Transgenic grapevine rootstock clones expressing the coat protein or movement protein genes of Grapevine fanleaf virus: Characterization and reaction to virus infection upon protoplast electroporation

Plant Science 170 (2006) 739–747 www.elsevier.com/locate/plantsci

Transgenic grapevine rootstock clones expressing the coat protein or movement protein genes of Grapevine fanleaf virus: Characterization and reaction to virus infection upon protoplast electroporation Laure Valat a,*, Marc Fuchs b,1, Monique Burrus a,2 a

Laboratoire de Stress, De´fense et Reproduction des Plantes, Unite´ de Recherche Vigne et Vin de Champagne, UPRES EA 2069, Universite´ de Reims Champagne-Ardenne, BP1039, 51687 Reims Cedex 2, France b Laboratoire de Virologie, Unite´ Mixte de Recherche Vigne et Vins d’Alsace, Institut National de la Recherche Agronomique, Universite´ Louis Pasteur, 28 rue de Herrlisheim, 68021 Colmar, France Received 22 June 2005; received in revised form 2 November 2005; accepted 12 November 2005 Available online 5 December 2005

Abstract The reaction to Grapevine fanleaf virus (GFLV) infection in 42 independent transgenic grapevine rootstock 41B clones expressing the coat protein (CP) or movement protein (MP) gene of GFLV was assayed by protoplast electroporation. Two of the 26 transgenic clones expressing the CP gene did not support the accumulation of GFLV MP to detectable levels, 12 accumulated substantially lower levels of MP, and 12 accumulated equivalent levels of MP relative to protoplasts of nontransformed controls at 72 h post-electroporation, as shown by Western blots with anti-MP gglobulins. Interestingly, inhibition of MP accumulation was achieved against virions but not viral RNAs, and was dependent on the inoculum dose. No interference was observed with the multiplication of Arabis mosaic virus, which is closely related to GFLV, likely due to low nucleotide identity between the CP genes. Also, one of the 16 transgenic clones expressing the MP gene significantly reduced the accumulation level of GFLV CP at 72 h post-electroporation, as shown by DAS-ELISA with anti-GFLV g-globulins. The potential of protoplast electroporation as rapid identification of GFLV-resistant grapevine clones at the cell level will be discussed relative to field screening for resistance at the plant level by nematodemediated GFLV transmission. # 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Transgenic grapevine; Protoplast electroporation; Grapevine fanleaf virus; Coat protein; Movement protein; Resistance

1. Introduction Fanleaf degeneration is one of the most important viral diseases of grapevines worldwide [1]. It causes a significant reduction in crop yield (up to 80%) and a progressive decline * Corresponding author at: Laboratoire de Physiologie Ve´ge´tale, Faculte´ des Sciences, Unite´ Mixte de Recherche A 408, Universite´ d’Avignon et des Pays de Vaucluse, 74 rue Louis Pasteur, 84029 Avignon Cedex 1, France. Tel.: +33 4 90 14 44 53; fax: +33 4 90 14 44 49. E-mail address: [email protected] (L. Valat). 1 Present address: Department of Plant Pathology, Cornell University, New York State Agricultural Experiment Station, Geneva, NY 14456, USA. 2 Present address: Evolution et Diversite´ Biologique, Unite´ Mixte de Recherche 5174, Universite´ Paul Sabatier, Bat 4R3, 118 Route de Narbonne, 31062 Toulouse Cedex 4, France. 0168-9452/$ – see front matter # 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2005.11.005

that reduces plant longevity or can even lead to plant mortality. Fanleaf degeneration is caused by several virus species from the genus Nepovirus in the family Comoviridae. The most important of them is Grapevine fanleaf virus (GFLV), which is vectored by the ectoparasitic nematode Xiphinema index [1]. The viral genome of GFLV is composed of two single stranded positive-sense RNAs, denoted RNA1 and RNA2, which carry a small covalently linked viral protein (VPg) at their 50 extremities and a poly(A) stretch at their 30 ends [1]. Each genomic RNA codes for a polyprotein, which is proteolytically processed into functional proteins. RNA1 codes for the proteins implicated in RNA replication and for the viral proteinase [1]. RNA2 codes for protein 2A, which is required for RNA2 replication, the movement protein (MP), and the coat protein (CP) [1].

740

L. Valat et al. / Plant Science 170 (2006) 739–747

Current strategies to control fanleaf degeneration in vineyards are based on soil disinfection with nematicides and cultural practices, including plant devitalization, uprooting, removal of root debris, and prolonged fallow [1,2]. Active molecules of nematicides have acute toxicity and fumigation is ineffective in heavy soils since nematode populations are not completely eradicated. Based on the limitations of the current strategies, there is a need to develop novel, efficient, and environmentally friendly alternatives to control GFLV in grapevines. One approach is to develop GFLV-resistant rootstocks. This can be achieved by engineering virus resistance through the application of the concept of pathogen-derived resistance [3] or by developing tolerance to virus spread through conventional breeding approaches using X. index-tolerant germplasm [4]. Since Powell-Abel et al. [5] demonstrated that tobacco plants expressing the CP gene of Tobacco mosaic virus (TMV) are protected against this virus, numerous transgenic plants expressing various CP gene constructs and exhibiting virus resistance have been developed [6,7]. Namely, transgenic Nicotiana benthamiana expressing the GFLV CP gene were obtained and shown to delay the onset of infection following mechanical inoculation with GFLV [8]. Based on these promising results, the GFLV CP gene was introduced into several grapevine rootstocks and varieties to engineer resistance to GFLV [9–12]. For instance, the grapevine rootstock 41B (Vitis vinifera cv. Chasselas
V. berlandieri), which is extensively used in the Champagne region in France for its tolerance to limestone, was transformed with the CP gene of GFLV strain F13 [10]. Other GFLV-derived constructs such as the MP gene were also introduced into rootstock 41B (Valat and Burrus, unpublished). Recently, resistance to GFLV was reported in V. vinifera var. Chardonnay grafted onto transgenic rootstock 41B clones expressing the GFLV CP gene that were tested over a 3-year period in a naturally GFLV-infected vineyard [13]. Evaluation of resistance to GFLV in grapevines usually relies on nematode-mediated GFLV transmission under field or greenhouse conditions. This approach requires prolonged period of time, i.e. several months to a few years, to identify GFLV-resistant clones. Other screening techniques would be desirable for a faster delivery of GFLV to test plants and for a more timely selection of GFLV-resistant material. Protoplast electroporation with virions or viral RNAs is another way to inoculate grapevines with GFLV [14,15]. No information is available on the potential of protoplast electroporation, as alternative to nematode-mediated GFLV inoculation, to identify transgenic grapevine clones that can interfere with GFLV multiplication. The aim of our study was to investigate protoplast electroporation as a rapid screening technique of transgenic grapevine clones expressing the CP or MP gene of GFLV to identify material that reduces or inhibits the accumulation of viral proteins at the cell level. Our results will be discussed in regard to the usefulness of grapevine protoplast electroporation as rapid evaluation of GFLV resistance at the cell level relative to lengthy field screening at the plant level.

2. Materials and methods 2.1. Viruses and viral RNAs GFLV strain F13 [16] and Arabis mosaic virus (ArMV) strain S [17] were propagated on the systemic herbaceous host Chenopodium quinoa and purified as described previously [18]. Purified GFLV and ArMV virions, and GFLV strain F13 RNAs extracted from purified virions [18] were used in protoplast experiments. 2.2. Plant material Plants of the grapevine rootstock 41B (Vitis vinifera cv. Chasselas
Vitis berlandieri) clone 233 were used for Agrobacterium tumefaciens-mediated transformation. Establishment and maintenance of embryogenic cultures, and transformation procedures were as previously reported [10]. Briefly, embryogenic cells were cultured with Agrobacterium tumefaciens strain LBA4404 containing either plasmid pRCPI with the CP gene [10] or plasmid PCT172 with the MP gene of GFLV strain F13 (Fig. 1). Plasmids pRCPI and PCT172 were kindly provided to us by Dr. L. Pinck, IBMP, Strasbourg, France, and Prof. P. Coutos-Thevenot, Universite´ de Poitiers, Poitiers, France, respectively. After 24 h of co-culture, embryogenic cells were transferred to liquid MS medium containing maltose (18 g/l) and glucose (4.6 g/l) (GM medium), supplemented with 5 mM b-naphthoxy acetic acid and cefotaxime (400 mg/ml), and cultured on paromomycincontaining medium. Transgenic 41B clones expressing the CP or MP gene of GFLV were obtained in independent experiments. Nontransgenic and transgenic clones of were maintained in tissue culture by propagation of one-node cuttings every twomonths on Murashige and Skoog medium (MS) [19]. Plants were grown in growth chambers under controlled light (16 h) and temperature (23 8C) conditions. 2.3. Characterization of the GFLV CP and MP transgenes by Southern blot and PCR The integration of the GFLV CP and MP transgenes was detected in putative transgenic grapevines by PCR and Southern blot hybridization with total DNA extracted from young leaves of in vitro-grown plants using 1 g of fresh tissue [10]. PCR and Southern blot experiments were conducted separately with distinct DNA samples. For PCR analysis of transgenic plants expressing the GFLV CP gene, primers CPfor (50 -3000CGGGTGAGACTGCGCAAC3017-30 ) and CPrev (50 -3572 GTCAGATACCCTA3554 GACTG -30 ) were used to amplify a 572 bp fragment corresponding to the 30 end of the CP gene. For transgenic plants expressing the GFLV MP gene, primers MPfor (50 -1300TGCACCATAGGATCAGTACGT1321-30 ) and MPrev (50 -1938ACTGAATCAGTATCCACAGTG1917-30 ) were used to amplify a 638 bp fragment corresponding to the central part of the MP gene. PCR reactions were performed with 0.3 mg

L. Valat et al. / Plant Science 170 (2006) 739–747

741

Fig. 1. Schematic representations of the T-DNA region of binary plasmids (A) pRCPI and (B) PCT172 used for transformation of embryogenic cells of the grapevine rootstock 41B with Agrobacterium tumefaciens strain LBA4404. The location of the probe used in Southern hybridization experiments is represented by dashed line. The position of the primers used in PCR assays are shown by arrows on top the CP or MP gene. CP: coat protein gene of GFLV; MP: movement protein gene of GFLV; NPT II: neomycin phosphotransferase II; GUS: b-glucuronidase gene; LB: Agrobacterium tumefaciens T-DNA left border; RB: Agrobacterium tumefaciens T-DNA right border; p35S: Cauliflower mosaic virus 35S promoter; t35S: Cauliflower mosaic virus 35S terminator; pNOS: nopaline synthase promoter; tNOS: nopaline synthase terminator.

of total DNA in 20 mM Tris–HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 mmol of each reverse primer (CPfor-CPrev or MPfor-MPrev for the CP and MP transgenes, respectively), and 2.5 U of Taq polymerase (Eurogentec) in a final volume of 50 ml. Fifty picograms of plasmid pCPM carrying the GFLV CP gene [20] or plasmid PCT172 harboring the GFLV MP and uidA genes were used as positive control. The PCR used a 3 min heating step at 92 8C followed by 35 cycles of 1 min melting at 92 8C, 1 min annealing at 55 8C, and 1 min elongation at 72 8C with a final extension of 3 min at 72 8C. PCR-amplified DNA products were analyzed by electrophoresis on 1% agarose gels in 90 mM Tris–Borate and 2 mM EDTA pH 8.0 (TBE), and subsequently visualized under UV after staining with ethidium bromide. For Southern hybridization, 20 mg of total DNA were digested with HindIII, separated by electrophoresis on 0.8% agarose gels in TBE, and transferred to Hybond-N membranes by capillarity in 10
SSC (1.5 M NaCl and 0.15 M trisodium citrate pH 7). Blotted DNA was hybridized to a 32P-labelled GFLV CP DNA fragment excised from plasmid pCPM by a HincII–HindIII digestion following standard procedures [21].

of 20 ml containing 50 mM Tris–HCl pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM of each dNTP, 50 mM of random hexamers, 20 U RNasin, and 15 U of reverse transcriptase from Moloney murine leukemia virus. The volume was adjusted to 100 ml with sterile water after denaturation at 95 8C for 5 min. Amplification of the cDNA was carried out by PCR as described above with 10 ml of the RT reaction, and primers MPfor and MPrev. 2.5. DAS-ELISA detection of the GFLV CP transgene expression The expression of the CP was detected in leaves of in vitrogrown transgenic plants expressing the GFLV CP gene by double antibody sandwich (DAS)-enzyme-linked immunosorbent assay (ELISA) [23] using commercial anti-GFLV gglobulins (Bioreba). DAS-ELISA data were expressed as optical density (OD) values at 405 nm. Transgenic clones were considered as CP expressors if their OD readings were at least twice 20% those of healthy nontransformed plants. 2.6. Protoplast isolation and transfection

2.4. Characterization of the GFLV CP and MP transgene transcripts by Northern blot and RT-PCR The steady-state accumulation of GFLV CP transgene transcripts was detected by Northern blotting using total RNAs isolated from leaves of in vitro-grown transgenic plants by the lithium chloride precipitation method [22]. Approximately 10 mg of total RNAs were separated on 1% agaroseformaldehyde gels, blotted to nylon membranes (Roche), and hybridized to a riboprobe corresponding to the full-length GFLV CP gene labelled by in vitro transcription with digoxygenin-dUTP. Hybridization and autoradiography were performed according to the manufacturer’s instructions (Roche). Reverse transcription (RT)-polymerase chain reaction (PCR) was used to detect GFLV MP transgene transcripts. RT assays were carried out at 42 8C for 45 min in a final volume

Protoplasts of transgenic and nontransgenic grapevine rootstock 41B clones were prepared as described [14]. Briefly, well expanded leaves of 6-week-old in vitro propagated plants were sliced in 0.5 M mannitol, 5 mM KCl, 2 mM CaCl2, 0.4 mM MgCl2, 0.3 mM 2-[N-Morpholino]ethanesulfonic acid (MES) pH 5.7 (osmotic pressure: 540 mosm/kg), and digested in 2% cellulase from Trichoderma viridae (1 U/mg, Fluka) and 1% pectinase from Rhizopus sp. (5 U/g, Fluka) for 16 h at 23 8C in the dark. Mesophyll protoplasts were isolated, purified by centrifugation, and cultured in NN69 liquid medium [24] with 0.6 M glucose and 2.5 mM MES, pH 5.8, at 23 8C in the dark [14]. Freshly isolated protoplasts were diluted in pre-chilled electroporation solution (0.1 mM CaCl2 pH 5.6 adjusted to 540 mosm/kg with mannitol) at 7.5
105 protoplasts/ml. Protoplasts at a final concentration of 3.75
105/ml were

742

L. Valat et al. / Plant Science 170 (2006) 739–747

electroporated with 2 mg of purified GFLV virions or 10 ng of viral RNAs in 800 ml per cuvette by using a Gene Pulser II apparatus (Bio-Rad). The voltage (150 or 200 V) and capacitance (150 or 175 mF) conditions were as previously described for optimal GFLV uptake and delivery [14]. Electroporated protoplasts were incubated on ice for 30 min, diluted in 2.5 ml liquid NN69 culture medium, and incubated at 23 8C for 72 h in the dark. At 72 h post-electroporation, protoplasts were harvested by centrifugation at 100 g for 3 min and resuspended in appropriate extraction buffer. Transfection experiments were repeated at least three times. 2.7. GFLV detection in electroporated protoplasts The CP accumulation was assayed in electroporated protoplasts of transgenic clones expressing the GFLV MP gene as preliminary evaluation of resistance to GFLV. The CP expression was detected by DAS-ELISA [23] using specific anti-GFLV g-globulins (Bioreba) and total proteins (60 mg/ml) extracted from 1.5
105 protoplasts in 400 ml of denaturation buffer (0.2 M Tris–HCl pH 8.2, 40 mM NaCl, 0.5 M PVP 40,000, and 0.05% Tween 20). Total proteins were quantified by using the Bradford total protein assay with bovine serum albumin as standard (Bio-Rad). Positive and negative controls of DAS-ELISA were total proteins from GFLV-infected grapevine leaves and unelectroporated grapevine protoplasts, respectively. Alternatively, leaves of GFLV-infected C. quinoa were also used as positive check. DAS-ELISA OD405 nm mean values were considered significatively different between electroporated transgenic and nontransgenic protoplasts, as well as between different transgenic clones, by running a paired Student test. The MP accumulation was assessed in electroporated protoplasts of transgenic clones expressing the GFLV CP gene as a preliminary indication of resistance to GFLV. The MP expression and accumulation was measured by Western blotting using purified anti-GFLV MP g-globulins diluted 1/ 30,000 [25] and total proteins (120 mg/ml) extracted from 3
105 protoplasts resuspended in 15 ml loading buffer (0.06 M Tris–HCl pH 6.8, 2% SDS, 10% glycerol, and 0.025% bromophenol blue). Positive and negative controls consisted of total proteins extracted from GFLV-infected C. quinoa leaves and unelectroporated nontransgenic grapevine protoplasts, respectively. Test samples were considered to interfere with GFLV infection if the MP consistently accumulated at a lower level than in control protoplasts. 3. Results 3.1. Characterization of transgenic grapevine rootstock 41B clones expressing the GFLV CP or MP gene Several putative independent transgenic grapevine rootstock 41B clones expressing the CP or MP gene of GFLV (Fig. 1) were developed. The integration of the GFLV CP transgene was assessed in putative transgenic plants by PCR using primers designed in the 30 end of the CP gene. The expected 572 bp

amplicon was obtained for 140 of the 200 (70%) clones analyzed. Southern blot analysis indicated that the GFLV CP transgene was transferred to 1–5 insertion loci for 26 randomly selected clones of the 140 PCR-positive that were initially tested (Table 1). Of these transgenic 26 clones containing the GFLV CP gene, including ten that were partially characterized previously [10,13], ten had one insertion locus, seven had two insertion loci, and nine had three, four or five insertion loci (Table 1). Northern blotting revealed the accumulation of GFLV CP transgene transcripts to detectable levels in all 26 transgenic clones tested (Table 1). Interestingly, transgenic clone 149 accumulated a higher level of steady-state transcripts (Fig. 2, lane 3) compared to transgenic clones 240 and 223 (Fig. 2, lanes 1 and 5), which accumulated intermediate levels, and clones 32 and 64, which accumulated substantially lower levels (Fig. 2, lanes 2 and 4). The expression of the GFLV CP transgene was detected by DAS-ELISA in 25 of the 26 transgenic clones tested (Table 1). Interestingly, there was no correlation between expression of the CP transgene, as shown by Northern blot or DAS-ELISA, and the number of T-DNA insertion loci (Table 1). The presence of the GFLV MP transgene was tested in putative transgenic 41B plants by PCR using primers designed in the central part of the MP gene. The expected 638 bp fragment was amplified for 16 of the 29 (55%) putative transgenic 41B plants analyzed. In addition, the accumulation of GFLV MP transgene transcripts was detected by RT-PCR in 13 of the 16 plants analyzed (Table 1). 3.2. Reaction of transgenic grapevine protoplasts expressing the GFLV CP gene upon electroporation with GFLV Protoplasts of 26 transgenic grapevine rootstock 41B clones expressing the GFLV CP gene (Table 1) were isolated and electroporated with purified GFLV particles or viral RNAs to test the effect of the transgene on virus multiplication at the cell level by monitoring the MP accumulation in Western blotting using specific anti-GFLV MP g-globulins. The MP was targeted, not the CP, in order to avoid any interference from protein expression driven by the CP transgene. No MP accumulation was detected in protoplasts of transgenic clones 56 and 149 electroporated with 2 mg of purified GFLV strain F13 (Fig. 3A, lanes 6 and 7). These results were repeatedly obtained in six independent experiments, indicating a complete inhibition of MP accumulation in protoplasts of these two transgenic clones. In protoplasts of 12 other transgenic clones (32, 77, 139, 141, 155, 166, 218, 219, 223, 224, 225, and 241), the MP accumulated to detectable levels but at a substantially lower level than in protoplasts of nontransgenic controls, as illustrated for clone 223 (Fig. 3A, lane 5 versus lane 3), suggesting a reduction in MP accumulation. For the 12 remaining transgenic clones tested (5, 47, 61, 64, 68, 206, 207, 213, 226, 232, 237, and 240), the MP accumulation level was similar to that in protoplasts of

L. Valat et al. / Plant Science 170 (2006) 739–747

743

Table 1 Characteristics of transgenic grapevine rootstock 41B clones expressing the CP or MP gene of Grapevine fanleaf virus (GFLV) Transgenea

Clones

Transgene insertion locusb

Transgene mRNA accumulation c

Transgene CP expressiond

Reaction to GFLV electroporatione

CP

5 32 47 56 61 64 68 77 139 141 149 155 166 206 207 213 218 219 223 224 225 226 232 237 240 241

1 1 4 1 3 5 2 2 1 1 4 3 1 2 2 1 1 1 5 5 3 3 1 2 2 2

+ + + + + + + + + + +++ + + + + + + + ++ ++ + + + + ++ +

 +   +  + + +  + + +    + + + +   +  + +

e r e i e e e r r r i r r e e e r r r r r e e e e r

MP

1 2 33 35 36 38 43 65 66 79 85 98 99 101 109 110

ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND

+ + + + +  +  + + + +  + + +

ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND

e e e e e e e e r e e e e e e e

ND: not determined. a Transgenic grapevines expressed the coat protein (CP) or the movement protein (MP) gene of (GFLV). b Transgene insertion locus was determined by Southern blot hybridization with a 32P-labelled GFLV CP probe using HindIII-digested total DNA extracted from leaves of tissue-culture grown plants. c Steady-state transgene transcripts were determined in transgenic plants expressing the CP gene by Northern blot hybridization with a digoxygenin-dUTP-labelled GFLV CP riboprobe using total RNA extracted from leaves of tissue-culture grown CP transgenic plants. Plants with (+) weak, (++) high, and (+++) very high transgene transcript accumulation were discriminated. Steady-state transgene transcripts were determined in transgenic plants expressing the MP gene by RT-PCR using total RNA extracted from leaves of tissue-cultured MP transgenic plants. Plants with () no detectable RNA and (+) detectable mRNA were discriminated. d The relative CP expression level was determined by DAS-ELISA using specific anti-GFLV g-globulins. Transgenic clones with (+) CP expression and () lack of detectable CP expression were distinguished. e Transgenic clones for which (i) an inhibition or (r) a reduction in the accumulation of the GFLV CP or MP was observed in protoplasts electroporated with GFLV virions relative to control protoplasts were distinguished. Similarly, transgenic clones for which an equivalent accumulation of GFLV CP or MP was observed in protoplasts electroporated with GFLV virions relative to control protoplasts were marked as (e). The accumulation of GFLV CP and MP was assayed in protoplasts of transgenic clones expressing the MP and CP genes, respectively.

744

L. Valat et al. / Plant Science 170 (2006) 739–747

Fig. 2. Northern blot analysis of five independent transgenic grapevine clones expressing the CP gene of GFLV strain F13. Lane 1: clone 240; lane 2: clone 32; lane 3: clone 149; lane 4: clone 64; lane 5: clone 223; lane 6: nontransgenic grapevine infected by GFLV strain F13 (positive control); and lane 7: healthy nontransgenic plant (negative control). The arrows indicate the position of GFLV RNA2 (3774 bp) and GFLV CP transgene transcripts (1760 bp).

nontransgenic controls, as illustrated for clone 64 (Fig. 3A, lane 4 versus lane 3). To test whether the nature of the viral inoculum could influence the effect of the GFLV CP transgene on virus multiplication, protoplasts of clones 56 and 149 were electroporated with 10 ng of GFLV strain F13 RNAs. Western blot analysis showed the accumulation of MP (Fig. 3B, lanes 6 and 7), suggesting that inhibition of MP accumulation was effective against virions but not viral RNAs. In protoplasts of

Fig. 3. Western blot detection of GFLV MP in total proteins of protoplasts of nontransgenic or transgenic grapevine plants expressing the GFLV CP gene electroporated with (A) 2 mg of purified GFLV strain F13 at 150 mF and 200 V, or (B) 10 ng viral RNAs at 150 mF and 174 V, using specific anti-MP gglobulins 72 h after electroporation. Lane 1: GFLV-infected Chenopodium quinoa leaves; lane 2: unelectroporated protoplasts of nontransgenic grapevine 41B mixed with 2 mg of purified GFLV strain F13; lane 3: protoplasts of nontransgenic grapevine 41B; lanes 4–7: protoplasts of transgenic clones 64, 223, 56 and 149, respectively.

the twelve transgenic clones, which accumulated low MP levels relative to controls upon transfection with virions (32, 77, 139, 141, 155, 166, 218, 219, 223, 224, 225, and 241), the MP accumulated but at a lower level than in protoplasts of nontrangenic controls even when viral RNAs were tested, as illustrated for clone 223 (Fig. 3B, lane 5 versus lane 3). A similar MP accumulation was obtained in protoplasts of the twelve remaining transgenic clones, which did not interfere with the MP accumulation upon transfection with virions (5, 47, 61, 64, 68, 206, 207, 213, 226, 232, 237, and 240), and in protoplasts of nontransgenic plants when viral RNAs were tested, as illustrated for clone 64 (Fig. 3B, lane 4 versus lane 3). To determine the effect of increasing amounts of viral inoculum on inhibition of MP accumulation, protoplasts of transgenic clone 149 were electroporated with 2, 5, 25, and 50 mg of purified GFLV strain F13 particles. The MP accumulation level was not detectable at 2 mg (Fig. 4A, lane 7), low at 5 and 25 mg (Fig. 4A, lanes 8 and 9), and increased at 50 mg viral inoculum conditions (Fig. 4A, lane 10). These results suggested that the inhibition of MP accumulation is dependent on the amount of viral inoculum in protoplasts of transgenic clone 149. Nevertheless, the level of MP accumulation was consistently lower in protoplasts of transgenic clone 149 than in control protoplasts in which it increased proportionally with increasing viral inoculum (Fig. 4A, lanes 7–10 versus lanes 3–6). Protoplasts of transgenic clone 149 were further electroporated with increasing amounts of purified ArMV strain S particles to examine the breadth of the GFLV CP transgene effect on virus multiplication. ArMV is another nepovirus closely related to GFLV [1]. Noteworthy, the anti-MP g-

Fig. 4. Western blot detection of the GFLV or ArMV MP in total proteins of protoplasts of nontransgenic and transgenic grapevine clone 149 expressing the GFLV CP gene by using GFLV MP g-globulins 72 h after electroporation. Protoplasts were electroporated at 150 mF and 200 V with increasing amounts (2–50 mg) of purified (A) GFLV strain F13 or (B) ArMV strain S. Lane 1: GFLV-infected Chenopodium quinoa leaves; lane 2: unelectroporated protoplasts of nontransgenic grapevine 41B mixed with 2 mg of purified GFLV strain F13; lanes 3–6: protoplasts of nontransgenic grapevine 41B electroporated with 2, 5, 25 and 50 mg of purified virus, respectively; lanes 7–10: protoplasts of transgenic clone 149 electroporated with 2, 5, 25 and 50 mg of purified virus, respectively.

L. Valat et al. / Plant Science 170 (2006) 739–747

Fig. 5. DAS-ELISA detection of the GFLV CP in protoplasts of transgenic grapevine clones expressing the GFLV MP gene electroporated at 150 mF and 200 V with 2 mg of purified GFLV strain F13 by using specific anti-GFLV gglobulins 72 h after electroporation. Lanes 1, 3, and 5: unelectroporated protoplasts of nontrangenic grapevine 41B, and transgenic grapevine clones 66 and 38 mixed with 2 mg GFLV strain F13, respectively; lanes 2, 4 and 6: electroporated protoplasts of nontransgenic grapevine 41B and transgenic grapevine clones 66 and 38, respectively. The standard deviation of ELISA OD values after 2 h substrate hydrolysis is represented by a bar. Different letters (a–c) denote statistical differences between OD values.

globulins used in this study equally detect the MP of GFLV and ArMV [25]. No difference on accumulation of ArMV MP was detected by Western blot in protoplasts of transgenic clone 149 and nontransgenic controls, regardless of the amount of electroporated virions (Fig. 4B lanes 7–10 and 3–6). These data indicated no interference of the GFLV CP transgene with ArMV multiplication at the cell level. 3.3. Reaction of transgenic grapevine protoplasts expressing the GFLV MP gene upon electroporation with GFLV Protoplasts of 16 transgenic grapevine rootstock 41B clones expressing the GFLV MP gene (Table 1) were electroporated with 2 mg of purified GFLV particles to examine the effect of the transgene on virus multiplication at the cell level. The impact of the MP transgene was assessed by measuring the CP accumulation in DAS-ELISA using anti-GFLV g-globulins, in order to avoid any potential interference from the transgenedriven MP expression. CP accumulation was significantly reduced in protoplasts of transgenic clone 66 compared to protoplasts of nontransgenic controls (Fig. 5, lane 4 versus lane 2) (P = 0.05) and protoplasts of transgenic clone 38 (Fig. 5, lane 4 versus lane 6) (P = 0.05). For the fifteen remaining transgenic plants tested (1, 2, 33, 35, 36, 38, 43, 65, 79, 85, 98, 99, 101, 109, and 110), similar DASELISA OD readings were obtained for protoplasts of transgenic clones and nontransgenic controls, as illustrated for clone 38 (Fig. 5, lane 6 versus lane 2). 4. Discussion Several transgenic grapevine rootstock 41B clones transformed with either the CP or the MP gene of GFLV were characterized in this study for transgene insertion and expression. The majority of the transgenic clones tested

745

(93%, 39 of 42) expressed the GFLV-derived transgene, as shown by Northern hybridization, RT-PCR and/or DASELISA, even at a fairly high level for some of them. Protoplasts of these transgenic clones were further electroporated with purified GFLV virions or viral RNAs to test the effect of these transgenes on viral protein expression and accumulation. Direct inoculation of GFLV using electroporation constitutes a novel and useful tool to infect grapevine tissues and evaluate the efficiency of GFLV-derived transgenes at reducing or inhibiting the accumulation of viral proteins at the cell level. This approach allows a rapid evaluation of a large population of grapevine clones within a short time frame. Indeed, we were able to analyze at least eight transgenic clones within 1 week. Protoplast electroporation is also an efficient and reproducible approach to inoculate GFLV since the viral inoculum is quantified and plant growth is standardized in controlled tissue culture conditions. In addition, protoplast electroporation requires little plant material (200 mg of leaf tissue) and reduced laboratory space. A complete inhibition of MP accumulation following electroporation with GFLV virions was observed in two transgenic grapevine clones (56 and 149) expressing the GFLV CP gene. This reaction was dependent on the inoculum concentration since the MP expression and accumulation occurred to detectable levels when the viral inoculum was higher than 2 mg. Also, no reduction in MP accumulation was observed when protoplasts of these two transgenic clones were electroporated with viral RNAs rather than virions. Furthermore, one transgenic clone (66) expressing the GFLV MP gene significantly reduced the accumulation of CP. The effect of CP gene constructs on virus multiplication was reported previously for GFLV [8] and other nepoviruses such as ArMV [26], Grapevine chrome mosaic virus [27], Tomato ringspot virus [28], and Tomato black ring virus [29] at the plant but not at the protoplast level. Protoplasts of transgenic grapevine clones expressing the GFLV CP gene did not interfere with the accumulation of the MP of ArMV. Similarly, at the plant level, transgenic N. benthamiana expressing the GFLV CP gene have been shown to be resistant to mechanical inoculation of GFLV but not of ArMV [8]. The CP gene of GFLV and ArMV share 65% homology at the nucleotide level [30]. The lack of effect of the GFLV CP transgene against ArMV at the protoplast and plant level suggests that the identity between the CP gene of these two viruses might be too low. Indeed, post-trancriptional gene silencing, which is the mechanism underlying resistance to viruses in most transgenic plants expressing virus-derived genes [31,32], requires at least 87% sequence identity between transgene transcribed regions and target viral genes for efficient resistance [33–35]. Based on these requirements, a dual CP gene construct with, for instance, the CP gene of GFLV fused to the CP gene of ArMV within a given T-DNA, should be envisaged to confer resistance to both GFLV and ArMV in a single transgenic grapevine rootstock clone. Protoplast electroporation was used as transient gene expression system to screen three virus-derived gene constructs (CP sequences in sense orientation, CP as antisense RNA, and

746

L. Valat et al. / Plant Science 170 (2006) 739–747

antisense 30 untranslatable region) for their potential to interfere with the accumulation of Cherry leafroll virus (CLRV) from the genus Nepovirus [36]. Anti-viral activity was shown in protoplasts of Nicotiana tabacum cv Xanthi that were previously electroporated with plasmids intended to express CLRV CP RNA. Although the experimental approach was different, this study and ours demonstrate the utility of an electroporation protoplast system to test the efficiency of different nepovirus-derived sequences for their potential to interfere with virus replication and accumulation at the cell level. Similarly, protoplast electroporation was successfully used for screening candidate virus-derived sequences of Citrus tristeza virus to interfere with viral replication [37]. Protoplast electroporation offers timely information on the effect of GFLV-derived transgenes on virus multiplication at the cell level. Do results at the cell level predict results at the plant level? Earlier studies indicate that engineered resistance at the plant level against TMV or Tobacco etch virus is also observed at the protoplast level [38,39]. In the case of GFLV, ten (5, 32, 56, 68, 77, 139, 141, 206, 219, and 240) of the 26 transgenic grapevine rootstock 41B clones expressing the GFLV CP gene that were selected for this study have been previously tested in a naturally GFLV-infected vineyard [13]. A comparative analysis of field data and our findings indicate no correlation between the effect of the GFLV CP transgene on virus multiplication at the cell level and resistance to virus infection at the plant level. Protoplasts of transgenic clones 206, and 240, which were resistant to GFLV infection in the vineyard [13], accumulated substantially lower levels of MP compared to controls, while protoplasts of transgenic clone 219, which was also resistant to GFLV in the vineyard [13], accumulated equivalent levels of MP than controls. Also, protoplasts of transgenic clones 32, 77, 139, 141, 206, and 237 accumulated less MP than controls but V. vinifera var. Chardonnay grafted onto the same clones were susceptible to GFLV infection in the vineyard [13]. Finally, transgenic clones 5 and 68 were susceptible to GFLV at the cell and plant level. Based on these observations, an equivalent accumulation of MP in protoplasts of transgenic clones compared to control protoplasts did not predict susceptibility to GFLV infection at the plant level, neither did a reduced accumulation of MP. Similarly, an inhibition of MP accumulation at the cell level did not predict resistance to GFLV infection at the plant level. Our intention was to use protoplast electroporation as a first step of a screening program to quickly evaluate a population of transgenic clones and eliminate susceptible material based on the reaction to GFLV infection at the cell level. Then, a second screening would have been performed at the plant level with putative resistant transgenic clones of interest. This strategy was going to be devised with a large population of transgenic rootstock clones expressing various GFLV-derived gene constructs. Since interference with GFLV multiplication at the cell level does not predict resistance at the plant level, we can conclude that our strategy is not suited to identify GFLVresistant transgenic grapevine rootstock clones. Assuming gene silencing is involved in the engineered resistance in transgenic grapevine clones expressing the CP gene of GFLV, one possible

explanation for the differential reaction at the cell and plant level, among others, might relate to a variable regulation of the initiation, establishment, amplification, and/or cell-to-cell movement of the RNA silencing signal in the different tissues and transgenic clones [31]. Acknowledgments We are grateful to Drs. Lothaire Pinck and Christiane StussiGaraud (IBMP, Strasbourg, France) for providing us with plasmids pPCPI and g-globulins directed to the movement protein of GFLV, respectively, Prof. Pierre Coutos-Thevenot (Universite´ de Poitiers, Poitiers, France) for providing us with plasmid PCT172, and Pascal Cornuet (INRA, Colmar, France) for supplying purified GFLV and ArMV. We thank Dr. L.M. Yepes for critically reading the manuscript. References [1] P. Andret-Link, C. Laporte, L. Valat, C. Ritzenthaler, G. Demangeat, E. Vigne, V. Laval, P. Pfeiffer, C. Stussi-Garaud, M. Fuchs, Grapevine fanleaf virus: still a major threat to the grapevine industry, J Plant Pathol 86 (2004) 183–195. [2] D.J. Raski, A.C. Goheen, L.A. Lider, C.P. Meredith, Strategies against Grapevine fanleaf virus and its nematode vector, Plant Dis 67 (1983) 335– 339. [3] J.C. Sanford, S.A. Johnston, The concept of parasite-derived resistancederiving resistance genes from the parasite’s own genome, J. Theor. Biol. 113 (1985) 395–405. [4] A. Bouquet, Y. Danglot, L. Torregrosa, M. Bongiovanni, P. CastognoneSereno, Breeding rootstocks resistant to grape fanleaf virus spread, using Vitis
Muscadinia hybridization, in: A. Bouquet, J.M. Boursiquot (Eds.), Proceedings of the Seventh International Symposium on Grapevine Genetics and Breeding, Montpellier, France, Acta Hortic. 528 (2000) 517–523 (special issue). [5] P. Powell-Abel, R.S. Nelson, B. De, N. Hoffmann, S.G. Rogers, R.T. Fraley, R.N. Beachy, Delay of disease development in transgenic plants that express the Tobacco mosaic virus coat protein gene, Science 232 (1986) 738–743. [6] M. Fuchs, D. Gonsalves, Genetic engineering and resistance to viruses, in: G. Khachatourians, A. McHughen, R. Scorza, W.K. Nip, Y.H. Hui (Eds.), Transgenic Plants and Crops, Marcel Dekker Inc., New York, 2002, pp. 217–231. [7] I. Dasgupta, V.G. Malathi, S.K. Mukherjee, Genetic engineering for virus resistance, Curr. Sci. 84 (2003) 341–354. [8] N. Bardonnet, F. Hans, M.A. Serghini, L. Pinck, Protection against virus infection in tobacco plants expressing the coat protein of grapevine fanleaf nepovirus, Plant Cell Rep. 13 (1994) 357–360. [9] S. Krastanova, M. Perrin, P. Barbier, G. Demangeat, P. Cornuet, N. Bardonnet, L. Otten, B. Walter, Transformation of grapevine rootstocks with the coat protein gene of grapevine fanleaf nepovirus, Plant Cell Rep. 14 (1995) 550–554. [10] M.C. Mauro, S. Toutain, B. Walter, L. Pinck, L. Otten, P. CoutosThevenot, A. Deloire, P. Barbier, High efficiency regeneration of grapevine plants transformed with the GFLV coat protein gene, Plant Sci. 112 (1995) 97–106. [11] B. Xue, K.S. Ling, C.L. Reid, S. Krastanova, M. Sekiya, E.A. Momol, S. Sule, J. Mozsar, D. Gonsalves, T. Burr, Transformation of five grape rootstocks with plant virus genes and a virE gene from Agrobacterium tumefaciens, In vitro Cell Dev. Biol. Plant. 35 (1999) 226–231. [12] A. Spielmann, S. Krastanova, V. Douet-Orhant, P. Gugerli, Analysis of transgenic grapevine and Nicotiana benthamiana plants expressing an Arabis mosaic virus coat protein gene, Plant. Sci. 156 (2000) 235– 244.

L. Valat et al. / Plant Science 170 (2006) 739–747 [13] E. Vigne, V. Komar, M. Fuchs, Field safety assessment of recombination in transgenic grapevines expressing the coat protein gene of Grapevine fanleaf virus, Transgenic Res. 13 (2004) 165–179. [14] L. Valat, S. Toutain, N. Courtois, F. Gaire, E. Decout, L. Pinck, M.C. Mauro, M. Burrus, GFLV replication in electroporated grapevine protoplasts, Plant. Sci. 155 (2000) 203–212. [15] L. Valat, M. Burrus, M. Fuchs, M.C. Mauro, Review of techniques to inoculate grapevines with Grapevine fanleaf virus: lessons and perspectives, Am. J. Enol. Vitic. 54 (2003) 279–285. [16] A. Vuittenez, M.C. Munck, J. Kuszala, Souches de virus a` hautes agressivite´s isole´es de vignes atteintes de de´ge´ne´rescence infectieuse, Etud. Virol. Appl. 5 (1964) 69–78. [17] B. Huss, B. Walter, M. Fuchs, Cross protection between Arabis mosaic virus and Grapevine fanleaf virus in Chenopodium quinoa, Ann. Appl. Biol. 114 (1989) 45–60. [18] L. Pinck, M. Fuchs, M. Pinck, M. Ravelonandro, B. Walter, A satellite RNA in Grapevine fanleaf virus strain F13, J. Gen. Virol. 69 (1988) 233–239. [19] T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays with tobacco tissue cultures, Physio. Plant. 15 (1962) 473–497. [20] M.A. Serghini, M. Pinck, L. Pinck, In vitro expression of a chimeric coat protein gene from Grapevine fanleaf virus (strain F13), Arch. Virol. 117 (1991) 297–304. [21] E.F. Sambrook, O. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, 1991. [22] L. Valat, F. Mode, M.C. Mauro, M. Burrus, Preliminary attempts to biolistic inoculation of Grapevine fanleaf virus, J. Virol. Meth. 108 (2003) 29–40. [23] B. Walter, L. Etienne, Detection of the Grapevine fanleaf virus away from the period of vegetation, J. Phytopathol. 120 (1987) 355–364. [24] P. Nitsch, C. Nitsch, Haploid plants from pollen grains, Science 163 (1969) 85–87. [25] C. Ritzenthaler, M. Pinck, L. Pinck, Grapevine fanleaf nepovirus P38 putative movement protein is not transiently expressed and is a stable final maturation product in vivo, J. Gen. Virol. 76 (1995) 907–915. [26] D. Bertioli, J.L. Cooper, M.L. Edwards, W.S. Hawes, Arabis mosaic nepovirus coat protein in transgenic tobacco lessens diseases severity and virus replication, Ann. Appl. Biol. 120 (1992) 47–54. [27] V. Brault, T. Candresse, O. Le Gall, R.P. Delbos, M. Lanneau, J. Dunez, Genetically engineered resistance against Grapevine chrome mosaic nepovirus, Plant. Mol. Biol. 21 (1993) 89–97.

747

[28] L.M. Yepes, M. Fuchs, J.L. Slightom, D. Gonsalves, Sense and antisense coat protein gene constructs confer high levels of resistance to tomato ringspot nepovirus in transgenic Nicotiana species, Phytopathol 86 (1996) 417–424. [29] C. Pacot-Hiriart, O. Le Gall, T. Candresse, R.P. Delbos, J. Dunez, Transgenic tobaccos transformed with a gene encoding a truncated form of the coat protein of tomato black ring nepovius are resistant to viral infection, Plant Cell Rep. 19 (1999) 203–209. [30] A.M. Loudes, C. Ritzenthaler, M. Pinck, M.A. Serghini, L. Pinck, The 119 and 124 kDa polyproteins of Arabis mosaic nepovirus (isolate S) are encoded by two distinct RNA species, J. Gen. Virol. 76 (1995) 899– 906. [31] O. Voinnet, Induction and suppression of RNA silencing: insights from viral infections, Nat. Rev. Genet. 6 (2005) 206–221. [32] C. Ritzenthaler, Resistance to plant viruses; old issue, news answers, Curr. Opin. Biotechnol. 16 (2005) 118–122. [33] E. Mueller, J. Gilbert, G. Davenport, G. Brigneti, D. Baulcombe, Homology-dependent resistance: transgenic virus resistance in plants related to homology-dependent gene silencing, Plant J. 7 (1995) 1001–1013. [34] M.E. Taliansky, E.V. Ryabov, D.J. Robinson, Two distinct mechanisms of transgenic resistance mediated by groundnut rosette virus satellite RNA sequences, Mol. Plant Microb. Interact 11 (1998) 367–374. [35] C.H. Chiang, J.J. Wang, F.J. Jan, S.D. Ye, D. Gonsalves, Comparative reactions of recombinant papaya ringspot viruses with chimeric coat protein (CP) genes and wild-type viruses on CP-transgenic papaya, J. Gen. Virol. 11 (2001) 2827–2836. [36] M. Brooks, G. Bruening, Transient gene expression of antisense RNA and coat protein-encoding sequences reduced accumulation of Cherry leafroll virus in tobacco protoplasts, Virology 208 (1995) 132–141. [37] O. Olivares-Fuster, G.H. Fleming, M.R. Albiach-Marti, S. Gowda, W.O. Dawson, J.W. Grosser, Citrus tristeza virus (CTV) resistance in transgenic citrus based on virus challenge of protoplasts, In Vitro Cell Dev. Biol. Plant 39 (2003) 567–572. [38] J.C. Register III, R.N. Beachy, Resistance to TMV in transgenic plants results from interference with an early event in infection, Virology 166 (1988) 524–532. [39] J.A. Lindbo, L. Silva-Rosales, W.M. Proebsting, W.G. Dougherty, Induction of a highly specific antiviral state in transgenic plants: implications for regulation of gene expression and virus resistance, Plant Cell 5 (1993) 1749–1759.