26/112 (23%) 4/42 (9.50/.) 3/40 (7.5%)

Lungs only Lungs only Lungs only

5k1.6 0.5 k0.3 0.8 k0.4

29/63 (46%) 6/52 (1 1 %)

Lungs only Lungs only

41.7 7.7 3.2k1.3

6/39 (1 5%)

Lungs only

2 f0.86

No. of mice with lesion No. of mice injected

Origin of cell lines: A375M: Human malignant melanoma, metastatic in the patient and in nude mice: 32/38 (84%) of animals inoculated i.v. TR4 Nu: Mouse fibrosarcoma non-metastatjc from subcutaneous site (derived from 3T3 fibroblasts)

M5076: Mouse sarcoma, probably of macrophage origin; heavily metastatic to liver from tumours formed at the site of subcutaneous inoculation: 68/68 (100%) animals inoculated p574: Mouse mammary carcinoma, weakly metastatic from tumour formed after inoculation in the mammary fat pad (numerical data provided above).

181

mycin selection. ldepending on the quality of DNA and the specific conditions of each transfection.

ous inoculation site. The mouse tumour cell line TR4 Nu is completely non-metastatic from a subcutaneous site and only sporadically forms solitary deposits exclusively in the lungs after i.v. inoculation [63]. It originates from NIH 3T3 cells allowed to grow to superconfluence in vitro. Following transformation, these cells were injected into nude mice and the present line was obtained from a tumour formed S.C. at the site of inoculation. The donor cell line (M5076) used in the second series of transfection experiments is heavily metastatic from the site of subcutaneous inoculation to the liver [51, 521, causing subtotal replacement of this organ in 100% of our animals in 30 days. Deposits are rarely seen in the lungs although the pulmonary vasculature is often full of non-adherent tumour cells. DNA from this line was transfected into P574 cells, a line of mouse mammary tumour cells derived in our laboratory which is only weakly (two colonies) metastatic to the lungs in 15'7'0 of animals 6 months after inoculation via the mammary fat pad. Primary tumours apperared at about 23 months. P574 and TR4 Nu are both easily transfected in vitro yielding approximately 400 surviving clones after neo-

The group of animals injected with cells from our eighth transfection experiment with A375M DNA, designated the AH8 Test cell line, had very heavy colonisation of the lungs and mediastinum with virtually no residual normal pulmonary tissues, in 21 out of 25 animals (84%). Six of the 21 animals (28%) with metastases also had multiple large extrapulmonary secondary tumour deposits in various organs, including the liver, heart, skeletal muscles, bone, spleen, skin, diaphragm and peritoneal lining (see Table 1 and Fig. la-d). In contrast, the untransfected TR4 Nu cells only formed solitary macroscopic deposits or microscopic seedlings in 6 out of 59 animals (10%) inoculated i.v. (Table 1). Animals inoculated scbcutaneously with AH8 cells all developed local tumours but there were no spontaneous metastases. As can be seen from Table 1, the experimental procedure itself can sometimes cause background variability

Fig. 1. a Nude mouse inoculated i.v. 8 weeks prevoiusly with AH8 cells. Subcutaneous metastases are visible on the flank and the back of the head. b Same animal at autopsy showing metastatic tumour deposits (arrows) in the liver. rib cage, axillary lymph

nodes, lungs and diaphragm. c Histological confirmation of metastatic tumour deposits in mediastinal lymph nodes (thin arrows) and lungs (thick arrow). d Histological confirmation of metastatic tumour deposit in the skeletal muscle of the diaphragm

Pr irnary transfec I ions

182

23

9

23 6

9.4 4

6 *5

-

4.3

2.3 2.0

:.

2 -3 2.0

c.

0-5

0.5 b Fig. 2. a Autoradiograph of a Southern blot probed with the 300 base pair insert from the BLUR8 plasmid, which specifically recognises A h repeat sequences characteristic of human DNA. ' f u n e f contains DNA from untransfected TR4 Nu cells. Lane 2 contains DNA from TR4 Nu cells transfected with pSV,neo alone. Lane 3 contains DNA from AH8 Test, primary transfectant. cells. fune 4 contains DNA isolated from a lung metastasis formed by AH8 Test cells. Lane 5 contains DNA isolated from another lung metastasis formed by AH8 Test cells. Lune 6 contains DNA from TR4 Nu cells co-transfected with their own DNA and pSV2neo. The figure shows the presence of human DNA sequences incorporated in several fragments of different sizes in the DNA from the transfected cell population (visualised as dense bands in lune3).

Human DNA sequences are also present in cells obtained from metastases isolated from the lungs (Iunes4 and 5). Note that the integration pattern in both of these metastases is the same and that the band is not visible in the parent transfected population. probably because the clone giving rise to the metastases constituted too small a proportion of the parent population to be detectable with these techniques. The untransfected (TR4 Nu) mouse tumour cells and TR4 Nu cells transfected with their own DNA do not contain similar sequences hybridisinp to the Blur8 probe. b Control studies on the same filter shown in a. probed with plasmid pBr322 showing bands in different positions to the ones detected with the Alu repeat probe. These represent integrated co-transfected selectable vector (pSV,neo) sequences

in the results. For instance, transfection of TR4 Nu cells with their own DNA and pSV2neo (designated AH8 control cell line l), resulted in a moderate increase in the numbers of animals with solitary seedlings (26 out of 112 animals; 23%) relative to batches of animals injected with untransfected TR4 Nu cells (lo%, see above), but there was no comparable increase in the mean degree of pulmonary colonisation in individual animals, to that seen in animals injected with AH8 Test transfectants (see below). However, transfections with control DNA from various other sources (see Table 1 for representative sample viz AH8 control 2, AH8 control 3) resulted in either no increase or a decrease in metastatic capability of TR4 Nu. The number of secondary tumour deposits in individual animals inoculated with the AH8 Test cell line (mean 170+SE 14.5) was of much greater magnitude than in any control group, the pulmonary deposits in the former being so numerous (mean 170+SE 14.5) and confluent as to be difficult to quantify accurately, whereas in the latter they were solitary or occasional

( c 0.5 k0.3 to 5 k 1.6). Additionally, the substantially greater (P 0.001) incidence of metastasis (i. e. the proportion of animals scored positive) and the frequency and diversity of extrapulmonary organ involvement, established the AH8 Test line as having much more metastatic capability than controls. The control studies have been repeated several times with almost identical results (data not shown). The metastatic behaviour of AH8 transfectants conformed to that of the donor cell line, in that they showed augmented experimental metastatic capability [i.e. ability to colonise the lungs after intravenous inoculation: the cell line donating the DNA (A375M) readily makes experimental metastases (see above) but infrequently ( c 30%) makes spontaneous metastases]. Reinoculation, on several occasions, of the cell lines AH8 Test, AH8 control 1, AH8LMC (derived from a lung metastasis formed by AH8 Test) and TR4 Nu into fresh batches of animals have repeatedly produced very similar results to those shown in Table 1, demonstrating

-=

183

c

Fig. 3. a Identification of human J’

.

d .

. &-.

4

i

-.

c-

,

DNA in AH8 Test cells using in situ hybridisation. The nuclei of the cells in this cell pellet were stained blueblack indicating specific hybridisation of the biotinylated Alu repeat probe (BLUR8) to human Alu sequences. b Pellet of AH8 control cells co-transfected with plasmid pSV,neo and their own (TR4 Nu) DNA, hybridi d in situ to biotinylated human genomic DNA. There is no specific hybidisation comparable to that seen in a. c AH8 Test cells probed with human papilloma virus sequence as a further control for specificity of results seen in a. There is no hybridisation

184

the heritability of the metastatic properties acquired by the primary transfectants (AH8 Test) and their descendants (AH8 LMC), over several cell generations (data not shown). In a separate series of experiments, we eventually also produced a line (e.g. DD1 in Table 1) showing a marked increase in spontaneous metastasis from primary tumours in the mammary fat pad (mean=41.7 colonies in 46% of animals) relative to its untransfected counterpart, P574 (2k0.86 in 15% of animals; P
Subcutaneous Growth of Turnours in nude mice Injected with AH8 Transfectants and TR4 NU cells

.......

AH8CONT

-

....

AH8TEST

AHILMC

-A-

TR4N.l

Tumour size hm diaJ

IN VlTRO GROWTH OF AH 8 Transfectants and TR 4 NU cells

.......

AH8CONT

4

--- -..- -

AH8TEST

TWMJ

AHILK

'

1

2

3

4

5

6

7

8

9

I

time (days) C M t s r . p . r n 1 (h.nunnl* ol -la

mcnb

Fig. 5. Growth rates or transfected cell lines and controls in vitro

LMC cells did show a slight increase in S.C. tumour growth (P=O.O11) at 40 days, compared to AH8 Test and control transfectants at the same time period. At 90 days, however, when the experiment was terminated, tumour sizes were similar in all animals. Also, no significant differences were observed in the growth rates of the various cell lines in vitro over the time period of the assays (Fig. 5). These results indicate that the growth rate of the AH8 Test transfectants was not suficiently increased relative to controls as to account for the increased lung colonisation seen when these cells were injected i.v. into nude mice.

In vivo and in vitro growth of A H 8 transfectants and recipient TR4 Nu cells

Secondary transfection experiments

The growth rates of the various cell lines in vivo were broadly similar (Fig. 4) although both TR4 Nu and AH8

All attempts to transfer metastatic capability through a second round of transfection without using supplemen-

185 Table 2. Secondary transfection Transfectant

Donor DNA metastasis

Survival time (days) mctastasis

Incidence of

Distribution of

AH8TI AH8Tll

AH8LMC AH8LMC TR4 Nu*

42-56 days 42 days 56 days

10/14 (71'/0) 11/13 (85'10) 2/44

Lungs (confluent metastases) Lungs (confluent metastases) Lungs (single deposits)

-

Incidence =

No. of mice with lesion No. of mice injected

* Concurrent controls Origin of cell line: AH8LMC: Cell line derived from pulmonary metastases made by primary transfectant AH8 (see Table 1) 2

3

4

5

6

0

4

It--

310

5

6

7

.. '

' .

'0 0.

0

.

a..

Fig. 6. a Autoradiograph of Southern blot of polymerase chain

reaction (PCR) products amplified with primers 298 and 299 and probed with gel-purified human Alu repeat insert from plasmid BLURI. The presence of homologous amplified fragments of human DNA is demonstrated in the primary transfectant cell line AH8 Test and in cell lines derived from metastases produced by the primary and secondary transfectants. Sources of DNA were as follows: Lane 1 Normal human DNA. Lane 2 Mouse cellular DNA (TR4 Nu). Lone 3 Primary transfectant (AH8 Test). Lane 4 Cell line derived from metastasis made by AH8 Test (designated AH8 LMC). Lane 5 Cell line derived from lung metastasis made by secondary transfectant (AH8 TI1 LMC). Lane 6 Marker 4x174; Hue I11 digest. b Autoradiograph of Southern blot of PCR prod-

tary pSV, neo failed. However, both attempts to do so using supplmentary plasmid, with exactly the same protocol as the primary transfection described above, were successful, resulting in lines (designated AH8 T1 and AH8TII) which are capable of heavily colonising the lungs of 71 % and 85% of recipient nude mice respectively (Table 2). The deposits in the lungs in these animals were histologically confirmed as being metastases and we have derived a cell line from some of them (designated AH8TII LMC). Amplification of human-specific Alu repeat sequences, using human specific primers (see above) in

ucts amplified with primer 517 and probed with gel-purified human A h repeat insert from plasmid BLURB. The presence of homologous amplified fragments of human DNA up to 1350 bp in size in the primary transfixtant cell line AH8 Test and in cell lines derived from metastases produced by the primary and secondary transfectants is demonstrated. SQUK~S of DNA were as follows: Lane 1 Normal humari DNA. Lnne 2 Marker 4x174; Hue 111 digest. Lane 3 Mouse cellular DNA (TR4 Nu). Lane 4 Mouse cells (TR4 Nu) transfected with pSV,neo. Lane 5 Primary transfectant (AH8 Test). Lane6 Cdl line from metastasis made by AH8 Test (designated AH8 LMC). Lane 7 Cell line from metastasis made by secondary transfectant AH8 T I1 LMC

the polymerase chain reaction (Mu PCR),confirmed the presence of humart sequences in this cell line (Fig. 6a and b) as welLas in AH8TI and AHSTII, obtained from the two separate secondary transfections, and their absence in the controls. Similarly, Alu PCR demonstrated the presence of DNA containing human Alu repeats in the donor cell lines AH8 and AHSLMC. Subsequently WI: have cloned and sequenced a fragment of human DNA from one of these cell lines. Th~s contains several Alu repeat elements of the specific type seen in higher primates and comparison with the GenBank/EMBL DataBank indicates that it is a novel piece

186

of DNA that has not been previously isolated and characterised. Southern blotting data indicate that the sequence is present in single or low copy number in various human cell lines. The detailed sequence of the fragment we have cloned and other pertinent information will be published separately. Discussion

In previous publications [28, 531 we have recorded the preliminary results of studies on the transfer of metastatic behaviour by transfection of mouse cells with DNA from human tumour cells with metastatic capability. In those reports we described the evidence indicating success in primary transfections of these phenotype. In the current work we consolidate and extend our earlier observations with evidence that the new phenotype is stable and heritable in the cell population over many cell generations and that secondary transfer of both the phenotype and the human DNA can also be achieved concomitantly in a further round of transfection. These present findings further show, by studies in vivo and in vitro, that the capacity for heavy metastatic colonisation induced in the transfectants, is not simply the consequence of an increase in growth rate of the transfected cells, enabling them to make detectable tumour deposits sooner, nor of the presence of detectable amounts of any of several known human oncogenes. Finally, we present several converging lines of evidence (Southern blot hybridisation, in situ hybridisation and PCR) demonstrating clearly that DNA of human origin is present in the transfected cell populations, but not in any of the control ones, and culminate with the news that we have cloned and sequenced a novel fragment of human DNA from one of the transfected cell lines. To this collected information we now add further data showing significant ( P<0.001) increase of spontaneous metastatic capability in cells (DD1) transfected with a genomic DNA library from a spontaneously metastatic mouse tumour cell line. Taken in conjunction with the two successful secondary transfection experiments described above, this result testifies that transfer of metastatic capability during DNA transfection, having been achieved at least four times in the experience documented above, is a real phenomenon and not a freak coincidence of unrelated events. Surprisingly, these metastases formed by DDl cells (transfected with DNA from M5076 cells) were localised in the lungs and not in the liver, which is the preferential site of metastasis of the DNA donor (please see above). This might suggest that the minute amount of DNA which is incorporated by the recipient cells in this transfection experiment orchestrated the metastatic repertoire of the host cells but could not specify new organ-specificity. This information needs to be considered in the context of other studies on genetic aspects of metastasis. When our own earlier publications, cited above, are taken in conjunction with the observations presented here and several other reports of success in primary transfection of metastasis with total genomic DNA from meta-

static cell populations. published by a number of different groups in recent years [ l . 1 1 . 12, 18. 42, 581, it can be seen that there is a growing body of evidence indicating that the task is feasible although certainly not easy or frequent. The data reported in most of these papers published to date (see above) have, however, not been generally acknowledged as conclusive, perhaps because of absence of convincing evidence of donor DNA in the transfectants in some reports and/or absence of evidence of secondary transfer of the phenotype, together with donor DNA, through another transfection cycle, in others. The findings reported in the current communication satisfy both of these requirements and are evidence of successful specific transfer of at least part of the metastatic phenotype with functional genomic sequences. Final proof of such functional activity, however, will require reproducible transfer of the phenotype with human DNA cloned from the transfectants. Our data also exclude the possibility that the elevation of metastatic colonisation seen with our primary transfectants was a non-specific effect of the transfection procedure akin to that observed by Kerbel et al. [23] in SP1 mammary carcinoma cells when they were mocktransfected with calcium phosphate solution alone. We have never seen induction or even augmentation of metastatic capability in the cell lines used in our experiments in numerous control (over 100) transfection studies using the pSV2 neo plasmid or the pCV 108 cosmid vector, either alone or in combination with DNA from normal human cells or with DNA from other species (e.g. salmon). A representative sample of some of this data is given in Table 1. We have, however, seen (Table 1) that transfection of some tumour cells with their own DNA can, on occasion, moderately increase the incidence of sporadic lung colonies and believe that this needs to be very carefully monitored with contemporaneous controls at each stage in the experiment. We have done this in the studies we describe here. Transfection-mediated transfer of the metastatic phenotype is reproducible if one is sufficiently persistent. This has been shown in this series of experiments both with DNA from different donor cell lines and with sequential transfer of the phenotype in a second round of transfections with DNA from one of the donor cell lines. The incidence of success is however very low and it is important to recognise that it approximates to the calculated frequency of transfection efficiency for a single copy gene under these conditions. We cannot measure directly the amount of DNA which was incorporated by individual clones in our experiments, because we pooled all surviving clones and injected the mixed cell population into batches of mice to increase the emciency of detection of any which converted to metastatic behaviour. However, working from information obtained from related experiments in our laboratory, some comparisons with published data on transfection processes can be made. We know that individual surviving clones of our cell lines incorporate between one and ten copies of the neo gene. Thus, cells of a clone containing five copies of the neo gene contain approximately 30 kb of the plasmid pSV,neo (which is 5.6 kb in size). From

187

’

many other studies ([36. 451; see also review in [4]) it is now generally agreed that, during co-transfection procedures, cells rapidly concatenate plasmid and camer DNA by legitimate and illegitimate recombination procedures, to produce large structures known as transgenomes of about 1000-2000 kb, which are then integrated into their chromosomes. Assuming, therefore, that the TR4 Nu cells in this experiment behaved accordingly and incorporated the human DNA co-transfected with the neo plasmid in the same relative proportions as in the DNA precipitate we used, approximately 1000 kb would be assimilated by a surviving cell containing five copies of neo. This is approximately the same value as that reported by other workers [36, 451. Thus one can estimate that more than 3000 clones surviving neo selection are required to transfer the full human genome of 3 x lo9 base pairs. In practice, 10000 surviving clones is probably a more realistic estimate to allow for redundancy in the process. As a successful transfection procedure with these cell lines produced 400-500 clones, the chances of transferring a single gene of interest consequently range between 1 in 6 and 1 in 25 transfections. The phenomenon is therefore likely to be uncommon and the incidence of successful transfer of phenotype that we have observed is within the predicted range. This concordance between calculated and observed frequency also indicates that the gene or genes concerned are not present in numerous copies scattered throughout the genome and that one gene or a small group of contiguous genes is responsible. This is in accord with the successful secondary transfection data discussed further below. Thorgeirsson et a]. [58, 591 reported successful transfer of metastatic capability by transfection of mouse 3T3 cells with total genomic DNA from the leukocytes of a patient with acute leukaemia. DNA from cell foci formed after primary transfection was used for a second cycle of transfection after which cells were injected i. v. and found to be capable of lung colonisation. Southern blot hybridisation detected a single 8.8 kb Nras specific fragment and slot blot analysis indicated the presence of human A h repeats, both in the cell inoculum and in a pulmonary deposit. Since then, there have been a number of other reports of augmentation of metastatic or lung colonisation capability following transfection with ras and other oncogene constructs, [8, 9, 31, 39, 41, 61-63] but contrary evidence, that some cell lines are refractory to their effects and do not form lung deposits has also been recorded, (e.g. C127 cells, [31]; LTA cells, [61]). Also, some reports have described induction of full spontaneous metastatic capability [31, 391 whilst others documented lung colony formation but not spontaneous metastasis in their ras-transfected cell lines [41, 631. It therefore seems likely that the metastatic behaviour seen in some cell types after transfection with oncogene constructs requires the complementary action of other intrinsic genes, in the recipient cells. Despite a careful search we have not found evidence, in our human DNA-containing mouse cell lines, of any of the oncogenes so far reported to be able to induce or increase metastatic capability.

These observations collectively suggest that components of the metastatic phenotype are heritable; are probably conserved in evolution (because genes transferred from humans are apparently functional in mouse cells); and are corferrable on tumour cells, by transfer of genomic DNA in certain, as yet undefined, circumstances. Interestingly, it would appear that whatever genetic activity is responsible for this new behaviour, is not repressed (at least not in the lines we have obtained) by regulatory gents, in the non-metastatic recipient. It must be noted, however, that transfected genes can be expressed in host cells in which the endogenous counterparts are inactive (2.g. /?globin in fibroblasts, [35]). Secondly, we de1ibera:ely impose a stringent selection pressure on our transfectants by injecting them into animals and screening for metastases, from which we derive our cell lines for further work. Hence, cells in which relevant transfected genes were ‘dominated’ by host repressors may never come t3 our attention. Data suggesting the existence of such repressor genes have been recorded by Steeg et al. [50], who have cloned a sequence (designated nm23) from the K1735 mouse melanoma. which they believe may have metastasis inhibitory activity. Subsequent studies by the same and other laboratories [2, 3, 16, 261 have indicated that the level of expression of the nm23 gene family has a good inverse correlation with the degree of spread of human breast cancer and may provide useful prognostic information on the course of the illness. However, some of the recent findings in studies on human colon cancer [6, 151 and neuroblastoma [13] are contradictory and more information is needed to evaluate the precise relationship of nm23 function to the metastatic process. In principle we find the idea of balanced interaction between stimulatoiy (activator) and inhibitory (repressor) elements attractive and currently favour the interpretation that, in our successful transfection experiments with genomic DNA, we have transferred a deranged regulatory complex, capable of pleiotropic control over numerous other gene:; lower in the hierarchy, which is ‘hijacking’ and coordinately mis-regulating host cell genes, thereby imposing metastatic behaviour. Otherwise, it seems unlikely that a range of individual, abnormally functioning genes, necessary for such a complicated process, could have heen collectively transferred through two rounds of transfection, as our experimental data demonstrate. Thesc findings therefore indicate that the metastatic process is probably orchestrated by one or a few functionally inter-related controlling genetic elements, which are probably in close physical proximity. In conclusion, the collective results of all the experiments discussed in this communication have demonstrated that direct experimental analysis of the genetic disturbances causing metastatic behaviour is now feasible and that a new phase of investigation of the problem has been opened. Acknowledgemenfs. We: wish to thank Mrs L Summerville for help with preparation of the manuscript and Drs P A Whittaker and P Winship for advice and comment in the early stages of this project. We also thank Dr J Taggart. Dr B Moffett, Dr NG Ryley.

188

Miss M Cairney. Mr B Tutty and Mr A Gazzurd for some help with some of the technical procedures, and Dr IJ Fidler for the gift of cell lines A375M and M5076.

References 1 . Ananthaswamy HN, Price JE. Goldberg LH, Bales ES (1988)

Simultaneous transfer of tumorigenic and metastatic phenotypes by transfection with genomic DNA from a human cutaneous squamous cell carcinoma. J Cell Biochem 36: 137-146 2. Barnes R. Masood S, Barker E, Rosengnrd AM. Coggin DL, Crowell T, King CR, Porter-Jordan K. Wargotz ES, Liotta LA, Steeg PS (1991) Low nm23 protein expression in infiltrating ductal breast carcinomas correlates with reduced patient survival. Am J Path01 139: 245-250 3. Bevilacqua G. Sobel ME, Liotta LA, Steeg PS (1989) Association of low nm23 RNA levels in human primary infiltrating ductal breast carcinomas with lymph node involvement and other histopathological indicators of high metastatic potential. Cancer Res 49:5185-5190 4. Bishop JO. Smith P (1989) Mechanism of chromosomal intcgration of microinjected DNA. Mol Biol Mcd 6:283-298 5. Burns J, Graham AK. Frank C, Fleming KA. Evans MP. McGee JO'D (1987) Detection of low copy human papilloma virus DNA and mRNA i n routine paraffin sections of cervix by non isotopic in situ hybridisation. J Clin Pathol40:858-864 6. Cohn KH, Wang F. Desoto-Lapaix F. Solomon WB. Patterson LG, Arnold MR. Weimar J. Feldman JG. Levy AT, Leone A. Steeg PS (1991) Association of nm23-HI allelic deletions with distant metastases in colorectal carcinoma. Lancet 338 -722-724 7. De Baetselier P, Roos E, Brys L. Remels L. Gobert M, Dekegel D. Segal S, Feldman M (1984) Nonmetastatic tumor cells acquire metastatic properties following somatic hybridization with normal cells. Cancer Metastasis Rev 3 : 5-24 8. Egan SE. Wright JA. Jarolim L, Yanagihara K, Bassin RH. Greenberg AH (1987) Transformation by oncogenes encoding protein kinases induces the metastatic phenotype. Science 238:202-205 9. Egan SE, McLarty GA. hrolim L. Wright JA. Spiro I, Hager G. Greenberg AH (1987) Expression of H-ras correlates with metastatic potential: Evidence for direct regulation of the metastatic phenotype in 10T1/2 and NLH 3T3 cells. Mol Cell Biol 7:830-837 10. Fidler IJ, Kripke ML (1977) Metastasis results from pre-existing variant cells within a malignant tumour. Science 197:89> 895 1 1 . Gibbins JR, Nicholson TR. Vozab RJ. Ying B, Messerle KR (1991) Direrent malignant phenotypes induced in a stable, subdiploid, benign epithelial clone by DNA transfection. Anticancer Res 1 1 : 129-1 37 12. Glenn J, McDonald D. Horetsky RL, Sexton FM (1988) Metastatic phenotype in murine cells transfected with human DNA. J Surg Res 44: 382-390 13. Hailat N, Keim DR, Melhem RF, Zhu X-X, Eckenkorn C, Brodeur GM, Reynolds CP. Seeger RC, Lottspeich F, Strahler JR, Hanash SM (1991) High levels of p19/nm23 protein in neuroblastoma are associated with advanced stage disease and with N-myc gene amplification. J Clin Invest 88:341-345 14. Hart IR (1984) Tumor cell hybridization and neoplastic progression. In: Nicolson GL, Milas L (eds) Cancer invasion and metastasis: biologic and therapeutic aspects. Raven Press, New York, pp 133-143 15. Haut M. Steeg PS, Willson JKV, Markowitz SD (1991) Induction of nm23 gene expression in human colonic neoplasms and equal expression in colon tumors of high and low metastatic potential. J Natl Cancer Inst 83:712-716 16. Hennessy C. Henry JA, May FEB, Westley BR, Angus B, Lennard TWJ (1991) Expression of the antimetastatic gene nm23

in human breast cancer: An association with good prognosis. J Natl Cancer Inst 83:281-285 17. Horak E. Darling DL. Tarin D (1986) Analysis of organ-specific effects on metastatic tumor formation by studies in vitro. J Natl Cancer Inst 76:913-922 18. Jamieson S. Barraclough R. Rudland PS (1990) Generation of metastatic variants by transfection of a nonmetastatic rat mammary epithelial cell line with DNA from a metastatic rat mammary cell line. Pathobiology 58: 329-342 19. Jelineck WR, Toomey TP. Leinwand L. Duncan CH, Biro PA, Choudary PV, Weissman SM, Rubin CM, Houck CM, Deininger PL, Schmid CW (1980) Ubiquitous, interspersed.repeated sequences in mammalian genomes. Proc Natl Acad Sci USA 7711398-1402 20. Johnson DA, Gautsch JW, Sportsman JR. Elder JH (1984) Improved technique utilizing nonfat dry milk for analysis of proteins and nucleic acids transferred to nitrocellulose. Gene Anal Tech 1 :3-8 21. Kerbel RS. Lagarde AE, Dennis JW, Donaghie TA (1983) Spontaneous fusion in vivo between normal host and tumor cells; possible contribution to tumor progression and metastasis studied with a lectin resistant mutant tumor. Mol Cell Biol 3 : 523-538 22. Kerbel RS, Frost P, Liteplo R. Carlow DA. Elliott BE (1984) Possible epigenetic mechanisms of tumor progression : Induction of high-frequency heritable but phenotypically unstable changes in the tumorigenic and metastatic properties of tumor cell populations by 5-azacytidine treatment. J Cell Physiol SUPPI3 :87-97 23. Kerbel RS, Waghorne C, Man MS, Elliott B, Breitman ML (1987) Alteration of the tumorigenic and metastatic properties of neoplastic cells is associated with the process of calcium phosphate-mediated DNA transfection. Proc Natl Acad Sci USA 84:1263-1267 24. Knudson AG (1985) Hereditary cancer. oncogenes and antioncogenes. Cancer Res 45 : 1437-1 443 25.'Lariaa L. Schimacher V (1984) Somatic cell fusion as a source of genetic rearrangment leading to metastatic variants. Cancer Metastasis Rev 3 : 193-222 26. Leone A. McBride OW. Weston A. Wang MG. Anglard P, Cropp CS, Goepel JR. Lidcrcau R. Callahan R, Linehan W M , Rees RC. Harris CC. Liotta LA, Steeg PS (1991) Somatic allelic deletion of nm23 in human cancer. Cancer Res 51 :2490-2493 27. Maniatis T, Fritsch EF, Sambrook J (1989) Molecular cloning: a laboratory manual (Second edition). Cold Spring Harbor Laboratory, Cold Spring Harbour, New York 28. McMenamin MM, Hayle AJ,Darling DL, Whittaker PA, Tutty MB, Clarke PJ, Tarin D (1988) Genetic basis of metastases. Adv Exp Med Biol233:269-279 29. Moffett BF, Baban D, Bao L, Tarin D (1992) Fate of clonal lineages during neoplasia and metastasis studied with an incorporated genetic marker. Cancer Res 52: 1737-1743 30. Morikawa K, Walker SM, Nakajima M, Pathak S. Jessup JM, Fidler IJ (1988) Influence of organ environment on the growth, selection and metastasis of human colon carcinoma cells in nude mice. Cancer Res 48 :6863-6871 31. Muschel RJ, Williams JE, Lowy DR, Liotta LA (1985) Harvey ras induction of metastatic potential depends upon oncogene activation and the type of recipient cell. Am J Pathol 121 :1-8 32. Nelson DL, Ledbetter SA, Corbo L, Victoria MF, RamirezSolis R, Webster TD, Ledbetter DH, Caskey CT (1989) A h polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources. Proc Natl Acad Sci USA 86:66864690 33. Nicolson GL (1982) Cancer metastasis: organ colonization and the cell-surface properties of malignant cells. Biochim Biophys Acta 695: 113-176 34. Olsson L, Forschhammer J (1984) Induction of the metastatic phenotype in a m o w tumour model by 5-azacytidine and characterisation of an antigen associated with metastatic activity. Proc Natl Acad Sci USA 81 :3389-3393

189 35. Pellicer A. Robins D. Wold B. Sweet R. Jackson J. Lowy I. Roberts JM, Sim GK, Silverstein S. Axel R (1980) Altcring genotype and phenotype by DNA-mediated gene transfer. Science 209: 14141422 36. Perucho M. Hanahan D. Wigler M (1980) Genetic and physical linkage of exogenous sequences in transformed cells. Cell 22: 30%317 37. Pohl J. Goldfinger N. Radler-Pohl A. Rotter V. Schirrmacher V (1988) p53 increases experimental metastatic capacity of murine carcinoma cells. Mol Cell Biol8 :2078-208 I 38. Poste G (1982) Experimental systems for analysis of the malignant phenotype. Cancer Metastasis Rev 1 : 141-199 39. P o m t t i R. iMuschel R, Williams J. Padmanabhan R. Howard B, Liotta L, Khoury G (1986) Primary rat embryo cells transformed by one or two oncogenes show different metastatic potentials. Science 232 :223-227 40. Price JE, Carr D, Jones LD, Messer P. Tarin D (1982) Experimental analysis of factors affecting metastatic spread using naturally occurring tumors. Invasion Metastasis 2: 77-1 12 41. Price JE. Aukerman SL. Ananthaswamy HN, McIntyre BW. Schackert G. Schackert HK, Fidler IJ (1989) Metastatic potential of cloned murine melanoma cells transfected with activated c-Ha-ras. Cancer Res 49:4274-4281 42. Radler-Pohl A, Pohl J. Schirrmacher V (1988) Selective enhancement of metastatic capacity in mouse bladder carcinoma cells after transfection with DNA from liver metastases of human colon carcinoma. Int J Cancer 41 :840-846 43. Razin A. Cedar H, Riggs A D (eds) (1984) DNA methylation: biochemistry and biological significance. Springer-Verlag. New York 44. Reed KC, Mann DA (1985) Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res 13: 7207-7221 45:Robins DM, Ripley S. Henderson .4S,Axel R (1981) Transforming DNA integrates into the host chromosome. Cell 23 :29-39 46. Rubin CM. Houck CM. Deninger PL. Friedmann T. Schmid CW (1980) Partial nucleotide sequence of the 300-nucleotide interspersed repeated human DNA sequences. Nature 284: 371-373 47. Sealey PG. Whittaker PA, Southern EM (1985) Removal of repeated sequences from hybridisation probes. Nucleic Acids Res 13: 1905-1922 48. Sidebottom E, Clark SR (1983) Cell fusion segregates progressive growth from metastasis. Br J Cancer 47:399406 49. Southern PJ. Berg P (1982) Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J Mol Appl Genet 1 :327-341 50. Steeg PS. Bevilacqua G, Kopper L, Thorgeirsson UP, Talmadge JE, Liotta LA, Sobel ME (1988) Evidence for a novel gene associated with low tumor metastatic potential. J Natl Cancer Inst 80 :200-204

51. Talmadgc JE (19:35) Animal models for bone metastasis. In: Garattini S (ed) Bone resorption. metastasis and diphosphonates. Raven Press. New York, pp 17-26 52. Talmadge JE. Hart IR (1983) Morphologic studies on a murine reticulum cell sarcoma (histiocytic sarcoma) of histiocytic origin and its metastases. Vet Pathol 20:342-352 53. Tarin D (1988) Molecular genetics of metastasis. In: Whelm J. Bock G R (eds) Ciba foundation symposium on metastasis. John Wiley & Sons. London, pp 149-169 54. Tarin D. Price JE. (1981) Influence of microenvironment and vascular anatom} on "metastatic" colonization potential of mammary tumors. Cancer Res 41 :36043609 55. Tarin D. Vass ACR. Kettlewell MGW, Price JE (1984) Absence of metastatic sequelae during long-term treatment of malignant ascites by peritorieo-venous shunting: A clinico-pathological report. Invasion Metastasis 4: 1-12 56. Tarin D. Price JE.. Kettlewell MGW, Souter RG, Vass ACR. Crossley B (1984) Mechanisms of human tumor metastasis studied in patienis with peritoneovenous shunts. Cancer Res 44:3584-3592 57. Tarin D. Price JE. Kettlewell MGW. Souter RG. Vass ACR. Crossley B (1984) Clinicopathological observations on metastasis in man studied in patients treated with peritoneovenous shunts. Br Med J !88:749-751 58. Thorgeirsson UP. Turpeenniemi-Hujanen T. Williams JE. Westin EH. Heilman (:A. Talmadge JE. Liotta LA (1985) NIH/3T3 cells trdnsfected nith human tumor DNA containing activated ras oncogenes express the metastatic phenotype in nude mice. Mol Cell Biol 5: 2.59-262 59. Thorgeirsson UP, Turpeenniemi-Hujanen T, Talmadge JE. Liotta LA (1 986) Expression of oncogenes in cdncer metastases. Prog Clin Biol Re: 212:77-93 60.Trainer DL. Kline T. Mallon F. Greig R, Poste G (1985) Effect of 5-Azacytidine on DNA methylation and the malignant properties of 816 melanoma cells. Cancer Res 45:61246130 61. Tuck AB. Wilson SM. Sergovich FR. Chambers A F (1991) Gene expression and metastasis of somatic cell hybrids between murine fibroblast :ell lines of different malignant potential. Somat Cell Mol Genet 17:377-389 62. Vousden KH. Ecdes SA. Purvies H. Marhsall CJ (1986) Enhanced spontaneous metastasis of mouse carcinoma cells transfected with an act:vated c-Ha-ras-l gene. Int J Cancer 37:425433 63. Wallace JS. Hayle AJ, Syms AJ. Cairney M. Tutty B, G a u a r d A. Evans MF, Fleming KA. Tarin D (1989) The ras oncogene and tumour metastasis: observations on murine cells transfected with activaled human c-Ha-ras. Differentiation 41 :208215 64.Wigler M, Sweet R. Sim GK. Wold B. Pellicer A. Lacy E. Maniatis T, Silverstein S, Axel R (1979) Transformation of mammalian cells with genes from prokaryotes and eukaryotes. Cell 16: 777-785