Transgenic mouse lines expressing rat AH receptor variants — A new animal model for research on AH receptor function and dioxin toxicity mechanisms

Toxicology and Applied Pharmacology 236 (2009) 166–182

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / y t a a p

Transgenic mouse lines expressing rat AH receptor variants — A new animal model for research on AH receptor function and dioxin toxicity mechanisms☆ Raimo Pohjanvirta ⁎ Department of Food and Environmental Hygiene, Faculty of Veterinary Medicine, P.O. Box 66, FI-00014 University of Helsinki, Finland National Institute for Health and Welfare, Laboratory of Toxicology, P.O. Box 95, FI-70701 Kuopio, Finland Finnish Food Safety Authority EVIRA, Kuopio Research Unit, P.O. Box 92, FI-70701 Kuopio, Finland

a r t i c l e

i n f o

Article history: Received 19 September 2008 Revised 9 January 2009 Accepted 12 January 2009 Available online 23 January 2009 Keywords: 2,3,7,8-Tetrachlorodibenzo-p-dioxin TCDD AH receptor Transgenic animals Strain differences Enzyme induction Acute lethality Liver toxicity

a b s t r a c t Han/Wistar (Kuopio; H/W) rats are exceptionally resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) toxicity mainly because of their mutated aryl hydrocarbon receptor (AHR) gene. In H/W rats, altered splicing of the AHR mRNA generates two AHR proteins: deletion (DEL) and insertion (INS) variants, with the INS isoform being predominantly expressed. To gain further insight into their functional properties, cDNAs of these and rat wild-type (rWT) isoform were transferred into C57BL/6J-derived mice by microinjection. The endogenous mouse AHR was eliminated by selective crossing with Ahr-null mice. A single mouse line was obtained for each of the three constructs. The AHR mRNA levels in tissues were generally close to those of C57BL/6 mice in INS and DEL mice and somewhat higher in rWT mice; in testis, however, all 3 constructs exhibited marked overexpression. The transgenic mouse lines were phenotypically normal except for increased testis weight. Induction of drug-metabolizing enzymes by TCDD occurred similarly to that in C57BL/6 mice, but there tended to be a correlation with AHR concentrations, especially in testis. In contrast to C57BL/6 mice, the transgenics did not display any major gender difference in susceptibility to the acute lethality and hepatotoxicity of TCDD; rWT mice were highly sensitive, DEL mice moderately resistant and INS mice highly resistant. Co-expression of mouse AHR and rWT resulted in augmented sensitivity to TCDD and abolished the natural resistance of female C57BL/6 mice, whereas mice co-expressing mouse AHR and INS were resistant. Thus, these transgenic mouse lines provide a novel promising tool for molecular studies on dioxin toxicity and AHR function. © 2009 Elsevier Inc. All rights reserved.

Introduction Dioxins are lipophilic, persistent and wide-spread environmental contaminants arising from various industrial activities and thermal reactions including metal and electronic waste recycling, ore sintering, as well as backyard and landfill fires (Cieplik et al., 2003; Hedman et al., 2005; Fiedler, 2007; Li et al., 2007; Nguyen et al., 2003). The most potent congener of dioxins is 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). In laboratory animals, it brings about an exceptionally wide range of behavioral, biochemical and morphological effects encompassing e.g. a wasting syndrome and alterations in feeding behavior, endocrine disruption, impairment of the immunological system, liver toxicity, induction of specific Phase I and Phase II biotransformation enzymes, as well as carcino- and teratogenicity (Okey 2007; Pohjanvirta and Tuomisto, 1994; Birnbaum and Tuomisto, 2000; Knerr and Schrenk, 2006). In humans, exposure to TCDD

☆ Preliminary results were reported in 46th Annual Meeting of the Society of Toxicology, Charlotte, NC, USA, March 25–29, 2007 (The Toxicologist 2007, 96, 278 [abstr. 1344]). ⁎ Fax: +358 9 19157170. E-mail address: raimo.pohjanvirta@helsinki.fi. 0041-008X/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.taap.2009.01.005

and other dioxins at levels somewhat higher than those currently prevailing in the general population of Western countries has epidemiologically been associated with tooth abnormalities and altered gender ratio in offspring (Alaluusua and Lukinmaa, 2006; Mocarelli et al., 2000). After occupational or accidental exposure to still higher concentrations, evidence for other ailments including cancer, porphyria, changes in serum biochemical variables, chloracne, cardiovascular dysfunction and impaired glucose tolerance (or even diabetes) has been obtained (Pelclová et al., 2006; Schecter et al., 2006; Sweeney and Mocarelli, 2000; Consonni et al., 2008). Virtually all biological effects of dioxins are mediated by a cytosolic protein with functional reminiscence of the nuclear receptor superfamily: aryl hydrocarbon receptor (AHR). The AHR is a ligandactivated transcription factor which structurally belongs to the bHLH/PAS proteins. In an inactive state, it is physically associated with a chaperone complex consisting of two molecules of heat shock protein-90, the immunophilin-like X-associated protein 2 (XAP2) and p23 (Petrulis and Perdew, 2002; Harper et al., 2006; Furness et al., 2007). Binding of ligand transforms the receptor disclosing its nuclear localization signal and the receptor moves into the nucleus detaching from the chaperones and heterodimerizing with a structurally related protein, AHR nuclear translocator (ARNT). The AHR/ARNT-dimer then

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

167

Fig. 1. Main features of rat AHR isoforms. TCDD-sensitive rat strains such as Sprague-Dawley and Long-Evans (Turku/AB) express almost exclusively the wild-type form of the receptor, whereas the highly TCDD-resistant Han/Wistar (Kuopio) strain predominantly expresses the insertion variant (ca. 85%) but also, to a smaller degree (ca. 15%), the deletion variant of the AHR (Moffat et al., 2007).

binds to the DNA at specific response elements (AHRE-I and AHRE-II) residing in promoter and/or enhancer regions of genes regulated by the AHR (Whitlock 1999; Boutros et al., 2004). Physically interacting with transcriptional co-activators, the DNA-bound AHR is capable of upregulating gene expression; the mechanisms of gene repression are still obscure (Furness et al., 2007). AHR is finally degraded by the ubiquitin-26S proteasome system (Ma, 2001). The AHR protein has a modular structure. The domains responsible for DNA binding and heterodimerization are located towards the Nterminus, while the ligand-binding domain is in the mid-region. The C-terminal end harbors a large transactivation domain (TAD) which comprises several interacting subunits (Ma, 2001). The acute toxicity of TCDD is characterized by exceptionally large variation in sensitivity among laboratory animals. About 1000-fold differences have been reported not only between species (with guinea pigs and hamsters representing the extremes in mammals) but also within species: the LD50 value for Long-Evans (Turku/AB; L-E) rats is 9.8 (females) or 17.7 μg/kg (males) whereas it is over 9600 μg/kg for both

genders of Han/Wistar (Kuopio; H/W) rats (Pohjanvirta et al., 1993; Unkila et al.,1994; Pohjanvirta and Tuomisto,1994). Diverse studies some 20 years ago already demonstrated that this rat strain difference does not arise from kinetic reasons (Pohjanvirta et al.,1990), appears to be specific to agents acting through the AHR (Unkila et al., 1992), is inherited as an autosomal dominant trait (Pohjanvirta 1990), and diminishes with reducing binding affinity to the AHR among dioxins (Pohjanvirta et al., 1993). Moreover, it is not universal: H/W rats show normal susceptibility to a number of biochemical and even toxic impacts of TCDD (dubbed type I effects) including induction of drug-metabolizing enzymes, changes in vitamin A status and thymic atrophy (Pohjanvirta and Tuomisto 1994 and references therein; Simanainen et al., 2002). A logical explanation for this inter-strain divergence was provided by the exciting finding that the AHR of the TCDD-resistant H/W rats is remodeled: a point mutation at the first nucleotide of intron 10 results in altered splicing of AHR mRNA generating 3 variant mRNA species, a deletion (DEL) and two insertion variants (Pohjanvirta et al., 1998). As the insertions will translate identically, there are two

Fig. 2. Principal elements of the two sets of rat AHR expression constructs tested in vivo. (a) Initial constructs. (b) Final constructs. The initial constructs worked well in vitro but failed to be expressed in vivo. Thus, all the data presented in this paper are derived from the second-generation (final) constructs. The numbers below the schematic structures indicate the approximate sizes (in bp) of the subunits. Abbreviations: MCS, multiple cloning site; CMV, cytomegalovirus immediate-early enhancer/promoter region; pA, SV40 late polyadenylation signal; EF-1α, human eukaryotic translation elongation factor-1α1 promoter region.

168

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

different versions of the AHR at the protein level, both restructured at the C-terminal TAD (Fig. 1; note that there is also an alteration at nucleotide 1524 but this occurs within a hypervariable region and is probably of little functional consequence). The shortened TAD is reflected in lowered molecular mass of the AHR in H/W rats (98 vs. 106 kDa for wild-type AHR) and, interestingly, in increased sensitivity of the ligand-binding function of the receptor to metal oxyanions and to buffers with high osmolality (Pohjanvirta et al., 1999). Although H/W rats also harbor another, contributing mutation in a currently unidentified gene B that may be involved in heme metabolism (Niittynen et al., 2003), the restructured AHR is by far the most important factor for their TCDD resistance (Tuomisto et al., 1999). Based on recent mRNA expression analyses, the predominant form of the AHR in H/W rat tissues is the insertion (INS) variant representing some 85% of total AHR expression (Moffat et al., 2007). A somewhat surprising finding was that the intrinsic transactivation activity of the TAD of the INS isoform was only slightly reduced compared with the rat wild-type (rWT) TAD in an in vitro assay; the DEL variant TAD exhibited 3-fold enhanced activity (Moffat et al., 2007). This outcome suggested that the influence of the structural reformations on TAD function is context-dependent and prompted planning of an appropriate in vivo model for further studies. Transgenic mice expressing rWT, DEL or INS AHRs globally were considered best-suited for this purpose. Materials and methods

Since the sequence of this EF-1α1 promoter had not been determined in detail before, it was analyzed first. Subcloning into pCR Script SK(+) Amp plasmid and sequencing of this DNA fragment revealed that it was identical to the DNA spanning from 113562 to 115956 in the human clone RP11-505P4 on chromosome 6 (GenBank accession number AL603910), with the exception that a 64-bp stretch between two nearby SmaI sites at 115118 and 115182 was missing (this section localizes to intron 1 in EF-1α1 mRNA). Therefore, it was 2331 bp in length. The modified pTransgene vector (containing the added Mph1103I site) was then cut with PacI and BcuI to expel the original promoter, blunted with T4 polymerase and ligated with the similarly blunted EF-1α1 promoter. This was followed by subcloning of the refined rat rWT AHR into the remodeled vector. To this end, the AHR was digested with PauI and blunted with T4 DNA polymerase, followed by NotI digestion. The vector, in turn, was digested with MluI, blunted (T4) and cut with NotI, whereafter the two now compatible DNA fragments were joined by ligation. Finally, the expression construct was linearized with Mph1103I and SbfI cleaving a product of 7076 bp in size (Fig. 2b). Constructs of the INS and DEL of rat AHR were subsequently prepared by cutting both the newly-created wild-type construct and the first-generation constructs of the two variants with Eco32I (cuts the AHR at NT 989 and downstream from the splicing alteration [position 2569 for the rWT receptor] but not at any other site in the constructs), and the AHR fragments were swopped. These variants contain the single-nucleotide mutation (T → C) at NT 1520 present in the AHR of the TCDD-resistant H/W rat.

DNA constructs Generation of transgenic mice Initial trials were conducted with constructs containing a human cytomegalovirus (CMV) promoter and, immediately upstream the translation start site, an artificial Kozak sequence (GCC-GCC-ACC, preceded by a neutral fragment AAG-TAA-GTA-AGT-A) (Fig. 2a). Although these constructs were well-expressed in all cell lines tested including mouse Hepa-1 cells, they were totally silent in mice (data not shown). This disappointing outcome prompted redesign of the constructs. The final constructs were built on the backbone of pTransgene vector (GenBank accession number AF515846), kindly provided by Dr. Xinhai Yang, Boston University, USA (Fig. 2b). It was sequentially cut at its multiple cloning site with Nhe I and EcoRI. An Mph1103I site (for linearization of the final constructs) was incorporated between Nhe I and EcoRI sites by means of two oligonucleotides complementary with one another in the middle portion but leaving overhangs at both ends identical to those generated by Nhe I and EcoRI. The oligos were allowed to hybridize in the same reaction used for ligation of the resultant sticky-end DNA with the digested pTransgene vector. A fragment of about 800 bp from the 5′ end of the 3′UTR of rat AHR was amplified from rat liver cDNA by PCR using primers which either covered or contained (artificially incorporated) XhoI and NotI sites. The PCR product was purified and transferred at the 3′ end of rat wild-type AHR (in pCR Script SK[+] Amp plasmid produced previously (Pohjanvirta et al., 1998) in two steps using the restriction enzymes XhoI and NotI followed by NcoI and NotI. A 93-nt oligo representing mouse AHR 5′ up to EheI site in the coding sequence (NT 12; this stretch of the coding sequence as well as the entire flanking 30-bp leader of rat AHR is identical to the corresponding region in mouse AHR) was rendered double-stranded by way of T4 DNA polymerase and an antisense primer starting from the EheI site. To put this fragment in place, the 3′ end-amended rat wildtype AHR was digested with EheI and KpnI and blunted thereafter (KpnI end) with T4 DNA polymerase; the two pieces were then ligated and subcloned into pCR Script SK(+) Amp plasmid. Next, the promoter of the pTransgene vector was replaced with human EF-1α1 promoter (a generous gift from Dr. Sumio Sugano, University of Tokyo, Japan).

After excision of the expression constructs from the plasmids they were isolated and purified from agarose gels with Wizard SV Gel and PCR Clean-Up System (Promega). With their concentrations set at 2 ng/ μl, they were microinjected into fertilized mouse oocytes. For the first set of constructs, hybrid animals of C57BL/6 and 129 strains were used as recipients at the AIV institute in Kuopio, Finland. The final constructs were transferred into C57BL/6JOlaHsd zygotes in the transgenic core facility of Biocenter Oulu, University of Oulu, Finland. Transgenic founders were identified by PCR analysis of genomic DNA from ear prick samples (isolated by the “HotSHOT” method (Truett et al., 2000) using primers which enabled distinguishing of all three construct genotypes: 5′CTCAGCAGGAACGAAAGCAC3′ (forward) and 5′ TCATCCTGGCCTCGAGC3′ (reverse). The sizes of the products generated in this reaction were 564 bp (rWT), 435 bp (DEL) and 593 bp (INS). A second PCR assay was used for determination of the mouse AHR status of the animals and targeted exon 2 in a multiplex reaction with the following primers: 5′GACACAGAGACCGGCTGAAC3′ (forward) and 5′ AGCATGTACCATCCAAACAGC3′ (reverse); 5′TGAATGAACTGCAGGACGAG3′ (forward) and 5′AATATCACGGGTAGCCAACG3′ (reverse). The first primer pair amplified a DNA product of 369 bp from mice carrying their innate mouse AHR; the second yielded a stretch 515 bp in length from Ahr-null mice with neomycin-resistance cassette replacing exon 2 in their AHR (heterozygotes exhibited both signals). Although the forward primer of the first reaction was identical also with rat AHR sequence, the reaction did not amplify rat AHR constructs because the reverse primer annealed to intron 2 sequence that was only present in genomic DNA containing endogenous mouse AHR. To ascertain the expression of the constructs, liver biopsies were harvested from selected individual mice. To this end, the mice were anesthetized with 0.2 ml/mouse of an 1:2 mixture of xylazin (Rompun 20 mg/ml, Orion Pharma, Turku, Finland) and ketamine (Ketalar 10 mg/ml, Pfizer, Helsinki, Finland) administered sc. The abdominal organs were exposed by a small (∼ 1 cm) incision through linea alba. The rim of the lateral lobe of liver was pinched with haemostatic forceps, a tiny piece (ca. 1–5 mg) was excised and stored in RNAlater (Ambion — Applied Biosystems, Foster City, CA, USA), and about 1 ml of

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

physiological saline was injected into the abdominal cavity to maintain proper hydration. After ensuring that the liver did not bleed, the abdominal muscles and skin were closed separately with absorbable suture material (Dexon 4-0, Syneture — Tyco Healthcare, Norwalk, CT, USA), and the mice were allowed to recover under a heating lamp after analgesic treatment (0.01 ml of Temgesic 0.3 mg/ml [buprenorfin; Schering-Plough, Kenilworth, NJ, USA]). For the three lines produced, the breeding colonies descend from a single mouse in each case. Once established, the lines were maintained in the animal facilities of the National Public Health Institute, Kuopio, Finland by breeding construct-positive mice mainly with AHRdeficient mice, albeit Ahr heterozygotes as well as interbreeding between construct-positive animals were also occasionally used. Both Ahr-null and C57BL/6 mice (further employed as a model for mouse AHR function and expression) stem from the C57BL/6J strain originally acquired from the Jackson Laboratory (Bar Harbor, ME, USA).

169

Animal husbandry During the experiments, the mice were generally housed in groups of 4–6 animals in Macrolon cages with pelleted R36 feed (Lactamin, Stockholm, Sweden) and tap water available ad libitum. As male mice tended to fight with one another, during the sensitivity experiments of AHR hybrid mice males were housed singly. The temperature in the artificially illuminated animal room was 21 ± 1 °C, relative humidity 50 ± 10% and lighting cycle 12/12 h light/dark. At termination (or if euthanasia was deemed necessary in the course of the experiments), the mice were killed by cervical dislocation. The study plans were approved of by the Animal Experiment Committee of the University of Kuopio and the Kuopio Provincial Government. The procedures were conducted in accordance with the Guidelines of the European Community Council directives 86/609/EEC.

Fig. 3. (a) and (b). Expression of exogenous or endogenous (for C57BL/6) AHR mRNA in various tissues of adult male mice (ng/30 ng original total RNA). Mean ± SD (n = 4 except for the following: INS, thymus, small intestine, pancreas, bone marrow: n = 3; INS, pituitary: n = 2; rWT, pancreas, pituitary: n = 3; DEL, pituitary: n = 3; DEL, pancreas, n = 2; C57BL/6, pituitary, n = 3). Columns with non-identical superscripts differ significantly from one another (p b 0.05).

170

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

Fig. 3 (continued).

Experimental design

The male and female mice were 3.5–8.5 and 2–5.5 months old, respectively. For males, samples of liver, lung and testis were excised, snapfrozen in liquid nitrogen and then stored at − 80 °C until RNA extraction. In the case of females, liver and ovary were identically harvested.

Constitutive expression of the constructs in various tissues. To compare basal expression levels of the constructs with one another and with mouse AHR concentrations across organs and tissues, groups of 4 untreated male mice of each transgene line as well as of C57BL/6 strain were weighed and killed at the age of 5–6 months. The following tissues were sampled, flash-frozen and stored in a deep-freezer: submandibular salivary gland, thymus, lung, heart, liver, spleen, pancreas, kidney, adrenal gland, white adipose tissue, small intestine, testis, vesicular gland, skeletal muscle, bone medulla, cerebrum, cerebellum and pituitary gland. Of these, heart, liver, spleen, kidneys, testicles and whole brain were weighed before samples were harvested.

Sensitivity to the acute toxicity of TCDD. In the first (pilot) experiment, adult male mice (age range 3–10 months) were treated by gavage with 0 or 500 μg/kg TCDD dissolved in corn oil (5 ml/kg). The mice were monitored for 21 days. At termination, pieces of liver were harvested in 4% formalin and in RNAlater. In a subsequent experiment, adult female mice (age range 4– 10 months) were exposed to 0, 250 or 500 μg/kg TCDD dissolved in corn oil (5 ml/kg). The follow-up time was again 21 days and liver was sampled as in the first experiment.

Responsiveness to enzyme induction by TCDD. Groups of 4 (transgenic lines) or 5 (C57BL/6) mice of both genders were administered TCDD in corn oil (5 ml/kg) by gavage at 0, 0.05, 0.5 or 5 μg/kg and killed 24 h later.

Effect of concomitant expression of mouse and rat AHRs on susceptibility to TCDD. The possible interference between endogenous mouse AHR and exogenous rat AHR in mediation of acute toxicity of TCDD

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

was studied by exposing adult mice representing different genotypic combinations and both genders by gavage to a single dose of 0, 125, 250 or 500 μg/kg TCDD in corn oil and monitoring their survival for 21 days. Extraction of RNA and cDNA synthesis The tissue samples were homogenized with Ultra-Turrax (Ika Works, Wilmington, NC, USA) making sure that the deep-frozen samples did not thaw before homogenization. Total RNA was isolated from the homogenates using GenElute Mammalian Total

171

RNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO, USA). The extracted total RNA was subjected to DNAse1-treatment with the DNA-free kit (Ambion, Austin, TX, USA). The purity and concentration of the RNA were assessed spectrophotometrically with GeneQuant II (GE Healthcare, Uppsala, Sweden). cDNA was generated with M-MLV, RNase H Minus, Point Mutant reverse transcriptase (Promega) using a 1:10 mixture of anchored oligo-dT and random nonamers (1 and 10 μM, respectively) as primers. The reaction mixture was incubated at 50 °C for 1 h. The resultant cDNAs were diluted to 5 ng/µl (of original RNA) with water for subsequent analyses.

Fig. 4. Expression of AHR (left panels) and CYP1A1 (right panels) mRNAs in liver, lung and testes of male C57BL/6 and AHR-transgenic mice 24 h after treatment with TCDD or corn oil (ng/30 ng original total RNA). The insets contain magnifications of columns which are too small to be visible in the original figure (Y-axis scale is different). Mean + SD of 4–5 mice (except for DEL, liver, control and INS, testis, 0.5 μg/kg where n = 3).

172

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

Measurement of mRNA levels mRNA expression levels were determined by real-time quantitative RT-PCR using either QuantiTect SYBR Green PCR Kit (Qiagen, Hilden, Germany) or RT2 (Superarray, Bethesda, MD, USA) with RotorGene 3000 Real-Time Amplification System (Corbett Research, Mortlake, NSW, Australia) in 20 μl reactions as described in detail for QuantiTect assays previously (Pohjanvirta et al., 2006). The cycling conditions in reactions with RT2 were: initial activation, 95 °C 10 min; 40 cycles with denaturation at 95 °C for 15 s and combined annealing and elongation at 60 °C for 60 s with fluorescence acquired. A melting curve was produced after the amplification at 64–95 °C (note that although the AHR primers yielded products of identical size from both mouse and rat AHR cDNA templates, these could be distinguished by their melting curves). All pipetting was carried out with CAS-1200 pipetting robot (Corbett Research). The primers used, amplicon lengths and reaction efficiencies (on average, 0.96) are shown in Supplementary Table 1. Measurement of AHR protein levels Hepatic AHR protein expression was assessed by Western blotting employing a primary antibody which recognizes both the rat and mouse receptor (BioMol, Exeter, England). The method for initial verification of protein expression was essentially as described previously (Tuomisto et al., 1999) with the minor modifications that

primary and secondary antibodies were diluted 1:20,000 and 1:18,000, respectively, and the secondary antibody as well as the colorimetric stain (NBT/BCIP) were from Sigma-Aldrich. For quantification of AHR protein concentration, hepatic homogenates were prepared from control male mice of the enzyme induction experiment. Protein concentrations were adjusted to 4.6 mg/ml and 70 μg of total protein was applied in each well of SDS-PAGE gels. The diluted primary antibody solution also contained polyclonal anti-β-actin antibody (NB100-56874, Novus Biologicals, Littleton, CO, USA) at 0.125 μg/ml. The bands were detected by chemiluminescence using Western Lightning Chemiluminescence Plus reagent (PerkinElmer, Boston, MA, USA) and Amersham Hyperfilm ECL films (GE Healthcare, Buckinghamshire, UK). Pixel intensities were quantified with GS-800 Calibrated Densitometer and Quantity One software (both from BioRad, Hercules, CA, USA). For each sample, AHR protein expression was calculated relative to its β-actin protein level. Copy number analysis To get an estimate of the number of construct copies incorporated into the genome of each line, a real-time qPCR method was developed. Its basic idea was to first find a reliable single-copy gene, determine the absolute concentration of both this gene and the construct (or endogenous Ahr gene in the case of C57BL/6 mice) by qPCR using standard curves and then relate the latter value to the former. From literature search, the gene encoding histidine-rich calcium binding

Fig. 5. Expression of AHR (left panels) and CYP1A1 (right panels) mRNAs in liver and ovaries of female C57BL/6 and AHR-transgenic mice 24 h after treatment with TCDD or corn oil (ng/30 ng original total RNA). The insets contain magnifications of columns which are too small to be visible in the original figure (Y-axis scale is different). Mean + SD of 4–5 mice (except for DEL, liver and ovaries, 0.5 μg/kg where n = 3).

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

protein (HRC) stood out as an excellent candidate for normalization because it has been reported that each mammalian HRC gene is present as a single copy in the haploid genome (Hong et al., 2005). Mouse Ahr gene is located in chromosome 12 and should also be single-copy (per haploid genome) based on NCBI Entrez Gene data. For AHR detection, the same primers could be used as in mRNA expression analysis. Initial trials disclosed that gDNA isolated by the HotSHOT method (used for genotyping of the transgenic mice) was not pure enough for qPCR. Therefore, GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) was employed. By this method, gDNA of sufficient quality could be extracted from livers stored either frozen or in RNAlater (Supplementary Table 2). Determination of ED50 values for enzyme induction ED50 values for cytochrome P450 mRNA induction were calculated with SigmaPlot 8.0 by nonlinear regression using Hill's equation for dose–response data. To this end, the value of the highest dose group was set at 100% and other dose groups expressed relative to it separately for each mouse line. Histological preparations Liver samples fixed in 4% formalin were embedded in paraffin, sectioned to the thickness of 5 μm, mounted on glass slides and stained with hematoxylin and eosin (HE) by standard protocols. Statistics Data on body and organ weights and on biochemical variables were initially assessed for homogeneity of variances by visual inspection and using the Levene test. If they appeared to be homogenous, oneway analysis of variance (ANOVA) was performed followed by Duncan's new multiple range test. If the variances proved nonhomogenous, the data were subjected to logarithmic transformation and the variances tested afresh. In the case of homogeneity, they were analyzed by one-way ANOVA and Duncan's post-hoc test. If the

173

variances still remained non-homogeneous, Kruskal–Wallis nonparametric ANOVA followed by Mann–Whitney U-tests were applied. In all cases, the level of significance was set at p b 0.05. Results The initial constructs tested carried a CMV promoter and an artificial Kozak sequence (Fig. 2a). Since they proved to be well expressed in various cell lines (including mouse Hepa-1 cells) in vitro, it was a surprise to find out that they exhibited no detectable expression in mouse tissues in vivo. This setback led to the design of the second set of constructs, in which careful attention was paid to optimizing all structural features potentially involved in expression efficiency (Fig. 2b): the CMV promoter was replaced with human EF1alpha promoter and an almost 800-bp stretch of authentic rat AHR 3′ UTR was incorporated at the 3′ end of the cDNAs. In the 5′ leader, the artificial Kozak sequence gave way to a ca. 90-bp portion of authentic mouse AhR leader sequence containing the full-length (30-bp) 5′ UTR of rat AHR. In addition, the final constructs carried chicken β-globin core insulators flanking both sides of the cDNA to protect against position effects in the chromosomes (Bell et al., 2001; TaboitDameron et al., 1999; Houdebine et al., 2003). These readjustments appeared to be beneficial as a new transgenic mouse line was obtained for all three constructs. In each case, the line descended from a single founder. The constructs turned out to be globally expressed in tissues (see below) and the expression was stable: only in the DEL line were non-expressing mice occasionally recorded (at a frequency of ca. 5%). No clear phenotypic feature could be associated with the presence of the exogenous AHR except for increased testis weight (see below), although postnatal mortality appeared to be slightly elevated, especially among INS and rWT transgenes. Basal expression of the constructs and the effect of TCDD on AHR expression The expression of AHR mRNA was analyzed by real-time quantitative RT-PCR in adult mice, predominantly males. The

Fig. 6. AHR protein levels in liver of male control mice. AHR protein expression was assessed by Western blot employing chemiluminescence detection. The data were individually normalized to β-actin band intensities. Images from original films for all the mice analyzed are shown along with a densitograph of the average relative AHR protein expression levels (percent of β-actin values; mean ± SD, n = 3 for DEL, 4 for rWT and INS and 5 for C57BL/6). To help verify correct size of the AHR variants, hepatic cytosols from L-E rats (rat wildtype AHR; apparent molecular mass 106 kDa) and H/W rats (98 kDa) were run in each gel. For mouse samples, a total of 70 μg protein was loaded in each well; the rat samples were not adjusted for protein content. The single-letter symbols above the gel lanes identify the samples (L = L-E, H = H/W, B = C57BL/6, D = DEL, I = INS and W = rWT). The asterisk in gel 1 singles out an individual DEL mouse which failed to exhibit any AHR expression at all (neither mRNA nor protein) and was excluded from the calculations. The mean values did not differ significantly from one another (p = 0.12).

174

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

constructs proved to be ubiquitously expressed in all tissues examined (Figs. 3a and b; for liver, lung and genital data, see left panels of Figs. 4 and 5). In most cases, the highest expression levels were measured for the rWT AHR with the INS and DEL AHR mRNA concentrations falling close to those of endogenous AHR in C57BL/6 mice. This was true of kidney, adrenal gland, heart, pancreas, salivary gland, small intestine, bone marrow, white adipose tissue, skeletal muscle and seminal vesicle. In liver, the DEL variant was also abundantly expressed similar to the rWT AHR. In lung, rWT AHR level was only slightly higher than the endogenous AHR concentration in C57BL/6 mice in the basal state but TCDD tended to repress the level of the endogenous C57BL/6 AHR. A different picture emerged in the rest of the tissues investigated. Both INS and DEL exhibited substantially higher concentrations than either rWT or endogenous AHR in C57BL/6 mice in spleen and thymus, while all constructs were (or tended to be) expressed more than the native AHR present in C57BL/6 mice in pituitary gland, cerebrum, cerebellum, and – especially so – in testis. In fact, the highest AHR mRNA concentrations of all tissues examined were present in testes of the transgenic lines (Fig. 4, bottom left panel). In female mice, AHR expression was assessed only in the context of the induction experiment (left panels in Fig. 5). Female liver exhibited the same concentration-order for the constructs as in males, and the absolute values were similar in both genders. However, ovarian and testicular patterns differed from one another. In ovary, the expression level in INS mice was equal to that of endogenous AHR in C57BL/6 mice while it was ca. 5- or 10-fold higher in DEL and rWT mice, respectively. TCDD failed to exert any undebatable influence on construct AHR expression in either gender. The same overall pattern in AHR abundance across the mouse lines detected in mRNA levels was also discernible in hepatic AHR protein concentrations with DEL and rWT mice exhibiting the highest and INS mice the lowest values (Fig. 6). However, in the case of AHR protein concentrations, the differences did not attain statistical significance. AHR protein concentrations were concordant with AHR mRNA levels also in females (data not shown).

Fig. 7. mRNA expression ratio of an EST (Mm. 31626) and CYP2B20 in liver of control male mice (mean ± SD; n = 3 for DEL, 4 for rWT and INS, 5 for C57BL/6 and 6 for Ahrnull mice). Columns with non-identical superscripts differ significantly from one another (p b 0.05).

Genomic DNA isolated from RNAlater-fixed liver appeared to contain small amounts of qPCR-interfering impurities which mainly affected the highest gene number values as assessed from different dilutions of the extracted gDNA (Supplementary Table 2). At the highest dilution (=lowest concentration of input gDNA), the results were fully in keeping with those obtained with repurified gDNA. The rWT mice analyzed seemed to have about 5 copies of the construct in their haploid genomes. For INS mice, the number was much larger, around 30. There appeared to be noticeable variation in copy number among individual DEL mice, but further analyses are needed to establish it. Intriguingly, a ratio of ca. 2 was consistently found for C57BL/6 mice albeit both Ahr and HRC should be single-copy genes (per haploid genome).

that lack AHR function. Hepatic mRNA levels of these two genes were determined from control male mice of the induction experiment (see below) as well as from six Ahr-null mice. As expected, the expression ratio of Mm. 31626/CYP2B20 was strikingly different between Ahr+/+ and Ahr−/− mice (Fig. 7). None of the transgene lines exhibited a statistically significant difference from C57BL/6 mice. The mice with either rWT or INS variant AHR differed significantly from AHR-deficient mice, but for DEL mice this difference did not reach statistical significance. This was probably due to the small sample number (3) in this group, since there happened to be one individual DEL mouse in the controls with very low hepatic AHR expression and it was discarded from all liver analyses. Interestingly, its expression ratio was close to that of Ahrnull mice (0.70) lending further confidence to this approach. As an alternative means to assess the physiological functionality of the AHR constructs, absolute and relative weights of key organs were recorded from control male mice in the induction experiment. Mice with non-functional AHR due to exon 2 deletion (as is the case for the Ahr-null mice used in the generation of these transgenes) have been reported to harbor a smaller-than-normal liver throughout their lives (Lahvis and Bradfield, 1998). Deficiency of the AHR also affects heart and spleen weights (Lin et al., 2001). However, these organs of all three transgenic lines proved to be indistinguishable in size from those of C57BL/6 mice (Table 1). The only organ that did exhibit a deviation in size was testis: in all transgenes the testes weighed significantly more than in their C57BL/6 counterparts (for rWT and DEL mice, both in absolute and relative terms; for INS mice, in absolute weights).

Physiological functionality of the exogenous AHRs

Enzyme inducibility by TCDD in the transgenic lines

AHR function is usually considered in the context of this receptor's ability to regulate biochemical and toxic responses to xenobiotic chemicals. However, the AHR also carries out important physiologic functions in the absence of exogenous ligands. Our previous genome-wide expression study on C57BL/6 and Ahr-null mice revealed that two genes, Cyp2b20 and Mm. 31626 (an EST), are well-suited to serve as biomarkers for discrimination between Ahr−/− and Ahr+/+ mice (Tijet et al., 2006). CYP2B20 is constitutively much more expressed in AHR-deficient mice than in mice with wild-type AHR, whereas the converse is true for Mm. 31626. Thus, their expression ratio can be used as a measure of similarity either to mice which have fully functional AHR or to mice

In liver, the classic AHR-regulated gene, Cyp1a1, was induced in a practically identical manner in males (Fig. 4, right panels) and in females (Fig. 5, right panels). At the two lowest doses of TCDD (0.05 and 0.5 μg/kg), the largest responses were seen in rWT and DEL mice. Basal expression of CYP1A1 was lower in C57BL/6 mice than in any of the transgenic lines but C57BL/6 mice caught up the difference and attained the same level as rWT and DEL at 5 μg/kg. In INS mice, the CYP1A1 mRNA concentration stayed about 2–3-fold lower than in rWT and DEL mice at all three TCDD dose levels. In lung the inter-line differences among the transgenes were smaller than in liver. C57BL/6 mice tended to show a slightly more eminent induction than the transgenic lines at all doses, probably

Copy number comparisons

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182 Table 1 Absolute and relative organ weights in adult male mice Organ Body weight Liver Spleen Heart Kidneys Brain Testes Rel. Liver Rel. Spleen Rel. Heart Rel. Kidneys Rel. Brain Rel. Testes

Genotype C57BL/6

rWT

DEL

INS

30.22 ± 1.21 1.49 ± 0.13 0.10 ± 0.01 0.18 ± 0.02 0.39 ± 0.06 0.45 ± 0.03 0.20 ± 0.01a 4.93 ± 0.59 0.31 ± 0.03 0.60 ± 0.09 1.30 ± 0.16 1.49 ± 0.06 0.66 ± 0.02a

30.86 ± 1.51 1.47 ± 0.11 0.08 ± 0.01 0.19 ± 0.03 0.41 ± 0.06 0.47 ± 0.01 0.25 ± 0.02b 4.79 ± 0.54 0.25 ± 0.02 0.61 ± 0.10 1.33 ± 0.13 1.53 ± 0.07 0.80 ± 0.08b

29.90 ± 1.62 1.26 ± 0.20 0.08 ± 0.01 0.17 ± 0.03 0.38 ± 0.06 0.45 ± 0.04 0.23 ± 0.01b 4.20 ± 0.56 0.27 ± 0.04 0.56 ± 0.10 1.26 ± 0.21 1.52 ± 0.15 0.78 ± 0.03b

31.79 ± 1.58 1.49 ± 0.13 0.09 ± 0.01 0.17 ± 0.01 0.41 ± 0.02 0.45 ± 0.02 0.23 ± 0.02b 4.68 ± 0.34 0.27 ± 0.03 0.53 ± 0.02 1.30 ± 0.05 1.41 ± 0.10 0.72 ± 0.06ab

Both absolute and relative organ weights are shown. Relative organ weights (at the lower part of the table) are given in proportion to body weight (%). The numbers in the same line with non-identical letters are significantly different (p b 0.05). Mean ± SD (n = 4 except for heart, C57BL/6 and SIV, where n = 3).

reflecting the relatively high expression of the endogenous AHR in lung. In both testis and ovary, prominent induction of CYP1A1 was only seen at the two highest doses. At these doses, the rWT mice

175

exhibited 2–7-fold larger values than the other mice in ovary, whereas all transgenic lines displayed 10–40 times higher CYP1A1 mRNA concentrations than C57BL/6 mice in testis. Gender played little role in the patterns of induction of two other AHR-regulated drug-metabolizing enzymes studied in liver (Fig. 8). CYP1B1 was distinctly induced at the two highest doses only, with DEL and rWT having higher values than C57BL/6 or INS. CYP1A2 induction mirrored that of CYP1A1 although the magnitude of enhancement remained smaller. To further compare the induction profiles of CYP enzymes among the transgenic and intact C57BL/6 mice, the doses for half-maximal induction (ED50) were estimated from the dose–response data (Table 2). All ED50 values were similar in rWT and DEL mice and largely independent of gender. In these lines, a 10-fold higher dose was needed to reach the ED50 for CYP1B1 than for either CYP1A1 or CYP1A2. Both genders responded in much the same way also in C57BL/6 mice. However, the ED50 values for CYP1A1 and CYP1A2 were 2–5-fold higher than those in rWT or DEL mice, whereas no such difference was detected in the case of CYP1B1; hence, the ED50s for the three CYP enzymes were closer to one another in C57BL/6 mice compared with rWT or DEL mice. The INS mice exhibited a clear gender difference: In males, the ED50 values did not stand out from those of the other two transgenic lines for any of the CYP enzymes, but

Fig. 8. Expression of CYP1A2 and CYP1B1 mRNAs in liver of male and female C57BL/6 and AHR-transgenic mice 24 h after treatment with TCDD or corn oil (ng/30 ng original total RNA). The insets contain magnifications of columns which are too small to be visible in the original figure. To give maximal visibility to the data, the Y-axis scales differ between male and female panels as well as between insets and their origins. Mean + SD of 4–5 mice (except for female DEL, 0.5 μg/kg where n = 3).

176

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

Table 2 ED50 values (µg/kg) for induction of liver cytochrome P450 enzymes by TCDD Males C57BL/6 rWT DEL INS

Females

CYP1A1

CYP1A2

CYP1B1

CYP1A1

CYP1A2

CYP1B1

0.79 0.24 0.22 0.26

0.46 0.23 0.36 0.25

2.64 2.14 2.60 2.47

1.01 0.22 0.20 0.92

0.43 0.16 0.11 1.15

2.51 2.64 2.68 2.72

comparison with the control, albeit the decrease at 500 μg/kg was quite noticeable. In stark contrast to these two other lines, INS mice exposed to 250 μg/kg displayed a statistically significant enhancement of body weight gain and those treated with 500 μg/kg showed a significantly lesser reduction in body weight gain compared with their corn oiltreated controls. At termination of the experiment (day-21), the mean

in females the values for CYP1A1 and CYP1A2 were 4 to 10 times higher in INS mice. Sensitivity of the transgenic lines to acute toxicity of TCDD Upon exposure to 500 μg/kg TCDD, all male C57BL/6 mice died (or were euthanized moribund) between days 14 and 17 (Fig. 9). Four out of 6 rWT mice treated with this dose of TCDD also succumbed but the deaths occurred earlier commencing already on day 4. In DEL mice, the mortality rate was 1/3 with the only death taking place on day 10. In contrast, all 4 INS mice survived till the end of the follow-up period (day 21). At necropsy, frequent findings were general subcutaneous oedema and pale, often mottled liver with uneven surface and accentuated lobular pattern. Following this pilot experiment in male mice, a second sensitivity experiment was conducted in female animals. Because previous studies in L-E and Sprague-Dawley rats had shown females to be some 2-fold more sensitive than males (Pohjanvirta et al., 1993; Beatty et al., 1978), the dose of 250 μg/kg TCDD was tested in addition to the 500 μg/kg dose used in males. Both of these doses proved to exceed the LD50 for rWT mice (Fig. 10). The higher dose was lethal to all exposed rWT mice (between days 8 and 12), but there was one survivor (17%) in the 250 μg/kg group. In DEL mice, 1/6 and 3/6 mice succumbed at 250 and 500 μg/kg, respectively. Again, all INS mice tolerated the TCDD challenge. Thus, the LD50 was clearly less than 250 μg/kg for rWT, close to 500 μg/kg for DEL and substantially more than 500 μg/kg for INS mice. The predominant findings at necropsy involved the liver, which was pale or orange brown in colour with often full and distended gall bladder. The vastly different responsiveness of the 3 transgenic lines to TCDD toxicity was also reflected in body weight changes. By day 7 (the last day when all TCDD-treated female mice where still alive), both doses of TCDD had a marked loss of body weight (about 20%) in rWT mice (Table 3). In DEL mice, the changes did not reach statistical significance in

Fig. 9. Survival rate as a function of time in TCDD-treated transgenic and C57BL/6 male mice. The mice were exposed to a single dose of 500 μg/kg TCDD by gavage on day 0 and monitored for 21 days.

Fig. 10. Survival rate as a function of time in TCDD-treated transgenic female mice. The mice were exposed to a single dose of either 250 or 500 μg/kg TCDD by gavage (n = 6) on day 0 and monitored for 21 days.

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182 Table 3 Body weight change (% of initial weight) in the three dosage groups of transgenic female mice on day 7 after TCDD or corn oil administration Dose 0 250 500

Genotype rWT

DEL

INS

− 4.30 ± 2.39 − 19.01 ± 6.60⁎ − 18.35 ± 3.25⁎

− 7.17 ± 1.11 − 5.87 ± 11.45 − 14.28 ± 11.78

− 5.61 ± 1.97 + 2.50 ± 3.70⁎ − 0.21 ± 2.12⁎

The asterisks denote a statistically significant (pb 0.05) difference in comparison with the corresponding control group. Mean±SD (n=4 for controls and 6 for TCDD-treated groups).

weight gains of INS mice were slightly (but non-significantly) higher in both dosage groups than in controls (data not shown). A totally unexpected outcome was obtained when female C57BL/6 mice carrying the normal mouse AHR were tested. They turned out to be much more resistant to TCDD than their male counterparts and neither TCDD dose caused any mortality at all. Subsequent studies at even higher doses confirmed this intriguing gender difference but the data will be published in a separate paper. It is noteworthy in this context that at least in the rWT transgenic line females were somewhat more sensitive to TCDD toxicity than males. Histopathological findings In the three transgenic lines, the structural alterations in livers of TCDD-treated animals were unrelated to gender and did not differ appreciably between rWT and DEL mice. In mice that died early in the

177

course of the sensitivity experiment (at 4–5 days), the liver exhibited either extensive fatty degeneration (especially microvesicular) along with periportal or diffuse non-purulent hepatitis and scattered necrotic foci, or massive coagulative necrosis of hepatocytes (Fig. 11B). In mice succumbing between days 8 and 9, often severe fatty or hydropic degeneration was associated with periportal or diffuse infiltration of mainly mononuclear inflammatory cells, frequent single cell necroses and a nascent proliferation of biliary ducts. Bile duct proliferation grew more intense in mice surviving until days 12–14, and reached extreme proportions in a female DEL mouse dying on day-17 (Suppl. Figs. 1 and 2). Bile duct proliferation of variable degree (associated with periportal fibrosis) was also common in livers of survivor rWT and DEL mice. In addition, they showed fatty and hydropic degeneration, single cell or focal necroses, inflammatory cell infiltration and, occasionally, increased mitotic figures (Figs. 11C and D). In contrast to rWT and DEL mice, all INS mice survived TCDD exposure till the end of the observation period (day-21) and usually displayed few if any alterations compared with their corn oil-treated controls. A granuloma was detected in the liver of one female and a region of small necrotic foci in a male. Marginal to moderate accumulation of fat, a few single cell necroses, and a slightly elevated number of apoptotic bodies and mitoses were further recorded (Fig. 11E). The preponderant findings in livers of TCDD-treated male C57BL/6 mice (which all died between days 14 and 17 post-exposure) were (often severe) hydropic and fatty degeneration; periportal, zonal

Fig. 11. Histopathological findings in liver of TCDD-exposed male mice (HE staining). (a) rWT, control (day 21; ×40). (b) rWT, euthanized on day 4 after 500 μg/kg TCDD (×100): Massive acute necrosis of hepatocytes with gross cellular hypertrophy and small pyknotic nuclei or karyolysis. Hyperemia and hemorrhages. (c) rWT, survivor at 500 μg/kg (day 21; ×40): Chronic cholangiohepatitis with proliferation of bile ducts and prominent periportal fibrosis (arrows). (d) DEL, survivor at 500 μg/kg (day 21; ×100): Foci of coagulative necrosis surrounded by mononuclear inflammatory cells (arrows). (e) INS, survivor at 500 μg/kg (day 21; ×100): A few tiny necrotic foci (arrow). (f) C57BL/6, euthanized on day 17 after 500 μg/kg TCDD (×100): Hydropic degeneration, congestion and diffuse non-purulent hepatitis, frequent necrotic (arrowheads) and apoptotic (arrow) hepatocytes.

178

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

Table 4 Dependence of TCDD susceptibility on AHR status Gender

Mouse AHR

Rat AHR

TCDD dosea

Survivors/exposed

Male

+/+

–

+/− +/−

– rWT

+/− +/+ +/−

INS – –

+/−

rWT

+/−

INS

250 500 500 125 250 500 500 500 250 500 125 250 500 500

3/3 3/3 7/7b 0/4 0/5 0/5 4/4 1/1 4/4 6/6c 1/5 0/5 0/6 5/5

Female

Mice expressing various combinations of mouse and rat AHR isoforms were exposed to a single dose of TCDD and monitored for 21 days. a μg/kg by gavage. b 5 from rWT crosses, 2 from INS crosses. c 2 from rWT crosses, 4 from INS crosses.

(along lobular margins) or diffuse hepatitis; and proliferation of bile ducts in conjunction with periportal fibrosis (Fig. 11F). Sensitivity to the acute lethality of TCDD depends on AHR status To further elucidate the functional differences between AHR isoforms, mice emanating from crosses between transgenic (rWT or INS) and C57BL/6 or Ahr-null mice that express various combinations of mouse and rat AHRs were tested for their sensitivities to acute toxicity of TCDD (Table 4). Both male and female mice that expressed only the mouse AHR (either homo- or heterozygously) survived even the highest dose of TCDD (500 μg/kg). For females, this was not surprising as also C57BL/6 females had proved to be TCDD-resistant However, in the light of the fact that all C57BL/6 males treated with 500 μg/kg TCDD died in the pilot experiment (Fig. 9), the outcome implies that the C57BL/6JOlaHsd mice used as recipients in the construct microinjections are less responsive to acute TCDD toxicity compared with the C57BL/6 mice employed in the present studies and numerous previous studies as a model organism of mouse AHR function. Nevertheless, if these relatively TCDD-insensitive mice coexpressed the rWT isoform of the rat AHR, they were instantly converted to highly TCDD-susceptible animals. Importantly, this conversion took place also in female animals so that the lowest dose tested, 125 μg/kg, killed 80% of the exposed female mice with the higher doses being 100% lethal. In male mice co-expressing the rWT construct along with innate mouse AHR there were no survivors at any dose level. Contrary to the finding that a hemizygous presence of the rWT variant conferred great sensitivity to TCDD lethality, all mice (both male and female) that co-expressed the INS isoform of rat AHR together with the mouse AHR survived the challenge of 500 μg/kg TCDD exposure. Discussion The exceptional resistance of H/W rats to TCDD was fortuitously discovered in the late 1980s (Pohjanvirta et al., 1987; Pohjanvirta and Tuomisto, 1987). The reason for this resistance became evident some 10 years later with the advent of a specific antibody to the AHR: Western analyses with the antibody revealed that the H/W rat AHR is peculiarly small in its apparent molecular mass, ca. 98 kDa, suggesting altered function of this critical mediator of the biological effects of TCDD (Pohjanvirta et al., 1999). Molecular cloning of the receptor disclosed that the small size was ultimately due to an RNA splicing variation giving rise to two different proteins which were indistinguishable by one-dimensional gel electrophoresis (Pohjan-

virta et al., 1998). By genetic analyses, the AHR was then demonstrated to be the key factor underlying TCDD resistance in H/W rats (Tuomisto et al., 1999). Although H/W rats represent the only known (sub)strain homozygous for the TCDD-resistance allele of the AHR gene to date, it has transpired recently that the same allele can be found at a low frequency in some other outbred strains (Wistar, CD), too (Information on Charles River Website), suggesting that it is a fairly old mutation. Thus, characterization of the function of the two variant AHR proteins has both scientific and practical interest and significance since various substrains of Wistar rats are widely employed in studies in pharmacology and toxicology. Construct expression The initial constructs assembled had CMV promoter and exhibited excellent expression in all in vitro systems tested. However, when transferred into mouse genome, they turned totally silent. This outcome is not uncommon in the case of the CMV promoter (Houdebine et al., 2003). To circumvent the problem in the second set of AHR cDNA constructs, CMV was replaced with human EF-1α1 promoter that had previously been successfully used in rabbits (Taboit-Dameron et al., 1999). In addition to promoter, another factor influencing transgene performance is its genomic dose (copy number). One of the major problems with microinjection-based transgenic mouse production is the uncontrollability of the number of copies of foreign DNA that become incorporated into the mouse genome. Especially in the early days of this technique, there used to be an inverse relationship between the copy number and the resultant expression level, probably reflecting more active genomic repression of longer stretches of foreign DNA (the copies are usually in a tandem formation) (Overbeek, 1994; Henikoff, 1998; Houdebine 2002). To prevent the position effect, chicken β-globin insulators were included in the AHR cDNA constructs flanking both sides of the EF1α1 promoter. This insulator system has previously been reported to perform well as evidenced by a positive correlation between expression level and copy number (Taboit-Dameron et al., 1999). However, in the present case the insulators apparently did not function perfectly because the INS mice exhibited lower construct expression levels in most tissues analyzed compared with the rWT mice despite the fact that the latter appeared to have a much smaller construct copy number in their genome (though based on limited data from only two animals per line). The consistently found copy number of ca. 2 (per haploid genome) for the native AHR in C57BL/6 mice was surprising but may suggest the presence of a pseudogene for the AHR. Alternatively, it may stem from natural copy number variation which has proved to be common in mammals including humans (Freeman et al., 2006) and even in inbred mouse strains such as C57BL/6J (Watkins-Chow and Pavan, 2008). rWT mice displayed the highest construct expression levels of the three transgenic mouse lines in most tissues examined. Compared with native AHR mRNA and protein levels present in C57BL/6 mice, the most similar physiological expression patterns (i.e. in absence of treatment with xenobiotic chemicals) were found in DEL and INS mice. Although in the same range of AHR expression levels as C57BL/6 mouse in most tissues, both of these constructs were slightly or moderately underexpressed in lung. The expression level of INS was also low in a few other tissues such as small intestine, skeletal muscle and white adipose tissue. Conversely, they tended to be highly abundant in pituitary gland, the CNS, spleen and thymus; DEL further in liver, kidney, adrenal gland and ovary. However, by far the greatest overexpression was recorded in testis where the mRNA concentrations of all three rat AHR variants substantially exceeded those of native mouse AHR in C57BL/6 mice. This excessive expression of all constructs was strictly confined to testis; it was neither seen in the corresponding organ in females (ovary), nor in an accessory

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

reproductive organ in males (seminal vesicle). Immunohistochemical analysis is warranted to resolve the specific cell type(s) in testis responsible for this peculiar expression pattern. These mouse lines thus illustrate the fact that while the invention of insulator sequences has changed the previously prevailed relationship between transgene copy number and expression of foreign DNA by often abating the negative correlation or in some cases even converting it to a positive one, at present it is still not possible to predict the expression levels solely from the number of copies in the genome. Fortunately, the point in the present animal model is not in this relationship: as long as all the lines produce AHR in sufficient quantities to allow it to exert its physiological and toxicological functions, they enable comparison of the intrinsic properties of these AHR variants in vivo and provide a new tool for mechanistic studies on AHR function and TCDD toxicity. It is in this respect this novel animal model has its greatest value. Physiological functionality of the exogenous receptors Although studies with Ahr-null mice have indicated an important role for the AHR in development, e.g. in liver and vascular tissues (Lahvis and Bradfield, 1998; Walisser et al., 2004; Harstad et al., 2006), and although a wide variety of compounds have been shown to bind to this receptor (Denison and Nagy, 2003), its ultimate endogenous ligand still remains to be established. All three rat AHR isoforms appeared to be fully compatible with the putative physiologic mouse agonist(s), and the somewhat artificial expression patterns of the constructs had little influence in this respect. The transgenic lines grew and developed normally, their livers (as well as most other organs measured) were indistinguishable by weight from those in intact C57BL/6 mice, and they deviated equally to C57BL/6 mice from Ahr-null mice in expression ratio of the two discriminating genes analyzed, Cyp2b20 and EST Mm.31626. A notable exception to this similarity to intact C57BL/6 mice was detected in testes, which were significantly heavier in the transgenics. Coupled with the remarkable overexpression of construct AHRs in testis this finding suggests that the AHR may participate in physiological regulation of testis growth and that the prevailing AHR expression levels are growth-limiting in this organ. In support of this, it was previously reported that Ahr-null mice have smaller testes than Ahrwild-type mice at all phases of post-natal development studied (last measurement at the age of 3 months) (Lin et al., 2001). The hypothesis of AHR density as a limiting factor in testis was further reinforced by the induction data in response to TCDD. CYP1A1 induction was hugely augmented in the transgenics compared with C57BL/6 mice implying that receptor concentration is a critical determinant of magnitude for this adaptive response to TCDD as well. It is possible that the same phenomenon would also occur in other tissues if endowed with similarly overexpressed AHR but this would require in vivo experimental verification. In any case, the new transgenic mouse lines may reveal novel aspects of AHR physiological functions and are well-suited as an exceptionally sensitive model for studies on testicular impacts of TCDD and other AHR agonists. It is of interest to note that in a recent paper the characteristically low expression levels of AHR and CYP1A1 in testicular Leydig cells were suggested to protect them from benzo[a] pyrene-induced apoptosis (Chung et al., 2007). Mediation of enzyme induction by TCDD In addition to their largely normal function in mouse physiology, the foreign receptors also proved to be highly capable of mediating typical responses to TCDD in all tissues explored. Of particular interest was the fact that the mouse native receptor seemed to only slightly outperform rat receptor subtypes in mediation of induction of classical dioxin-responsive drug-metabolizing enzymes despite

179

the fact that the context (e.g. critical interacting molecules such as ARNT and co-activators) are of mouse origin. This is even more surprising considering that the C57BL/6 mouse AHR seems to have a 2–8-fold higher binding affinity for TCDD than the rat AHR isoforms (Okey et al., 1979, 1989; Pohjanvirta et al., 1999). An interesting example for comparison with the present data is provided by embryonal palatal shelves. Human shelves have a 350-fold lower AHR mRNA concentration than mouse shelves. Moreover, human AHR binds TCDD with a ca. 10-fold weaker avidity than does mouse (C57BL/6) AHR. This combination results in 1500-fold poorer responsiveness to CYP1A1 induction by TCDD in human palatal shelves than in mouse (Abbott et al., 1999; Connor and Aylward, 2006). In the present study, AHR mRNA expression levels were, in most cases, largely reflected by the induction responses throughout the tissues and genes analyzed with little or no indication of differential binding abilities of the receptors. Only at the highest dose tested did a small difference emerge in favor of the mouse AHR consistent with its slightly greater efficacy. The single exception to this pattern was lung CYP1A1 mRNA which was elevated about twice as effectively in C57BL/6 mice as expected after the AHR “normalization”. On the other hand, no highest-dose enhancement (relative to construct lines) was discernible in C57BL/6 mice in CYP1B1 mRNA concentrations, probably implying that the maximal response for this transcript was not yet attained at the 5 μg/kg dose of TCDD. Among the transgenes, the DEL mice tended to display subtly greater inducibility than the other two lines across all genes and in both genders. This is in keeping with previous in vitro data on the constructs (Moffat et al., 2007). It is worth noting that a direct correlation between AHR concentrations and maximal induction does not lend support to the proposed idea of spare receptors (Hestermann et al., 2000) in liver, let alone testis. TCDD toxicity in the transgenic lines In contrast to the straight-forward correlation between construct (or mouse endogenous AHR) expression and inducibility of drugmetabolizing enzymes by TCDD, the acute toxicity of TCDD to mice carrying rat AHR transgenes or to C57BL/6 mice was not critically dependent on AHR mRNA levels. This conclusion is based on a number of independent but convergent lines of evidence. First, acute mortality was greater and liver toxicity more severe in male C57BL/6 mice compared with male INS mice although their AHR mRNA concentrations in tissues were similar, particularly in liver (in which their AHR protein concentrations were also measured and found to be similar). Second, there was a substantial inter-gender difference in susceptibility to the acute toxicity of TCDD in C57BL/6 mice in spite of equal AHR expression in liver between males and females. Third, as expected, TCDD had a prominent effect on body weight in the exposed mice. However, contrary to all other transgenic lines and C57BL/6 mice, INS mice displayed a significant enhancement in body weight gain in response to TCDD during the first week postexposure. This did not happen by chance, since in subsequent timecourse and dose–response studies the same phenomenon has consistently and dose-dependently (up to 500 μg/kg) occurred in both genders of INS mice (manuscript in preparation). Thus, activation of the AHR variants by a potent AHR agonist can lead to opposite biological outcomes in vivo, depending upon which AHR variant is present. Fourth, in thymus the INS variant was significantly more expressed than the rWT. Yet, subsequent studies have demonstrated the INS mice to be less sensitive to TCDD-elicited thymic atrophy than their rWT counterparts (manuscript in preparation). Fifth, co-expression of both mouse and rat AHRs caused a dramatic accentuation of TCDD toxicity in mice when the rWT receptor subtype was present, but not with the INS variant. Mice harboring both mouse AHR and rWT construct were actually more sensitive to TCDD lethality than animals with either of the two

180

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

receptors alone. The difference was most striking in females which totally lost their peculiar natural resistance when the rWT receptor isoform was present. In mice expressing rWT AHR alone, both genders appeared to be equally susceptible to TCDD, so the trait associated with rat AHR prevails in circumstances where C57BL/6 mouse native AHR and rat wild-type AHR are co-expressed. This tantalizing finding warrants further investigation but suggests an altered protein–protein interaction between the AHR and the estrogen receptor when the rWT isoform is expressed in mice. Based on macroscopic observations at necropsy, the major organ inflicted by TCDD exposure was the liver. The histopathological picture was not pathognomonic to the insult but was rather composed of features common to chemical toxicities in general. The type of liver damage was time-dependent so that liver lesions probably were the principal reason for the exceptionally early deaths (days 4–5) of some rWT mice but also a significant contributor to mortality at later timepoints as inferred from the correlation between mortality and the degree of hepatotoxicity among the mouse lines. Bile duct proliferation (which occasionally reached extreme proportions and was often associated with cholangiohepatitis) recorded in rWT, DEL and C57BL/ 6 mice implies strong and persistent periportal irritation by TCDD in these animals. In a previous study (Chang et al., 2005) it was found that while the highest expression of the AHR in untreated young male ICR mice occurred in centrilobular hepatocytes, exposure to a high dose of TCDD depleted the AHR from these cells protecting them from TCDD toxicity. Comparison with the rat model These new transgenic lines support the previous inferences from genetic experiments that the sensitivity difference in TCDD toxicity between L-E and H/W rats mainly emanates from dissimilarities in their AHR structures (Tuomisto et al., 1999). Both DEL and (foremost) INS mice exhibited more pronounced resistance to the acute lethality of TCDD than rWT mice, fully in keeping with the differential expression of these AHR variants in H/W and L-E rats. The most notable divergence in overt responses to toxic doses of TCDD between TCDD-sensitive L-E rats and TCDD-resistant H/W rats is discernible in the degree of body weight loss, a key index of the wasting syndrome. In L-E rats, doses over 20 μg/kg result in a precipitous and progressive decline of body weight until death ensues. In H/W rats, in contrast, body weight loss does not amount to greater than 10–15% even after 500-fold higher doses of TCDD (Pohjanvirta and Tuomisto, 1994). The transgenic mouse lines recapitulate this difference. However, mice with the INS isoform of rat AHR (the predominant form expressed in H/W rats) actually exhibited enhanced body weight gain in response to TCDD, which has not been seen in H/W rats. It could be dependent on co-regulating proteins whose concentrations might differ in mice and rats. The INS construct tended to be highly expressed in the brain, which may contribute to the outcome. Although insertion of the INS construct in a chromosomal region involved in the control of appetite or energy metabolism cannot be ruled out, the intriguing bidirectional response may suggest interference of AHR signaling with body weight regulation and is worth further studies. A characteristic feature of the rat model is highly similar induction of AHR-regulated drug-metabolizing enzymes by TCDD in the two strains (Pohjanvirta et al., 1988). The transgenic mouse lines reproduced this phenomenon; especially so, if the enzyme mRNA levels were normalized to tissue AHR concentrations. The mouse lines also shed new light into the question of the role of enzyme induction in TCDD toxicity. The rat model has suggested previously that elevated expression of the classic set of dioxin-inducible genes by TCDD is not likely to be causally related with the acute lethality of TCDD in this species. Notwithstanding findings in rats, research on knockout mice has provided evidence in favor of a significant mechanistic role for CYP1A1 induction in the acute toxicity of TCDD in mice (Uno et al.,

2004). In the present induction experiment, mRNA concentrations of drug-metabolizing enzymes, including CYP1A1, did not appreciably differ in rWT, DEL and C57BL/6 mice at the highest dose (apart from testis in which there was huge overexpression in all transgenics); in INS mice they were usually ca. 50% of the highest concentration. The induction also reached or was approaching its peak at this dose (5 μg/ kg). Yet, there were remarkable deviations among the mice in both general and liver-specific toxicity of TCDD, e.g. between female rWT and C57BL/6 mice. Thus, neither induction potency nor induction efficacy for the Cyp1a1 gene correlated with TCDD toxicity. If CYP1A1 induction is indeed a prerequisite to TCDD toxicity in mice, it is clearly only one of the key determinants. At tissue level, the organ most conspicuously affected in TCDDsensitive transgenic mice was the liver. In TCDD-resistant INS mice, liver lesions were far less severe. Liver is also a site of differential TCDD toxicity in L-E and H/W rats, although the histological features are not identical in rats and mice (Pohjanvirta et al., 1989). Interestingly, giant multinuclear hepatocytes, which constitute a typical morphologic response to non-lethal and lethal doses of dioxin congeners in rats (Pohjanvirta et al., 1995) but are uncommon in mice, were not seen in the transgenics. They rather tended to exaggerate impacts typical of the mouse liver response with some extreme cases of almost total replacement of liver parenchyme by epithelial cells of bile ducts. On the other hand, thymus atrophy occurs in a much the same manner in both L-E and H/W rats (Pohjanvirta et al., 1989), but our recent studies in the transgenic mouse lines revealed that INS mice are highly insensitive to this impact in the face of the overexpressed AHR in thymus. It is conceivable that the co-expressed DEL variant in H/W rats is sufficient to render them susceptible to thymus atrophy. Taken together, the novel transgenic AHR-“ratonized” mice (I personally prefer calling them AHR-RATionalized mice) provide an exciting and promising animal model for studies on various aspects of dioxin toxicity, such as its effects on body weight regulation and on testicular function. They can further help elucidate the in vivo role of the TAD in AHR signal transduction and the interactions of the AHR with other proteins involved in transcriptional control including the estrogen receptor. Acknowledgments I want to thank Prof. (emer.) Allan B. Okey for highly thoughtful and useful suggestions and comments on the manuscript. I am also very grateful for the indispensable help provided by the following persons: Janne Korkalainen and Leena Haatainen (assistance in animal experiments and in breeding of the mice), Ulla Naukkarinen (assistance in animal experiments and extraction of gDNA), Arja Tamminen (extraction of nucleic acids and proteins, preparation of TCDD solutions), Susanna Lukkarinen (running AHR Westerns with chemiluminescence detection), Dr. Merja Korkalainen (assistance in preparation of the CMV-constructs), Seija Haatanen (preparation of histopathological slides), Dominique Wendelin (guidance with the densitometric analysis) and Jere Lindén (assistance in photographing the supplementary microscopic images). This work was financially supported by the Academy of Finland (Grant no. 123345). The funding source had no role in the design or conduct of the study. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.taap.2009.01.005. References Abbott, B.D., Held, G.A., Wood, C.R., Buckalew, A.R., Brown, J.G., Schmid, J., 1999. AhR, ARNT, and CYP1A1 mRNA quantitation in cultured human embryonic palates exposed to TCDD and comparison with mouse palate in vivo and in culture. Toxicol. Sci. 47, 62–75.

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182 Alaluusua, S., Lukinmaa, P.L., 2006. Developmental dental toxicity of dioxin and related compounds — a review. Int. Dent. J. 56, 323–331. Beatty, P.W., Vaughn, W.K., Neal, R.A., 1978. Effect of alteration of rat hepatic mixedfunction oxidase (MFO) activity on the toxicity of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). Toxicol. Appl. Pharmacol. 45, 513–519. Bell, A.C., West, A.G., Felsenfeld, G., 2001. Insulators and boundaries: versatile regulatory elements in the eukaryotic genome. Science 291, 447–450. Birnbaum, L.S., Tuomisto, J., 2000. Non-carcinogenic effects of TCDD in animals. Food Addit. Contam. 17, 275–288. Boutros, P.C., Moffat, I.D., Franc, M.A., Tijet, N., Pohjanvirta, R., Tuomisto, J., Okey, A.B., 2004. Dioxin-responsive AHRE-II gene battery: identification by phylogenetic footprinting. Biochem. Biophys. Res. Commun. 321, 707–715. Chang, H., Wang, Y.-J., Chang, L.W., Lin, P., 2005. A histochemical and pathological study on the interrelationship between TCDD-induced AhR expression, AhR activation, and hepatotoxicity in mice. J. Toxicol. Environ. Health A 68, 1567–1579. Chung, J.Y., Kim, J.Y., Kim, Y.J., Jung, S.J., Park, J.E., Lee, S.G., Kim, J.T., Oh, S., Lee, C.J., Yoon, Y.D., Yoo, Y.H., Kim, J.M., 2007. Cellular defense mechanisms against benzo[a]pyrene in testicular Leydig cells: implications of p53, aryl-hydrocarbon receptor, and cytochrome P450 1A1 status. Endocrinology 148, 6134–6144. Cieplik, M.K., Carbonell, J.P., Muñoz, C., Baker, S., Krüger, S., Liljelind, P., Marklund, S., Louw, R., 2003. On dioxin formation in iron ore sintering. Environ. Sci. Technol. 37, 3323–3331. Connor, K.T., Aylward, L.L., 2006. Human response to dioxin: aryl hydrocarbon receptor (AhR) molecular structure, function, and dose–response data for enzyme induction indicate an impaired human AhR. J. Toxicol. Environ. Health B Crit. Rev. 9, 147–171. Consonni, D., Pesatori, A.C., Zocchetti, C., Sindaco, R., D'Oro, L.C., Rubagotti, M., Bertazzi, P.A., 2008. Mortality in a population exposed to dioxin after the Seveso, Italy, accident in 1976: 25 years of follow-up. Am. J. Epidemiol. 167, 847–858. Denison, M.S., Nagy, S.R., 2003. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu. Rev. Pharmacol. Toxicol. 43, 309–334. Fiedler, H., 2007. National PCDD/PCDF release inventories under the Stockholm Convention on Persistent Organic Pollutants. Chemosphere 67, S96–S108. Freeman, J.L., Perry, G.H., Feuk, L., Redon, R., McCarroll, S.A., Altshuler, D.M., Aburatani, H., Jones, K.W., Tyler-Smith, C., Hurles, M.E., Carter, N.P., Scherer, S. W., Lee, C., 2006. Copy number variation: new insights in genome diversity. Genome Res. 16, 949–961. Furness, S.G.B., Lees, M.J., Whitelaw, M.L., 2007. The dioxin (aryl hydrocarbon) receptor as a model for adaptive responses of bHLH/PAS transcription factors. FEBS Lett. 581, 3616–3625. Harper, P.A., Riddick, D.S., Okey, A.B., 2006. Regulating the regulator: factors that control levels and activity of the aryl hydrocarbon receptor. Biochem. Pharmacol. 72, 267–279. Harstad, E.B., Guite, C.A., Thomae, T.L., Bradfield, C.A., 2006. Liver deformation in Ahr-null mice: evidence for aberrant hepatic perfusion in early development. Mol. Pharmacol. 69, 1534–1541. Hedman, B., Näslund, M., Nilsson, C., Marklund, S., 2005. Emissions of polychlorinated dibenzodioxins and dibenzofurans and polychlorinated biphenyls from uncontrolled burning of garden and domestic waste (backyard burning). Environ. Sci. Technol. 39, 8790–8796. Henikoff, S., 1998. Conspiracy of silence among repeated transgenes. Bioessays 20, 532–535 1998. Hestermann, E.V., Stegeman, J.J., Hahn, M.E., 2000. Relative contributions of affinity and intrinsic efficacy to aryl hydrocarbon receptor ligand potency. Toxicol. Appl. Pharmacol. 168, 160–172. Hong, S., Kim, T.-W., Choi, I., Woo, J.-M., Oh, J., Park, W.J., Kim, D.H., Cho, C., 2005. Complementary cloning, genomic characterization and expression analysis of a mammalian gene encoding histidine-rich calcium binding protein. Biochim. Biophys. Acta 1727, 188–196. Houdebine, L.-M., 2002. The methods to generate transgenic animals and to control transgene expression. J. Biotechnol. 98, 145–160. Houdebine, L.-M., Attal, J., Vilotte, J.L., 2003. Vector design for transgene expression, In: Pinkert, C.A. (Ed.), Transgenic Animal Technology: A Laboratory Handbook, 2nd edition. Academic Press, San Diego, pp. 419–458. Knerr, S., Schrenk, D., 2006. Carcinogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in experimental models. Mol. Nutr. Food Res. 50, 897–907. Lahvis, G.P., Bradfield, C.A., 1998. Ahr null alleles: distinctive or different? Biochem. Pharmacol. 56, 781–787. Li, H., Yu, L., Sheng, G., Fu, J., Peng, P., 2007. Severe PCDD/F and PBDD/F pollution in air around an electronic waste dismantling area in China. Environ. Sci. Technol. 41, 5641–5646. Lin, T.-M., Ko, K., Moore, R.W., Buchanan, D.L., Cooke, P.S., Peterson, R.E., 2001. Role of the aryl hydrocarbon receptor in the development of control and 2,3,7,8tetrachlorodibenzo-p-dioxin-exposed male mice. J. Toxicol. Environ. Health (A) 64, 327–342. Ma, Q., 2001. Induction of CYP1A1. The AhR/DRE paradigm: transcription, receptor regulation, and expanding biological roles. Curr. Drug Metab. 2, 149–164. Mocarelli, P., Gerthoux, P.M., Ferrari, E., Patterson Jr., D.G., Kieszak, S.M., Brambilla, P., Vincoli, N., Signorini, S., Tramacere, P., Carreri, V., Sampson, E.J., Turner, W.E., Needham, L.L., 2000. Paternal concentrations of dioxin and sex ratio of offspring. Lancet 355, 1858–1863. Moffat, I.D., Roblin, S., Harper, P., Okey, A.B., Pohjanvirta, R., 2007. Aryl hydrocarbon receptor splice variants in the dioxin-resistant rat: tissue expression and transactivational activity. Mol. Pharmacol. 72, 956–966.

181

Nguyen, H.M., Tu, B.M., Watanabe, M., Kunisue, T., Monirith, I., Tanabe, S., Sakai, S., Subramanian, A., Sasikumar, K., Pham, H.V., Bui, C.T., Tana, T.S., Prudente, M.S., 2003. Open dumping site in Asian developing countries: a potential source of polychlorinated dibenz-p-dioxins and polychlorinated dibenzofurans. Environ. Sci. Technol. 37, 1493–1502. Niittynen, M., Tuomisto, J.T., Auriola, S., Pohjanvirta, R., Syrjälä, P., Simanainen, U., Viluksela, M., Tuomisto, J., 2003. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces accumulation of biliverdin and hepatic peliosis in TCDD-semiresistant rats. Toxicol. Sci. 71, 112–123. Okey, A.B., 2007. An aryl hydrocarbon receptor odyssey to the shores of toxicology: the Deichmann lecture, International Congress of Toxicology-XI. Toxicol. Sci. 98, 5–38 2007. Okey, A.B., Bondy, G.P., Mason, M.E., Kahl, G.F., Eisen, H.J., Guenthner, T.M., Nebert, D.W., 1979. Regulatory gene product of the Ah locus. Characterization of the cytosolic inducer-receptor complex and evidence for its nuclear translocation. J. Biol. Chem. 254, 11636–11648. Okey, A.B., Vella, L.M., Harper, P.A., 1989. Detection and characterization of a low affinity form of cytosolic Ah receptor in livers of mice nonresponsive to induction of cytochrome P1-450 by 3-methylcholanthrene. Mol. Pharmacol. 35, 823–830. Overbeek, P.A., 1994. Factors affecting transgenic animal production, In: Pinkert, C.A. (Ed.), Transgenic Animal Technology: A Laboratory Handbook, 1st edition. Academic Press, San Diego, pp. 69–114. Pelclová, D., Urban, P., Preiss, J., Lukás, E., Fenclová, Z., Navrátil, T., Dubská, Z., Senholdová, Z., 2006. Adverse health effects in humans exposed to 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD). Rev. Environ. Health. 21, 119–138. Petrulis, J.R., Perdew, G.H., 2002. The role of chaperone proteins in the aryl hydrocarbon receptor core complex. Chem.-Biol. Interact. 141, 25–40. Pohjanvirta, R., 1990. TCDD resistance is inherited as an autosomal dominant trait in the rat. Toxicol. Lett. 50, 49–56. Pohjanvirta, R., Tuomisto, J., 1987. Han/Wistar rats are exceptionally resistant to TCDD. II. Arch. Toxicol., Suppl. 11, 344–347. Pohjanvirta, R., Tuomisto, J., 1994. Short-term toxicity of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) in laboratory animals: effects, mechanisms, and animal models. Pharmacol. Rev. 46, 483–549. Pohjanvirta, R., Tuomisto, J., Vartiainen, T., Rozman, K., 1987. Han/Wistar rats are exceptionally resistant to TCDD. I. Pharmacol. Toxicol. 60, 145–150. Pohjanvirta, R., Juvonen, R., Kärenlampi, S., Raunio, H., Tuomisto, J., 1988. Hepatic Ahreceptor levels and the effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on hepatic microsomal monooxygen¬ase activities in a TCDD-susceptible and -resis¬tant rat strain. Toxicol. Appl. Pharmacol. 92, 131–140. Pohjanvirta, R., Kulju, T., Morselt, A.F.W., Tuominen, R., Juvonen, R., Rozman, K., Männistö, P., Collan, Y., Sainio, E.-L., Tuomisto, J., 1989. Target tissue morphology and serum bio¬chemistry following 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure in a TCDD-susceptible and a TCDD-resistant rat strain. Fundam. Appl. Toxicol. 12, 698–712. Pohjanvirta, R., Tuomisto, J., Vartiainen, T., Uusi-Rauva, A., Mönkkönen, J., 1990. Tissue distribution, metabolism, and excretion of 14C-TCDD in a TCDD-susceptible and a TCDD-resistant rat strain. Pharmacol. Toxicol. 66, 93–100. Pohjanvirta, R., Unkila, M., Tuomisto, J., 1993. Comparative acute lethality of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 1,2,3,7,8-pentadibenzo-p-dioxin and 1,2,3,4,7,8-hexadibenzo-p-dioxin in the most TCDD-susceptible and the most TCDD-resistant rat strain. Pharmacol. Toxicol. 73, 52–56. Pohjanvirta, R., Unkila, M., Lindén, J., Tuomisto, J.T., Tuomisto, J., 1995. Toxic equivalency factors do not predict the acute toxicities of dioxins in rats. Eur. J. Pharmacol. 293, 341–353. Pohjanvirta, R., Wong, J.M.Y., Li, W., Harper, P.A., Tuomisto, J., Okey, A.B., 1998. Point mutation in intron sequence causes altered carboxyl-terminal structure in the aryl hydrocarbon receptor of the most 2,3,7,8-tetrachlorodibenzo-p-dioxin-resistant rat strain. Mol. Pharmacol. 54, 86–93. Pohjanvirta, R., Viluksela, M., Tuomisto, J.T., Unkila, M., Karasinska, J., Holowenko, M., Franc, M., Giannone, J.G., Harper, P.A., Tuomisto, J., Okey, A.B., 1999. Physicochemical differences in the AH receptors of the most TCDD-susceptible and the most TCDDresistant rat strains. Toxicol. Appl. Pharmacol. 155, 71–81. Pohjanvirta, R., Niittynen, M., Lindén, J., Boutros, P.C., Moffat, I.D., Okey, A.B., 2006. Evaluation of various housekeeping genes for their applicability for normalization of mRNA expression in dioxin-treated rats. Chem.-Biol. Interact. 160, 134–149. Schecter, A., Birnbaum, L., Ryan, J.J., Constable, J.D., 2006. Dioxins: an overview. Environ. Res. 101, 419–428. Simanainen, U., Tuomisto, J.T., Tuomisto, J., Viluksela, M., 2002. Structure–activity relationships and dose responses of polychlorinated dibenzo-p-dioxins for shortterm effects in 2,3,7,8-tetrachlorodibenzo-p-dioxin-resistant and -sensitive rat strains. Toxicol. Appl. Pharmacol. 181, 38–47. Sweeney, M.H., Mocarelli, P., 2000. Human health effects after exposure to 2,3,7,8-TCDD. Food Addit. Contam. 17, 303–316. Taboit-Dameron, F., Malassagne, B., Viglietta, C., Puissant, C., Leroux-Coyau, M., Chéreau, C., Attal, J., Weill, B., Houdebine, L.-M., 1999. Association of the 5′HS4 sequence of the chicken β-globin locus control region with human EF-1α gene promoter induces ubiquitous and high expression of human CD55 and CD59 cDNAs in transgenic rabbits. Transg. Res. 8, 223–235. Tijet, N., Boutros, P.C., Moffat, I.D., Okey, A.B., Tuomisto, J., Pohjanvirta, R., 2006. The aryl hydrocarbon receptor regulates distinct dioxin-dependent and dioxin-independent gene batteries. Mol. Pharmacol. 69, 140–153. Truett, G.E., Heeger, P., Mynatt, R.L., Truett, A.A., Walker, J.A., Warman, M.L., 2000. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 29, 52–54.

182

R. Pohjanvirta / Toxicology and Applied Pharmacology 236 (2009) 166–182

Tuomisto, J.T., Viluksela, M., Pohjanvirta, R., Tuomisto, J., 1999. The AH receptor and a novel gene determine acute toxic responses to TCDD: segregation of the resistance alleles to different rat lines. Toxicol. Appl. Pharmacol. 155, 82–95. Unkila, M., Pohjanvirta, R., MacDonald, E., Tuomisto, J.T., Tuomisto, J., 1994. Dose response and time course of alterations in tryptophan metabolism by 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) in the most TCDD-susceptible and the most TCDD-resistant rat strain: relationship with TCDD lethality. Toxicol. Appl. Pharmacol. 128, 280–292. Unkila, M., Pohjanvirta, R., Tuomisto, J., 1992. Acute toxicity of perfluorodecanoic acid and cobalt protoporphyrin in a TCDD-sensitive and a TCDD-resistant rat strain. Chemosphere 25, 1233–1239.

Uno, S., Dalton, T.P., Sinclair, P.R., Gorman, N., Wang, B., Smith, A.G., Miller, M.L., Shertzer, H.G., Nebert, D.W., 2004. Cyp1a1(−/−) male mice: protection against high-dose TCDD-induced lethality and wasting syndrome, and resistance to intrahepatocyte lipid accumulation and uroporphyria. Toxicol. Appl. Pharmacol. 196, 410–421. Walisser, J.A., Bunger, M.K., Glover, E., Bradfield, C.A., 2004. Gestational exposure of Ahr and Arnt hypomorphs to dioxin rescues vascular development. Proc. Natl. Acad. Sci. U. S. A. 101, 16677–16682. Watkins-Chow, D.E., Pavan, W.J., 2008. Genomic copy number and expression variation within the C57BL/6J inbred mouse strain. Genome Res. 18, 60–66. Whitlock Jr., J.P., 1999. Induction of cytochrome P4501A1. Annu. Rev. Pharmacol. Toxicol. 39, 103–125.