Transgenic mice possessing increased numbers of nociceptors do not exhibit increased behavioral sensitivity in models of inflammatory and neuropathic pain

Pain 106 (2003) 491–500 www.elsevier.com/locate/pain

Transgenic mice possessing increased numbers of nociceptors do not exhibit increased behavioral sensitivity in models of inflammatory and neuropathic pain Melissa Zwicka,1, Derek C. Molliverb,1, Jessica Lindsayb, Carolyn A. Fairbanksc, Tomoko Sengokuc, Kathryn M. Albersb, Brian M. Davisb,* a

b

Department of Anatomy and Neurobiology, University of Kentucky, Lexington, KY 40536, USA Division of Gastroenterology, Hepatology and Nutrition, Department of Medicine, University of Pittsburgh, Scaife Hall, Room S-843, 3550 Terrace Street, Pittsburgh, PA 15261, USA c Department of Pharmaceutics, Pharmacology, and Neuroscience, University of Minnesota, Minneapolis, MN 55455, USA Received 3 June 2003; received in revised form 18 September 2003; accepted 24 September 2003

Abstract At least two classes of nociceptors can be distinguished based on their growth factor requirements: glial cell-line derived neurotrophic factor (GDNF)- and nerve growth factor (NGF)-dependent primary afferent neurons. Based on numerous anatomical and biochemical differences, GDNF- and NGF-dependent neurons have been proposed to be involved in the development of different types of persistent pain. To examine this hypothesis we used two lines of transgenic mice that contained a supernormal number of either NGF- or GDNF-dependent neurons (referred to as NGF-OE and GDNF-OE mice, respectively). These mice were tested in a model of inflammatory pain (induced by injection of complete Freund’s adjuvant) and neuropathic pain (using a spinal nerve ligation protocol). Contrary to expectations, neither line of transgenic mice became more hyperalgesic following induction of persistent pain. In fact, NGF-OE mice recovered more rapidly and became hypoalgesic despite extensive paw swelling in the inflammatory pain model. In the neuropathic pain model, only wildtype mice became hyperalgesic. Real-time PCR analysis showed that the NGF-OE and GDNF-OE mice exhibited changes in neuronal-specific mRNAs in the dorsal root ganglia but not the spinal cord dorsal horn. These results indicate that increasing the number of nociceptors results in potent compensatory mechanisms that may begin with changes in the sensory neurons themselves. q 2003 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. Keywords: Nerve growth factor; Nociceptors; Inflammatory and neuropathic pain; Transcriptional analysis

1. Introduction One of the central tenets of somatosensory biology is that primary afferent neurons projecting into the superficial layers of the dorsal horn (lamina I and II) serve predominately nociceptive functions. Immunohistochemical labeling has been used to show that these neurons can be divided into those afferents that require nerve growth factor (NGF) during development (referred to as NGFdependent) and those that initially require NGF but at some point prior to birth become glial cell-line derived neurotrophic factor (GDNF)-dependent (referred to * Corresponding author. Tel.: þ 1-412-648-9745; fax: þ1-412-648-9731. E-mail address: [email protected] (B.M. Davis). 1 Both authors contributed equally to this report.

hereafter as GDNF-dependent neurons) (Baudet et al., 2000; Gavazzi et al., 1999; Molliver et al., 1997). These two populations can be differentiated based on their neurochemistry and, though some overlap occurs, on their projection patterns in the superficial dorsal horn (Bennett et al., 1998; Molliver et al., 1997; Zwick et al., 2002). These observations and others led Snider and McMahon (1998) to hypothesize that inflammatory pain may be the purview of NGF-dependent neurons whereas GDNFdependent neurons are responsible for development and transmission of neuropathic pain. For NGF-dependent nociceptors, this broad generalization is based on the established role of NGF in inflammatory pain (McMahon et al., 1995; Woolf, 1996; Woolf et al., 1994). In the periphery, the levels of NGF are often elevated following inflammation or injury (Heumann et al., 1987; Weskamp

0304-3959/$20.00 q 2003 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.pain.2003.09.016

492

M. Zwick et al. / Pain 106 (2003) 491–500

and Otten, 1987). The increase in NGF is also accompanied by increases in other inflammatory mediators such as bradykinin, prostaglandin, serotonin, ATP and protons (Beck and Handwerker, 1974; Bevan and Geppetti, 1994; Schaible and Schmidt, 1988; Thayer et al., 1988). The role of GDNF in neuropathic pain conditions is not as well documented. GDNF-dependent neurons primarily project to lamina II and express binding for the isolectin IB4 (Bradbury et al., 1998; Molliver et al., 1997; Vulchanova et al., 1998). A specific link between GDNF-dependent neurons and neuropathic pain has been inferred from studies of protein kinase C gamma (PKCg) knockout mice. These mice exhibited significant resistance to induction of neuropathic pain (Malmberg et al., 1997). PKCg is known to be selectively expressed in dorsal horn interneurons that are located in the region in which IB4-positive projections predominate. In the present study, we attempted to examine the hypothesis of Snider and McMahon (1998) by using two lines of transgenic mice that have supernormal numbers of NGF- or GDNF-dependent neurons (referred to as NGF-OE and GDNF-OE, respectively). We predicted that the NGF-OE mice would exhibit increased levels of inflammatory pain (relative to wildtype mice) whereas the GDNF-OE mice would exhibit a heightened response to induction of neuropathic pain. Unexpectedly, the response of both mouse lines was virtually opposite to our expectations. Transcriptional analysis of dorsal horn and spinal cord was performed with the expectation that changes would be identified that would point to potential compensatory mechanisms. Surprisingly, the only detectable changes were within primary afferents themselves and not in the dorsal horn, where previous investigations had found pain-related changes in gene transcription (Delander et al., 1997; Garry et al., 2003; Ji et al., 2002; McCarson and Krause, 1994; Ohtori et al., 2002).

2. Methods 2.1. Animals GDNF-OE and NGF-OE mice were obtained through breeding performed at the University of Kentucky Animal Facility and at the University of Pittsburgh Animal Facility. All animals were maintained on a C3H £ BL6 background. Both male and female mice between 2 and 6 months of age were used and wildtype littermates served as control animals. All mice were housed in group cages, maintained on a 12:12 h light –dark cycle in a temperature controlled environment (20.5 8C) and given food and water ad libitum. These studies were carried out in accordance with the guidelines of the Institutional Animal Care and Use Committee at the University of Kentucky and the University of Pittsburgh and the NIH Guide for the Care and Use of Laboratory Animals.

2.2. Complete Freund’s adjuvant-induced inflammation An emulsion of complete Freund’s adjuvant (CFA) was prepared by thoroughly mixing equal volumes of CFA (heat killed and dried Mycobacterium tuberculosis in paraffin oil and mannide monooleate; Sigma, St Louis, MO) with sterile saline. Ten mice received a subcutaneous injection of the CFA emulsion (20 ml) in the plantar surface of the left hindpaw (Honore et al., 2000). Animals were tested using a plantar analgesia meter (Hargreaves’ device) once a day, 6 days prior to CFA injection, then every other day for 2 weeks (days 1, 3, 5, 7, 9, 11, 13, 15) and again at 3 weeks post-CFA injection (day 22) and finally at 4 weeks postinjection (day 29). To determine the extent of edema, the diameter of the hindpaw was measured using a caliper square prior to injection and each day after behavioral testing. Data were analyzed using repeated measures analysis of variance (ANOVA), followed by a Bonferroni/ Dunn post-hoc test, with significance set at P , 0:0167; or ANOVA, followed by a Bonferroni/Dunn post-hoc test, with significance set at P # 0:05: 2.3. Spinal nerve ligation All surgeries were done under aseptic conditions (all instruments and disposables that came into contact with the mice were sterile). Mice were placed in an enclosed chamber for initial anesthetization by isofluorane in O2 (3.5% for induction) and fitted into a facemask to receive isofluorane (1.7% for maintenance) throughout the procedure. The animal was closely shaved on the left side and betadine was applied prior to the incision. A midline incision was made at lumbar level 4 to sacral level 2 (L4 – S2) and a mini-Goldstein retractor (Fine Science Tools, Foster City, CA) was inserted into the incision and opened, providing an area in which to work. The left paraspinal muscle and the L6 transverse process were removed. Once identified, the L5 spinal nerve was tightly ligated with 6.0 silk sutures distal to the dorsal root ganglion and proximal to the L4 – L5 spinal nerve confluence. The muscle was then sutured and the wound was closed with microclips (Roboz, Gaithersburg, MD). The animals were allowed to recover and returned to the animal care facility. A group of shamoperated mice ðn ¼ 6Þ underwent the same surgical procedures excluding the ligation of the L5 spinal nerve (Fairbanks et al., 2000a,b; Kim and Chung, 1992; Mogil et al., 1999). The animals were randomly divided into two groups and behavioral testing began 1 day post-operation. Following surgery, the animals were tested using the Hargreaves’ test of thermal nociception. Testing was performed once a day on both left and right paws, 3 days prior to surgery to establish a baseline response and every other day following surgery for 2 weeks (days 1, 3, 5, 7, 9, 11, 15) and once at 3 weeks (day 22) and finally at 4 weeks (day 29). Data were analyzed using a repeated measures

M. Zwick et al. / Pain 106 (2003) 491–500

ANOVA followed by a Bonferroni/Dunn post-hoc test, with significance set at 0.0167. 2.4. Hargreaves’ test of thermal nociception Each mouse was placed in an individual chamber (10.0 cm in length £ 10.0 cm in width £ 13.0 cm in height) of a 16 chamber Plexiglas device placed on top of a 6.0 mm thick glass surface (IITC Inc., Woodland Hills, CA). Mice were acclimated at least 1 h prior to testing. A radiant heat light source (setting ¼ 25) was applied to the plantar surface of the mid-hindpaw of an inactive mouse and the latency to withdraw was measured to the nearest 0.1 s. The left and right hindpaw was tested on each mouse once a day for 3 consecutive days. Data were analyzed using an unpaired t-test, with significance set at P # 0:05: 2.5. Statistical analysis for behavioral studies Data are expressed as the mean ^ standard error of the mean. Parametric and non-parametric statistical tests were performed when appropriate after fulfillment of all necessary pre-requisites using the StatView software package (Abacus Concepts, Berkeley, CA). 2.6. Real-time PCR analysis of RNA 2.6.1. RNA extraction Six adult male mice (non-inflammed or ligated) of each genotype (wildtype, GDNF-OE and NGF-OE) were anesthetized with inhaled isoflurane followed by a cocktail of 20 mg/ml ketamine, 2 mg/ml xylazine in saline, 0.05 ml/g, then killed by transcardial perfusion with approximately 75 ml ice-cold isotonic saline. L4 and L5 dorsal root ganglia were dissected bilaterally and collected on dry ice. The L4 and L5 spinal cord segments were identified (based on the level of dorsal root entry), bisected with iridectomy scissors at the level of central canal and the dorsal portion collected on dry ice. DRGs and spinal cord tissue from each animal were processed separately (i.e. tissues from each animal equal an n of 1). To isolate RNA, frozen tissue samples were placed in 1 ml Trizol reagent (Invitrogen, Carlsbad, CA), homogenized, extracted in chloroform and separated in phase lock gel tubes (Eppendorf, Hamburg, Germany). RNA was precipitated in isopropanol at 2 20 8C for 1 h then on dry ice for 1 h, then washed with 75% EtOH and resuspended in water. RNA quality was determined using an Agilent (Palo Alto, CA) 2100 Bioanalyzer according to the manufacturer’s instructions, and quantity was determined using the 260 nm absorbance recorded by a spectrophotometer. Extracted RNA was treated with DNase (1 ml DNase (Invitrogen), 2 ml 10 £ DNase buffer, 0.25 ml RNasin/5 mg RNA in H2O, 20 ml total/reaction) to remove genomic DNA. RNA was then reverse-transcribed using the Invitrogen Superscript II reverse transcription kit according to the

493

manufacturer’s instructions. Negative control reactions were run without RNA to test for contamination of reagents. To ensure complete DNase digestion of each RT reaction, realtime PCR runs were done in which the Superscript II was omitted, but GAPDH primers were included. The appearance of any product would indicate incomplete DNA digestion. This test indicated that all DNA digestions were complete. 2.6.2. Real-time PCR PCR primers were generated using Primer Express software (Applied Biosystems, Foster City, CA) using parameters optimized by the manufacturer. SYBR Green PCR amplification was performed using an Applied Biosystems 5700 real-time thermal cycler controlled by a Dell Latitude laptop computer running ABI Prism 7000 SDS software. Twenty nanograms of cDNA template were added to 50 ml reaction mixtures based on the SYBR Green reagent kit (Applied Biosystems): 1 £ SYBR Green PCR buffer, 2 mM MgCl2, 200 mM dNTPs, 1.25 U Amplitaq Gold, 0.5 U AmpErase UNG (uracil-N-glycosylase), 250 nM primers. The amplification protocol included 2 min at 50 8C to activate the AmpErase UNG to prevent the reamplification of any carryover PCR products, 12 min at 95 8C to activate the Amplitaq polymerase, then 40 cycles of 15 s at 95 8C for denaturation and 1 min at 60 8C for annealing and extension (a separate extension step was unnecessary due to the short length of the amplicon). After amplification, a dissociation curve was plotted against melting temperature to ensure amplification of a single product and to test for primer dimers. All samples were run in triplicate. For controls, no-template controls were run in which water replaced template (to further test for primer dimers). The primers used are shown in Table 1. 2.6.3. Analysis The thermal cycler measures the relative fluorescence of SYBR Green bound to double-stranded DNA compared to a passive reference for each cycle. Threshold cycle (Ct) values, the cycle number in which SYBR Green fluorescence rises above background, are recorded as a measure of initial template concentration. Relative fold changes in RNA levels were calculated by the ddCt method (Livak and Schmittgen, 2001) using p53-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference standard: Ct values from triplicate samples were averaged and subtracted from the reference standard, yielding dCt. The difference between the dCt of the experimental and control groups was then calculated (ddCt). The relative fold change was determined as 22ddCt. Statistical significance was determined by ANOVA using the Statview software package.

3. Results Prior to testing for statistical differences it was determined that all behavioral data were normally

494

M. Zwick et al. / Pain 106 (2003) 491–500

Table 1 Primers used for real-time PCR analysis Gene

Forward primer

Reverse primer

DREAM DOR1 KOR1 MOR1 NR1 NR2 MGluR1 Nav 1.8 Nav 1.3 GADPH TRPV1 TRPV2

GCTCAGACCAAGTTCACCAAGAAG GGAAGCAGAGCTGGTGATTCCT CTTCCAGTCTTGGAAGGCACAA CGAACACTCTTGAGTGCTCTCA TTTACTGCCTCGCGGAACAT CCTGTACGGCAAGTTCTCTTTC GTGACCTATGCCTCTGTCATTC GCCACCCAGTTCATTGCCTTTTC GATCAACGAGGACTGCAAGCT ATGTGTCCGTCGTGGATCTGA TTCCTGCAGAAGAGCAAGAAGC CCAGCCATTCCCTCATCAAA

CAAAGTCCTCAAAGTGGATGGC TCCTGGTTCCTGGAGCTGGAAT CAAGTCACCGTCAGCTTTCCAA GCTGTCCATGGTTCTGAATGCTT CATGCACCTGCTGACATTCG CGATGTTGCCATAGGTGACAGT ATCTCTGGCTTCTCCACGCATA TCCCCAGATTCTCCCAAGACATTC CACGCGGAACACTATCAGGAA ATGCCTGCTTCACCACCTTCTT CCCATTGTGCAGATTGAGCAT AAGTACCACAGCTGGCCCAGTA

DREAM, downstream regulatory element antagonistic modulator; DOR1, delta opioid receptor; KOR1, kappa opioid receptor; MOR1, mu opioid receptor; NR1, NMDA receptor subunit NR1; NR2, NMDA receptor subunit NR2; MGluR1, metabotropic glutamate receptor 1; Nav 1.8, tetrodotoxin resistant sodium channel (Nav 1.8/PN3); Nav 1.3, embryonic sodium channel type III; GADPH, glyceraldehyde-3-phosphate dehydrogenase; TRPV1, transient receptor potential channel, vanilloid subfamily 1; TRPV2, transient receptor potential channel, vanilloid subfamily 2.

distributed (data not shown; Kolmogorov – Smirnov). It was also determined that responses of control right and left paws to testing were not different from each other (data not shown; t-test) in each set of experiments; therefore, only the left paw was analyzed. 3.1. Inflammatory pain Prior to the induction of inflammatory pain, mice were exposed to several days of pre-testing to determine an

accurate baseline for each genotype. Interestingly, the NGFOE mice had slightly longer latencies (i.e. they were hypoalgesic) when compared to wildtype mice (Fig. 1, P , 0:01; ANOVA, Bonferroni/Dunn). GDNF-OE mice were not different from wildtype mice. Following CFA injection, wildtype and NGF-OE mice began to display decreased response times 1 day post-injection (Fig. 1b –d). On day 3, all three genotypes displayed hyperalgesic behavior when compared to their respective baselines. This was similar to previous mouse studies that reported that

Fig. 1. CFA injections did not induce more hyperalgesia in NGF-OE and GDNF-OE mice than in wildtype mice. (a) Comparison of all three genotypes. (b) Wildtype, (c) NGF-OE and (d) GDNF-OE mice were injected with CFA and tested for 1 month. Each mouse line exhibited significant hyperalgesia within 3 days of injections. NGF-OE mice recovered first (by day 5), followed by GDNF-OE mice on day 7. Wildtype mice did not exhibit pre-CFA latencies until day 9. NGF-OE mice also exhibited hypoalgesia on days 15 and 22 (relative to their pre-CFA baseline). – B–, wildype mice; –W–, NGF-OE mice; – V–, GDNFOE mice; BL, baseline value.

M. Zwick et al. / Pain 106 (2003) 491–500

peak hyperalgesia occurs 3 days post-injection (Fairbanks et al., 2000b). All animals began to recover following the peak hyperalgesia that occurred on day 3. By day 9, the wildtype mice had returned to normal (Fig. 1b). The response latencies of GDNF-OE mice returned to baseline by day 7, one timepoint earlier than the wildtype mice (Fig. 1c). The NGF-OE mice recovered first, no longer displaying hyperalgesic behavior by day 5 (Fig. 1c). The NGF-OE mice not only recovered faster than the other genotypes, but became hypoalgesic between days 15 and 22 when compared to their own baseline values. The response latencies for the three genotypes are directly compared in Fig. 2. This analysis shows that GDNF-OE mice were never significantly different from wildtype mice during the entire time-course of the experiment. In contrast, the response latencies of NGF-OE mice were significantly greater than wildtype mice prior to the CFA injection (i.e. naı¨ve NGFOE mice were hypoalgesic) and were also greater when tested on days 5, 7, 15 and 22. These data demonstrate that the increased number of nociceptors in either line of transgenic mice (Stucky et al., 1999; Zwick et al., 2002) did not translate into a hyperalgesic phenotype in the naı¨ve or inflamed state. Peripheral edema in the hindpaw occurred following CFA injection and coincided with the induction of hyperalgesia (Fig. 3). Maximal swelling occurred on day 1 in all genotypes. The maximum paw diameter increase was 49%

495

Fig. 3. Swelling induced by CFA was similar in all three genotypes. Within 24 h after CFA injections, all three genotypes exhibited significant swelling. Wildtype mice returned to normal by day 22, whereas NGF-OE and GDNF-OE mice were still significantly swollen at day 29. * P , 0:05 for all three genotypes; # P , 0:05 for GDNF-OE and NGF-OE mice.

in wildtype, 51% in NGF-OE and 64% in GDNF-OE mice. Paws of wildtype mice remained significantly swollen until day 23, when they returned to baseline. NGF-OE and GDNFOE paw diameters remained elevated and did not return to normal by day 29 (P , 0:05; repeated measures ANOVA, Bonferroni/Dunn). It is interesting to note that behaviorally all three genotypes returned to normal within the first week post-injection, although the effect of the initial insult was ongoing as indicated by significant persistent swelling. This suggests that behaviorally, compensatory mechanisms were active long before the effects of the triggering event (e.g. the inflammation and swelling) were resolved. 3.2. Neuropathic pain

Fig. 2. Direct comparisons of the three mouse genotypes during CFA experiment. NGF-OE mice were significantly different from wildtype mice prior to and during CFA testing ð* P , 0:05Þ: In addition to recovering more quickly (Fig. 1) NGF-OE mice exhibited longer latencies prior to CFA injections (i.e. at baseline (BL)) and again on days 5, 7, 15 and 22. In contrast, GDNF-OE mice were never significantly different from wildtype mice.

A sham surgery was performed on all three genotypes to eliminate the possibility that the procedure used to expose the L5 nerve induced behavioral changes. Testing revealed that exposure of the L5 nerve without ligation did not induce hyperalgesia in any of the three genotypes (repeated measures ANOVA, data not shown). It has been demonstrated that peak hyperalgesia following spinal nerve ligation occurs approximately on day 15 in mouse (Fairbanks et al., 2000b). In the present experiments, spinal nerve ligation produced hyperalgesia only in wildtype mice (Fig. 4b). Significant hyperalgesia was seen on day 3 and continued until day 15 (P , 0:01; repeated measures ANOVA, Bonferroni/Dunn). The NGF-OE and GDNF-OE mice never demonstrated significantly decreased latencies following spinal nerve ligation (Fig. 4c and d). The GDNF-OE mice appeared to be remarkably unaffected as the post-surgery latencies never fluctuated more than 22% in either direction from the pre-surgical baseline. This is in sharp contrast to the NGF-OE mice, whose overall pattern of latency changes was quite similar to that seen in these mice following CFA injection, with a trend towards a hyperalgesic state on day 5 and a hypoalgesic state on day 11. Compared to WT mice, NGF-OEs are hypoalgesic on days 11, 15, and 22 (P , 0:05; ANOVA, Bonnferroni/

496

M. Zwick et al. / Pain 106 (2003) 491–500

Fig. 4. Spinal nerve ligation induced hyperalgesia in wildtype, but not in NGF-OE or GDNF-OE mice. (a) Comparison of all three genotypes. (b) Wildtype, (c) NGF-OE and (d) GDNF-OE mice had the L5 spinal nerve ligated followed by testing for 1 month. Only wildtype mice exhibited significant hyperalgesia, although the response of NGF-OE mice appeared similar to that seen following CFA injections without reaching statistical significance. GDNF-OE mice appeared to be unaffected by spinal nerve ligation. –B–, wildype mice; –W– , NGF-OE mice; –V– , GDNF-OE mice; BL, baseline value.

Dunn). However, because of between-animal variability, these changes did not reach statistical significance (i.e. when control NGF-OEs are compared to operated NGF-OEs). 3.3. Changes in gene expression in NGF-OE and GDNF-OE mice Previous analysis of the NGF-OE mice documented an increase in the number, size and responsiveness of the nociceptor population (Albers et al., 1994; Davis et al., 1997; Stucky et al., 1999). Analysis of the GDNF-OE mice indicates that they have significantly more IB4positive neurons, that these putative nociceptors have increased projections to skin and that this is correlated with increased diameter of unmyelinated fibers (Zwick et al., 2002). Therefore, the lack of an increase in behavioral hyperalgesia revealed in the above studies was unexpected, but suggested that compensatory mechanisms developed in the transgenic mouse lines in response to the anatomical and physiological changes. As an initial exploration of possible naturally occurring analgesic mechanisms, we examined the dorsal horn and lumbar sensory ganglia for changes in mRNA expression in naı¨ve mice. The rationale for examining naı¨ve mice was that since our baseline measurements did not indicate a hyperalgesic state in either transgenic line (and in fact indicated a hypoalgesic state for the NGF-OE mice) that compensatory changes must have been in place prior to induction of inflammatory or neuropathic pain. Previous

studies have found long lasting changes in neuronspecific mRNA and protein associated with both hyperalgesic states and recovery from persistent pain states (Ji and Woolf, 2001). Therefore, real-time PCR was used as this allowed us to obtain quantitative measurements on several pain-related gene products from individual animals. Data for nine mRNA species are presented below: three opiate receptors (mu (MOR1), delta (DOR1) and kappa (KOR1)), the NMDA receptor subunits NR1 and NR2b, the metabotrobic glutamate receptor mGluR1, the transcription factor DREAM (downstream regulatory Table 2 Change in mRNA in mouse dorsal horn mRNA

WT vs. NGF-OE (fold change)

WT vs. GDNF-OE (fold change)

MOR1 DOR1 KOR1 NR1 NR2 mGluR1 DREAM TRPV1 TRPV2

1.0 1.0 þ 1.3 21.1 þ 1.3 þ 1.1 þ 1.1 ND þ 1.1

þ 1.2 þ 1.2 þ 1.1 1.0 þ 1.3 þ 1.1 þ 1.1 ND þ 1.4

All values are reported as fold changes relative to wildtype (WT) measurements. A value of ‘1’ indicates no change. Negative values indicate a decrease. None of the observed changes were statistically significant. ND, not detected.

M. Zwick et al. / Pain 106 (2003) 491–500 Table 3 Change in mRNA in mouse L4 –L5 dorsal root ganglia mRNA

WT vs. NGF-OE (fold change)

WT vs. GDNF-OE (fold change)

MOR1 DOR1 KOR1 NR1 NR2 mGluR1 Nav 1.8 Nav 1.3 TRPV1 TRPV2

þ 3.2* 21.6* þ 1.5* 21.8* 21.8* þ 3.1* þ 2.6 21.4* 1.0 þ 1.1

21.1 21.5* þ 2.1* 1.0 1.0 þ 3.7* þ 2.1 þ 1.1 21.1 þ 1.4*

All values are reported as fold changes relative to wildtype (WT) measurements. Fold changes equaling 1 indicate no change. Negative values indicate a decrease. * P , 0:05:

element antagonistic modulator; only examined in dorsal horn), and the Nav 1.3 and 1.8 sodium channels (only examined in DRG). Table 2 shows the results for dorsal horn samples from six male mice. No significant change for any of these genes was found in either transgenic line when compared to wildtype mice. We next examined sensory ganglia (Table 3). In the combined L4/L5 dorsal root ganglia significant changes were seen for all of the gene products that could be detected. Accurate interpretation of these data must take into account changes in the make-up of the dorsal root ganglia in the transgenic mice. Both lines of transgenic mice exhibit increases in the number of sensory neurons. In the GDNF-OE mice this difference is modest (27% increase in the total number of cells) and only one population of neurons exhibits a significant change in percentage (IB4 neurons are increased from 32.5 to 48.9%; Zwick et al., 2002). NGF-OE mice exhibit greater changes: they possess twice the number of neurons seen in wildtype mice, with a specific effect on the percentage of the CGRP/trkA population (which increases from 20.6 to 50.9%; Goodness et al., 1997). Thus, a 1.5-fold increase in KOR1 in NGF-OE may reflect an increase in the population of primary afferents that express this receptor. However, an increase in cell number cannot explain the large increases in mRNA content seen for KOR1 and mGluR1 in the GDNF-OE mice. Moreover, the decreases seen in DOR, NR1 and NR2 in the NGF-OE mice become even more significant since these are observed in ganglia that contain more of the cells that express these mRNA species (see Section 4).

4. Discussion 4.1. Using transgenic mice for functional studies The present series of experiments employed two lines of transgenic mice in which the sensory nervous system was

497

hypertrophied: NGF-OE mice have twice the number of peptidergic nociceptors and physiological recordings show that NGF-OE C-fibers are four times more sensitive to noxious heat stimulation (Stucky et al., 1999). In the GDNFOE mice, the number of IB4-positive (i.e. non-peptidergic) neurons is increased and the peripheral projections of these neurons are hypertrophied (Zwick et al., 2002). Thus, the observation that prior to inflammation or nerve ligation both lines of mice either exhibited normal behavioral responses to noxious heat (as in the GDNF mice) or were hypoalgesic (as in the NGF-OE) was not anticipated. Further, NGF-OE mice recovered more quickly following induction of hyperalgesia in the CFA model and the GDNF-OE mice exhibited no hyperalgesia in the spinal nerve ligation model. These results indicate that the increased number of nociceptors did not translate into a hyperalgesic phenotype thus reminding us of the plasticity of the somatosensory system and the unpredictability of genetically altered pain models. 4.2. Compensatory changes in response to increased nociceptor input No attempt will be made here to review the extensive literature on anatomical and biochemical changes in the somatosensory system associated with persistent pain. Changes in sensory neurons, dorsal horn and descending systems have all been implicated. Surprisingly, in this study, no significant changes were observed in the L4 –L5 dorsal horn though significant changes occurred in the dorsal root ganglia. For example, the opiate receptors, which have been localized to putative nociceptors (Coggeshall et al., 1997; Maekawa et al., 1994; Mansour et al., 1994; Minami et al., 1995; Wang and Wessendorf, 2001), were differentially regulated. Both transgenic lines exhibited a decrease in DOR1 and an increase in KOR1. The NGF-OE mice also exhibited an increase in MOR1. This increase likely exceeds what could be accounted for by the increase in the number of nociceptive neurons since in rat, only 30% of all putative nociceptors express MOR1 (similar data are not available for mice). One obvious explanation for the increase in MOR1 and KOR1 expression is that they counteract the increased nociceptor activity by decreasing transmitter release in the dorsal horn. Silbert et al. (2003) using single cell PCR found a direct correlation between the level of MOR mRNA and inhibition of Ca2þ current in response to the opioid agonist DAMGO. DOR was decreased in both transgenic lines as well, suggesting co-regulation of opiate receptors. Co-regulation has also been reported in studies of rat (Ji et al., 1995) where inflammation induced by carrageenan produced an increase in the number of MOR1 immunoreactive sensory neurons and a decrease in the number of DOR1- and KOR1-positive neurons. A second reasonable prediction from these studies is that the lack of change in withdrawal latencies in response to radiant heat was due to changes in the expression of two genes thought to detect noxious heat, TRPV1 and TRPV2

498

M. Zwick et al. / Pain 106 (2003) 491–500

(Caterina et al., 1999, 2000; Davis et al., 2000). However, no change in TRPV1 was detected in either transgenic line. TRPV2 was slightly, but significantly increased in the GDNF-OE mice and this could be related to changes in neuronal populations in these mice. The decrease in NR1 and NR2 in the NGF-OE mice suggests a compensatory mechanism that could act to decrease the release of transmitter. In most studies, NR1 expression (both mRNA and protein) has been found in the majority of primary afferents (Marvizon et al., 2002; Sato et al., 1993; Wang et al., 1999, but see Lu et al., 2003) whereas NR2 subunits are more restricted to small diameter afferents (Marvizon et al., 2002). It has been proposed that the NMDA receptor acts pre-synaptically to enhance transmitter release from primary afferents (Liu et al., 1994, 1997; Parada et al., 2003). If so, the decrease in NR1 and NR2 expression in the present studies could be a mechanism to suppress transmission. Interestingly, Wang et al. (1999) found a down-regulation of NR1 immunostaining in rat DRG following CFA injection. MGluR1 mRNA was increased in both lines of transgenic mice. This G protein-coupled receptor has been localized to the peripheral processes of primary afferents and primary afferent somata (Bhave et al., 2001; Tang and Sim, 1999; Zhou et al., 2001). Stimulation of these receptors increases primary afferent sensitivity (Bhave et al., 2001) in inflammatory and neuropathic pain models (Bhave et al., 2001; Dolan and Nolan, 2002; Yashpal et al., 2001; Zhou et al., 2001). Thus, the increase in mGluR1 is unlikely to represent a compensatory mechanism and may reflect the ability of NGF and GDNF to regulate expression of receptors on primary afferents. The expression of two sodium channels (Nav 1.8 and 1.3) was also examined because these channels appear to be regulated by NGF and GDNF (Black et al., 1997; Dib-Hajj et al., 1998; Fjell et al., 1999a,b; Okuse et al., 1997). Sensory neurons in culture exhibit an increase in Nav 1.3 and a decrease in Nav 1.8 that is reversed by addition of NGF (Black et al., 1997). Similarly, addition of GDNF not only restores the level of Nav 1.8 mRNA, but also Nav 1.9 (Fjell et al., 1999b). Boucher et al. (2000) reported that hyperalgesia induced by sciatic nerve or spinal nerve ligation could be reversed by intrathecal GDNF. In our studies, both NGF and GDNF overexpression produced a trend (P ¼ 0:074 and 0.053, respectively) towards increased levels of Nav 1.8 whereas overexpression of NGF produced a small but significant decrease in the level of Nav 1.3. Combined, these results support the concept that NGF and GDNF are important for maintaining the normal expression of Nav 1.8 and suppressing expression of Nav 1.3. 4.3. Do neuropathic and inflammatory pain employ different types of afferent neurons? Following injection of CFA, NGF-OE mice recovered faster than either the GDNF or WT mice. One possible

explanation for this recovery is that NGF-OE mice were resistant to the sequelae of events that result from injection of inflammatory substances due to their prior exposure to high levels of transgenic NGF. In contrast, GDNF-OE mice responded more like WT mice. The difference in the response of the two transgenic mouse lines to CFA may reflect changes in the composition of the afferent population resulting from developmental effects of altered growth factor level as well as increased growth factor in the adult. Regardless, the fact that inflammatory hyperalgesia was dramatically altered in NGF-OE, but not GDNF-OE mice, suggests that persistent pain generated by CFA preferentially involves NGF-responsive afferents. In the spinal nerve ligation model, the response of NGF-OE mice was similar to the response following CFA, although they did not reach statistical significance. This may reflect the complex nature of the injury, which includes both neurogenic and immunogenic components (Clatworthy et al., 1995; Cui et al., 2000; Daemen et al., 1998; Okamoto et al., 2001; Tal, 1999; Tracey and Walker, 1995). The behavioral response of the NGF-OE mice to ligation may therefore be largely due to the inflammatory component of nerve injury. In contrast, GDNF-OE mice clearly exhibited no hyperalgesia. Unlike NGF, exposure to supernormal levels of GDNF does not mimic any known persistent pain state. Therefore, the resistance to neuropathic pain in GDNF-OE mice is probably not due to compensation resulting from prior experience with a pain-inducing substance. In addition, intrathecal application of GDNF can prevent injury-induced hyperalgesia (Bennett et al., 1998; Boucher et al., 2000; Fang et al., 2003; Leffler et al., 2002). Since GDNF-OE mice contain a 2-fold increase in spinal cord levels of GDNF (Zwick et al., 2002), the results obtained in this study are consistent with the concept that GDNF protects against changes associated with nerve injury. The proposed site of action for GDNF is on GDNF-dependent primary afferents that express the Ret and GFRa1 receptors whereas the dorsal horn, another potential target, does not (Golden et al., 1998; Hoke et al., 2000; Josephson et al., 2001; Widenfalk et al., 1999). In terms of the original hypothesis, these results support the concept that neuropathic pain as modeled by spinal nerve ligation can be blocked by GDNF that appears to act selectively on GDNF-dependent afferents. In conclusion, these studies demonstrate the capacity of the somatosensory system to produce normal behaviors despite significant modification of the anatomical components that are the substrate of nociception. The transcriptional analysis conducted here suggests that sensory neurons themselves have built-in mechanisms for adjusting to changes in afferent populations and sensitivity of individual afferents. The results support a growing body of literature indicating that different types of persistent pain are mediated by populations of nociceptors that can be

M. Zwick et al. / Pain 106 (2003) 491–500

differentiated, at least in part, by their growth factor sensitivity.

Acknowledgements This work was supported by National Institute of Health grants NS31826 (BMD) and NS33730 to KMA. We thank Mr James Simpson and Mr John Burkett for their excellent technical assistance and Mr Patrick Crumrine (University of Kentucky) for his statistical expertise.

References Albers KM, Wright DE, Davis BM. Overexpression of nerve growth factor in epidermis of transgenic mice causes hypertrophy of the peripheral nervous system. J Neurosci 1994;14:1422–32. Baudet C, Mikaels A, Westphal H, Johansen J, Johansen TE, Ernfors P. Positive and negative interactions of GDNF, NTN and ART in developing sensory neuron subpopulations, and their collaboration with neurotrophins. Development 2000;127:4335–44. Beck PW, Handwerker HO. Bradykinin and serotonin effects on various types of cutaneous nerve fibers. Pflugers Arch 1974;347:209 –22. Bennett DL, Michael GJ, Ramachandran N, Munson JB, Averill S, Yan Q, McMahon SB, Priestley JV. A distinct subgroup of small DRG cells express GDNF receptor components and GDNF is protective for these neurons after nerve injury. J Neurosci 1998;18:3059–72. Bevan S, Geppetti P. Protons: small stimulants of capsaicin-sensitive sensory nerves. Trends Neurosci 1994;17:509–12. Bhave G, Karim F, Carlton SM, Gereau RWt. Peripheral group I metabotropic glutamate receptors modulate nociception in mice. Nat Neurosci 2001;4:417– 23. Black JA, Langworthy K, Hinson AW, Dib-Hajj SD, Waxman SG. NGF has opposing effects on Naþ channel III and SNS gene expression in spinal sensory neurons. NeuroReport 1997;8:2331–5. Boucher TJ, Okuse K, Bennett DL, Munson JB, Wood JN, McMahon SB. Potent analgesic effects of GDNF in neuropathic pain states. Science 2000;290:124 –7. Bradbury EJ, Burnstock G, McMahon SB. The expression of P2X3 purinoreceptors in sensory neurons: effects of axotomy and glialderived neurotrophic factor. Mol Cell Neurosci 1998;12:256–68. Caterina MJ, Rosen TA, Tominaga M, Brake AJ, Julius D. A capsaicinreceptor homologue with a high threshold for noxious heat. Nature 1999;398:436 –41. Caterina MJ, Leffler A, Malmberg AB, Martin WJ, Trafton J, PetersenZeitz KR, Koltzenburg M, Basbaum AI, Julius D. Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 2000; 288:306–13. Clatworthy AL, Illich PA, Castro GA, Walters ET. Role of peri-axonal inflammation in the development of thermal hyperalgesia and guarding behavior in a rat model of neuropathic pain. Neurosci Lett 1995;184: 5–8. Coggeshall RE, Zhou S, Carlton SM. Opioid receptors on peripheral sensory axons. Brain Res 1997;764:126–32. Cui JG, Holmin S, Mathiesen T, Meyerson BA, Linderoth B. Possible role of inflammatory mediators in tactile hypersensitivity in rat models of mononeuropathy. Pain 2000;88:239–48. Daemen MA, Kurvers HA, Kitslaar PJ, Slaaf DW, Bullens PH, Van den Wildenberg FA. Neurogenic inflammation in an animal model of neuropathic pain. Neurol Res 1998;20:41–5. Davis BM, Fundin BT, Albers KM, Goodness TP, Cronk KM, Rice FL. Overexpression of nerve growth factor in skin causes preferential

499

increases among innervation to specific sensory targets. J Comp Neurol 1997;387:489–506. Davis JB, Gray J, Gunthorpe MJ, Hatcher JP, Davey PT, Overend P, Harries MH, Latcham J, Clapham C, Atkinson K, Hughes SA, Rance K, Grau E, Harper AJ, Pugh PL, Rogers DC, Bingham S, Randall A, Sheardown SA. Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia. Nature 2000;405:183–7. Delander GE, Schott E, Brodin E, Fredholm BB. Temporal changes in spinal cord expression of mRNA for substance P, dynorphin and enkephalin in a model of chronic pain. Acta Physiol Scand 1997;161: 509– 16. Dib-Hajj SD, Black JA, Cummins TR, Kenney AM, Kocsis JD, Waxman SG. Rescue of alpha-SNS sodium channel expression in small dorsal root ganglion neurons after axotomy by nerve growth factor in vivo. J Neurophysiol 1998;79:2668–76. Dolan S, Nolan AM. Behavioral evidence supporting a differential role for spinal group I and II metabotropic glutamate receptors in inflammatory hyperalgesia in sheep. Neuropharmacology 2002;43:319–26. Fairbanks CA, Nguyen HO, Grocholski BM, Wilcox GL. Moxonidine, a selective imidazoline-alpha2-adrenergic receptor agonist, produces spinal synergistic antihyperalgesia with morphine in nerve-injured mice. Anesthesiology 2000a;93:765–73. Fairbanks CA, Schreiber KL, Brewer KL, Yu CG, Stone LS, Kitto KF, Nguyen HO, Grocholski BM, Shoeman DW, Kehl LJ, Regunathan S, Reis DJ, Yezierski RP, Wilcox GL. Agmatine reverses pain induced by inflammation, neuropathy, and spinal cord injury. Proc Natl Acad Sci USA 2000b;97:10584–9. Fang M, Wang Y, He QH, Sun YX, Deng LB, Wang XM, Han JS. Glial cell line-derived neurotrophic factor contributes to delayed inflammatory hyperalgesia in adjuvant rat pain model. Neuroscience 2003;117: 503– 12. Fjell J, Cummins TR, Davis BM, Albers KM, Fried K, Waxman SG, Black JA. Sodium channel expression in NGF-overexpressing transgenic mice. J Neurosci Res 1999a;57:39–47. Fjell J, Cummins TR, Fried K, Black JA, Waxman SG. In vivo NGF deprivation reduces SNS expression and TTX-R sodium currents in IB4-negative DRG neurons. J Neurophysiol 1999b;81:803–10. Garry EM, Moss A, Delaney A, O’Neill F, Blakemore J, Bowen J, Husi H, Mitchell R, Grant SG, Fleetwood-Walker SM. Neuropathic sensitization of behavioral reflexes and spinal NMDA receptor/CaM kinase II interactions are disrupted in PSD-95 mutant mice. Curr Biol 2003;13: 321– 8. Gavazzi I, Kumar RD, McMahon SB, Cohen J. Growth responses of different subpopulations of adult sensory neurons to neurotrophic factors in vitro. Eur J Neurosci 1999;11:3405 –14. Golden JP, Baloh RH, Kotzbauer PT, Lampe PA, Osborne PA, Milbrandt J, Johnson Jr EM. Expression of neurturin, GDNF, and their receptors in the adult mouse CNS. J Comp Neurol 1998;398:139 –50. Goodness TP, Albers KM, Davis FE, Davis BM. Overexpression of nerve growth factor in skin increases sensory neuron size and modulates Trk receptor expression. Eur J Neurosci 1997;9:1574–85. Heumann R, Korsching S, Bandtlow C, Thoenen H. Changes of nerve growth factor synthesis in nonneuronal cells in response to sciatic nerve transection. J Cell Biol 1987;104:1623–31. Hoke A, Cheng C, Zochodne DW. Expression of glial cell line-derived neurotrophic factor family of growth factors in peripheral nerve injury in rats. NeuroReport 2000;11:1651–4. Honore P, Rogers SD, Schwei MJ, Salak-Johnson JL, Luger NM, Sabino MC, Clohisy DR, Mantyh PW. Murine models of inflammatory, neuropathic and cancer pain each generates a unique set of neurochemical changes in the spinal cord and sensory neurons. Neuroscience 2000;98:585–98. Ji RR, Woolf CJ. Neuronal plasticity and signal transduction in nociceptive neurons: implications for the initiation and maintenance of pathological pain. Neurobiol Dis 2001;8:1–10. Ji RR, Zhang Q, Law PY, Low HH, Elde R, Hokfelt T. Expression of mu-, delta-, and kappa-opioid receptor-like immunoreactivities in rat dorsal

500

M. Zwick et al. / Pain 106 (2003) 491–500

root ganglia after carrageenan-induced inflammation. J Neurosci 1995; 15:8156–66. Ji RR, Befort K, Brenner GJ, Woolf CJ. ERK MAP kinase activation in superficial spinal cord neurons induces prodynorphin and NK-1 upregulation and contributes to persistent inflammatory pain hypersensitivity. J Neurosci 2002;22:478– 85. Josephson A, Widenfalk J, Trifunovski A, Widmer HR, Olson L, Spenger C. GDNF and NGF family members and receptors in human fetal and adult spinal cord and dorsal root ganglia. J Comp Neurol 2001;440:204–17. Kim SH, Chung JM. An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 1992;50: 355– 63. Leffler A, Cummins TR, Dib-Hajj SD, Hormuzdiar WN, Black JA, Waxman SG. GDNF and NGF reverse changes in repriming of TTXsensitive Na(þ) currents following axotomy of dorsal root ganglion neurons. J Neurophysiol 2002;88:650–8. Liu H, Wang H, Sheng M, Jan LY, Jan YN, Basbaum AI. Evidence for presynaptic N-methyl-D -aspartate autoreceptors in the spinal cord dorsal horn. Proc Natl Acad Sci USA 1994;91:8383 –7. Liu H, Mantyh PW, Basbaum AI. NMDA-receptor regulation of substance P release from primary afferent nociceptors. Nature 1997;386:721–4. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402 –8. Lu CR, Hwang SJ, Phend KD, Rustioni A, Valtschanoff JG. Primary afferent terminals that express presynaptic NR1 in rats are mainly from myelinated, mechanosensitive fibers. J Comp Neurol 2003;460: 191– 202. Maekawa K, Minami M, Yabuuchi K, Toya T, Katao Y, Hosoi Y, Onogi T, Satoh M. In situ hybridization study of mu- and kappa-opioid receptor mRNAs in the rat spinal cord and dorsal root ganglia. Neurosci Lett 1994;168:97–100. Malmberg AB, Chen C, Tonegawa S, Basbaum AI. Preserved acute pain and reduced neuropathic pain in mice lacking PKCgamma. Science 1997;278:279–83. Mansour A, Fox CA, Burke S, Meng F, Thompson RC, Akil H, Watson SJ. Mu, delta, and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study. J Comp Neurol 1994;350:412–38. Marvizon JC, McRoberts JA, Ennes HS, Song B, Wang X, Jinton L, Corneliussen B, Mayer EA. Two N-methyl-D -aspartate receptors in rat dorsal root ganglia with different subunit composition and localization. J Comp Neurol 2002;446:325– 41. McCarson KE, Krause JE. NK-1 and NK-3 type tachykinin receptor mRNA expression in the rat spinal cord dorsal horn is increased during adjuvant or formalin-induced nociception. J Neurosci 1994;14:712–20. McMahon SB, Bennett DL, Priestley JV, Shelton DL. The biological effects of endogenous nerve growth factor on adult sensory neurons revealed by a trkA– IgG fusion molecule. Nat Med 1995;1:774–80. Minami M, Maekawa K, Yabuuchi K, Satoh M. Double in situ hybridization study on coexistence of mu-, delta- and kappa-opioid receptor mRNAs with preprotachykinin A mRNA in the rat dorsal root ganglia. Brain Res Mol Brain Res 1995;30:203–10. Mogil JS, Wilson SG, Bon K, Lee SE, Chung K, Raber P, Pieper JO, Hain HS, Belknap JK, Hubert L, Elmer GI, Chung JM, Devor M. Heritability of nociception I: responses of 11 inbred mouse strains on 12 measures of nociception. Pain 1999;80:67–82. Molliver DC, Wright DE, Leitner ML, Parsadanian AS, Doster K, Wen D, Yan Q, Snider WD. IB4-binding DRG neurons switch from NGF to GDNF dependence in early postnatal life. Neuron 1997;19:849 –61. Ohtori S, Takahashi K, Ino H, Chiba T, Yamagata M, Sameda H, Moriya H. Up-regulation of substance P and NMDA receptor mRNA in dorsal horn and preganglionic sympathetic neurons during adjuvant-induced noxious stimulation in rats. Ann Anat 2002;184:71–6. Okamoto K, Martin DP, Schmelzer JD, Mitsui Y, Low PA. Pro- and antiinflammatory cytokine gene expression in rat sciatic nerve chronic constriction injury model of neuropathic pain. Exp Neurol 2001;169: 386– 91.

Okuse K, Chaplan SR, McMahon SB, Luo ZD, Calcutt NA, Scott BP, Akopian AN, Wood JN. Regulation of expression of the sensory neuron-specific sodium channel SNS in inflammatory and neuropathic pain. Mol Cell Neurosci 1997;10:196 –207. Parada CA, Vivancos GG, Tambeli CH, de Queiroz Cunha F, Ferreira SH. Activation of presynaptic NMDA receptors coupled to NaV1.8resistant sodium channel C-fibers causes retrograde mechanical nociceptor sensitization. Proc Natl Acad Sci USA 2003;100:2923–8. Sato K, Kiyama H, Park HT, Tohyama M. AMPA, KA and NMDA receptors are expressed in the rat DRG neurones. NeuroReport 1993;4: 1263–5. Schaible HG, Schmidt RF. Excitation and sensitization of fine articular afferents from cat’s knee joint by prostaglandin E2. J Physiol 1988;403: 91 –104. Silbert SC, Beacham DW, McCleskey EW. Quantitative single-cell differences in mu-opioid receptor mRNA distinguish myelinated and unmyelinated nociceptors. J Neurosci 2003;23:34– 42. Snider WD, McMahon SB. Tackling pain at the source: new ideas about nociceptors. Neuron 1998;20:629–32. Stucky CL, Koltzenburg M, Schneider M, Engle MG, Albers KM, Davis BM. Overexpression of nerve growth factor in skin selectively affects the survival and functional properties of nociceptors. J Neurosci 1999; 19:8509– 16. Tal M. A role for inflammation in chronic pain. Curr Rev Pain 1999;3: 440 –6. Tang FR, Sim MK. Pre- and/or post-synaptic localisation of metabotropic glutamate receptor 1alpha (mGluR1alpha) and 2/3 (mGluR2/3) in the rat spinal cord. Neurosci Res 1999;34:73– 8. Thayer SA, Perney TM, Miller RJ. Regulation of calcium homeostasis in sensory neurons by bradykinin. J Neurosci 1988;8:4089 –97. Tracey DJ, Walker JS. Pain due to nerve damage: are inflammatory mediators involved? Inflamm Res 1995;44:407–11. Vulchanova L, Riedl MS, Shuster SJ, Stone LS, Hargreaves KM, Buell G, Surprenant A, North RA, Elde R. P2X3 is expressed by DRG neurons that terminate in inner lamina II. Eur J Neurosci 1998;10:3470–8. Wang H, Wessendorf MW. Equal proportions of small and large DRG neurons express opioid receptor mRNAs. J Comp Neurol 2001;429: 590 –600. Wang H, Zhang RX, Wang R, Qiao JT. Decreased expression of N-methylD -aspartate (NMDA) receptors in rat dorsal root ganglion following complete Freund’s adjuvant-induced inflammation: an immunocytochemical study for NMDA NR1 subunit. Neurosci Lett 1999;265: 195 –8. Weskamp G, Otten U. An enzyme-linked immunoassay for nerve growth factor (NGF): a tool for studying regulatory mechanisms involved in NGF production in brain and in peripheral tissues. J Neurochem 1987; 48:1779– 86. Widenfalk J, Widmer HR, Spenger C. GDNF, RET and GFRalpha-1-3 mRNA expression in the developing human spinal cord and ganglia. NeuroReport 1999;10:1433– 9. Woolf CJ. Phenotypic modification of primary sensory neurons: the role of nerve growth factor in the production of persistent pain. Philos Trans R Soc London B Biol Sci 1996;351:441– 8. Woolf CJ, Safieh-Garabedian B, Ma QP, Crilly P, Winter J. Nerve growth factor contributes to the generation of inflammatory sensory hypersensitivity. Neuroscience 1994;62:327–31. Yashpal K, Fisher K, Chabot JG, Coderre TJ. Differential effects of NMDA and group I mGluR antagonists on both nociception and spinal cord protein kinase C translocation in the formalin test and a model of neuropathic pain in rats. Pain 2001;94:17–29. Zhou S, Komak S, Du J, Carlton SM. Metabotropic glutamate 1alpha receptors on peripheral primary afferent fibers: their role in nociception. Brain Res 2001;913:18–26. Zwick M, Davis BM, Woodbury CJ, Burkett JN, Koerber HR, Simpson JF, Albers KM. Glial cell line-derived neurotrophic factor is a survival factor for isolectin B4-positive, but not vanilloid receptor 1-positive, neurons in the mouse. J Neurosci 2002;22:4057–65.