Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination

NSC 19350

No. of Pages 12

7 November 2019

NEUROSCIENCE 1

RESEARCH ARTICLE U. Singh et al. / Neuroscience xxx (2018) xxx–xxx

4

Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination

5 6

Uday Singh, a,b12 Manoj Upadhya, c13 Sumela Basu, a,b Omprakash Singh, a,b Santosh Kumar, a,b4 Dadasaheb M. Kokare c and Praful S. Singru a,b*

7

a

8

b

Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400094, India

9

c

Department of Pharmaceutical Sciences, R.T.M. Nagpur University, Nagpur 440 033, Maharashtra, India

3 2

11 10

School of Biological Sciences, National Institute of Science Education and Research (NISER)-Bhubaneswar, Odisha 752050, India

Abstract—Thermosensitive transient receptor potential vanilloid (TRPV) channels are widely expressed in the brain and known to profoundly influence Ca2+-signaling, neurotransmitter release and behavior. While these channels are expressed in the cerebellum, neuronal firing and hyperactivity/reflexes seem associated with cerebellar temperature modulation. However, the distribution and functional significance of TRPV-equipped elements in the cerebellum has remained unexplored. Among TRPV sub-family, TRPV3 is regulated by temperature within physiological range and its transcript highly expressed in the brain. The study aims at exploring the relevance of TRPV3 in the cerebellum of developing and adult rat. RT-PCR analysis showed expression of N- and C-terminal fragments of TRPV3-mRNA in the adult rat cerebellum. Using double immunofluorescence, TRPV3immunoreactivity was observed in Calbindin D28K-labeled Purkinje neurons. The sections of cerebellum from the postnatal rats (P4, P8, P16 and P42) were processed for TRPV3-immunofluorescence. Compared to P4 and P8, the percent fluorescent area of TRPV3-immunoreactivity significantly increased in the cerebellum of P16 and P42 rats. With a view to test the significance of TRPV3 in cerebellar function, TRPV3-agonist (eugenol) or inhibitors [ruthenium red or isopentenyl pyrophosphate (IPP)] were administered stereotaxically intracerebellum and motor responses analyzed. Compared to controls, rats injected with TRPV3 inhibitor significantly reduced the stride length (P < 0.001), locomotor activity (P < 0.001), and rotarod retention time (P < 0.001), but increased footprints length (P < 0.01) and escape latency (P < 0001). TRPV3-agonist treatment, however, had no effect on these behaviors. We suggest that TRPV3 in Purkinje neurons may serve as novel molecular component for Ca2+-signaling and motor coordination function of the cerebellum. Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved.

Key words: cerebellum, motor coordination, Purkinje neurons, TRPV3.

*Correspondence to: P.S. Singru, School of Biological Sciences, National Institute of Science Education and Research (NISER), Jatni, Khorda 752050, Odisha, India. Fax: +91-674-2494004. E-mail address: [email protected] (P. S. Singru). 1 First two authors have contributed equally. 2 Department of Pharmacology, University of Iowa Carver College of Medicine, Iowa City, USA. 3 Neuroscience and Pharmacy Department, School of Life & Health Sciences, Aston University, B47ET, Birmingham, UK. 4 Department of Biochemistry and Molecular Medicine, University of California at Davis, School of Medicine, Institute for Pediatric Regenerative Medicine, Shriners Hospital for Children Northern California, Sacramento, USA. Abbreviations: AMPA, a-amino-3-hydroxy-5-methyl-4-isoxazolepropio nic acid; BT, biotin-tyramide; BW, body weight; DMSO, dimethyl sulfoxide; IAEC, Institutional Animal Ethics Committees, i.p., intraperitoneal; IPP, isopentenyl pyrophosphate; MWM, Morris water maze; NMDA, N-methyl-D-aspartate; OFT, open field test; PFA, paraformaldehyde; PWL, paw withdrawal latency; TRPV3, transient receptor potential vanilloid 3; TRPV, thermosensitive transient receptor potential vanilloid; TRP, transient receptor potential.

INTRODUCTION

12

Coordinated motor activities including movements of eyes and limbs, defense mechanism, balance, and regulation of physiological activities are some of the key functions controlled by the cerebellum (McKay and Turner, 2005). Purkinje neurons are important component of the cerebellum located in a row throughout the cerebellar border of the granular and molecular layers (Voogd and Glickstein, 1998). These cells serve as integrative center for the sensory inputs and provide output for downstream actions (Crepel et al., 1976). Calcium homeostasis is necessary for Purkinje cell survival as well for its sensory and cellular activity (Duen˜as et al., 2006). The disrupted intracellular calcium homeostasis in Purkinje neurons due to alteration in the voltage-gated Ca2+ currents or genes encoding Ca2+ channel subunits, causes neuronal dysfunctions resulting in ataxia and altered motor activity (Pietrobon, 2002;

13

https://doi.org/10.1016/j.neuroscience.2019.10.047 0306-4522/Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved. 1 Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

NSC 19350

No. of Pages 12

7 November 2019

2 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

Servais et al., 2007). Evidence suggest that the Purkinje neurons are equipped with a range of Ca2+ channels including the high voltage activated (P/Q-, L-, and Ntype), low voltage activated (T- and R-type) (Usowicz et al., 1992; Huguenard, 1996; Iwasaki et al., 2000; Cavelier and Bossu, 2003; Womack and Khodakhah, 2004; Leitch et al., 2009; Hashimoto et al., 2011), and the classical voltage-activated Ca2+ channels including the ligand-gated Ca2+ channels including the a-amino-3 -hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) (Balchen and Diemer, 1992) and N-methyl-D-aspartate (NMDA) (Piochon et al., 2010) receptors. In addition, ion channels located on the endoplasmic reticulum, Ca2+ binding proteins, and Ca2+ pumps also play role in regulating Ca2+ signaling in Purkinje neurons (Empson and Kno¨pfel, 2012; Gruol et al., 2012). In recent years, growing evidence show the presence and importance of transient receptor potential (TRP) ion channels in the brain and neural regulation (Kauer and Gibson, 2009). These ion channels are integral membrane proteins, function as cationic channels, and regulate sensory and cellular functions (Clapham, 2003; Venkatachalam and Montell, 2007; Kauer and Gibson, 2009; Jardı´ n et al., 2017). The TRP superfamily consist of six sub-families viz. canonical (TRPC), vanilloid (TRPV), ankyrin (TRPA), melastatin (TRPM), polycystic (TRPP), and mucolipin (TRPML) based on their sequence homology (Flockerzi, 2007; Venkatachalam and Montell, 2007; Flockerzi and Nilius, 2014). Recently, mRNA analysis showed the presence of transcripts for TRP ion channels in the cerebellum (Kunert-Keil et al., 2006). While TRPM3 and TRPC1 are located at the parallel fiberPurkinje cell synapses, their modulation generate slow excitatory postsynaptic conductance (Kim et al., 2003) and release of the neurotransmitters (Hoffmann et al., 2010; Zamudio-Bulcock et al., 2011). Cerebellar TRPC3 expression peaks during the third week of postnatal development (Becker et al., 2009) and a point mutation (T635A) in a conserved residue of TRPC3 leads to reduced dendritic arborization of Purkinje neurons during development, progressive loss of Purkinje neurons, and cerebellar ataxia (Becker et al., 2009). Compared to other TRP ion channels, lower expression of TRPV sub-family members of ion channels was observed in the cerebellum (Kunert-Keil et al., 2006). In mice, while TRPV1 immunoreactivity was observed in the presynaptic terminals around the cell body and axons of the Purkinje neurons (Cristino et al., 2006), expression of other TRPV channels has been demonstrated in the cerebellum (Kunert-Keil et al., 2006; Kumar et al., 2017a,b). Purkinje cells show complex trimodal firing pattern which is age dependent and sensitive to temperature (Womack and Khodakhah, 2002). In ex vivo cerebellum slices, a 3 °C decrease in temperature from 35 °C resulted in loss of firing in Purkinje neurons (Womack and Khodakhah, 2002). In the goldfish, initial hyperactivity, enhancement of reflexes, and activity of Purkinje neurons were observed following moderate cooling and heating of animal as well as following increasing the cerebellar temperature by thermode (Friedlander et al., 1976). Similarly, the cultured rat cerebellar neurons were spontaneously active but

cooling at 18 °C ceased their neuronal activity (Ga¨hwiler et al., 1972). The nature of cerebellar elements equipped with thermosensitive TRPV channels and their functional significance, however, has remained unexplored. Unlike other members in the TRPV subfamily, TRPV3 is gated by temperature between 31 and 39 °C (Peier et al., 2002; Xu et al., 2002), uniquely sensitive around 37 °C, and is highly expressed in the brain as compared to other tissues (Xu et al., 2002). In a pilot study, we observed TRPV3 mRNA expression in the cerebellum of rat. RT-PCR was employed to find out whether the full length TRPV3 mRNA transcript is expressed in the cerebellum of rat. Immunofluorescence using TRPV3 specific antiserum was used to find out whether Purkinje neurons in the cerebellum of adult and developing rats are equipped with TRPV3. Finally, to test the significance of the ion channel in cerebellar function, TRPV3 agonist or inhibitors were administered intra-cerebellum of rat and their effects on motor functions were analyzed.

MATERIALS AND METHODS

92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109

110

Animals

111

Adult, male, Wistar rats (250–280 g) were used in this study. Animals were housed in temperature-controlled room (22 ± 1 °C) with light between 6:00 and 18:00 h, and access to water and food ad libitum. All the experimental procedures were approved by the Institutional Animal Ethics Committees (IAEC) at NISER, Bhubaneswar and Department of Pharmaceutical Sciences, Nagpur University, Nagpur.

112

Total RNA isolation and RT-PCR analysis

120

Rats were anaesthetized (n = 3) with an intraperitoneal (i.p.) injection of mixture of ketamine [Neon Laboratories Ltd., Mumbai, India; 100 mg/kg body weight (BW)] and xylazine (Stanex Drugs and Chemicals Pvt. Ltd., Hyderabad, India; 10 mg/kg BW). Animals were decapitated and cerebellum of each animal was isolated in sterile condition. The tissue samples were processed for RNA isolation and RT-PCR analysis as previously described (Singh et al., 2016b). The total RNA was isolated, cDNA was synthesized and amplified using Taq DNA Polymerases (NEB) at 60 °C. The C- and Nterminus TRPV3 were amplified using primers specific to rat TRPV3 [C-terminus – forward: CGACGCGGTGCTGGAGCTCAA and reverse: CCATTCCGTCCACTTCACCTCGT; N-terminus – forward: ACCCCATCCAATCCCAACAGTCC and reverse: CAGGGGCGTCTCACCAAAATAG] (Guatteo et al., 2005; Singh et al., 2016b). The PCR product was analyzed on 1% agarose gel. Image of the gel was acquired using FluorChem E gel documentation system (ProteinSimple, CA, USA) and edited in Adobe Photoshop.

121

Tissue preparation and immunofluorescence

143

Rats (n = 5) were anesthetized with an i.p. injection of mixture of ketamine (100 mg/kg BW) and xylazine

144

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

91

113 114 115 116 117 118 119

122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142

145

NSC 19350

No. of Pages 12

7 November 2019

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200

201 202 203 204 205

(10 mg/kg BW) and perfused, transcardially with 100 ml of phosphate buffer saline (PBS: 0.2 M, pH 7.4) followed by 4 % paraformaldehyde (PFA) in phosphate buffer (0.1 M, pH 7.4). Brains were dissected out and post-fixed overnight in 4 % PFA at 4 °C, cryoprotected in 25 % sucrose solution in PBS, and were sectioned through the rostro-caudal extent of the cerebellum on a cryostat (CM3050S, Leica) to obtain three sets of 25 mm thick free-floating coronal sections in PBS. The sections were stored at
20 °C in anti-freezing solution until used further. For TRPV3 immunofluorescence, biotin-tyramide (BT) amplification protocol was employed as described previously (Singh et al., 2016b). One set of cerebellar sections from each animal were rinsed in PBS and treated with 0.5% Triton X-100 in PBS for 20 min. Sections were incubated in 3% normal horse serum in PBS for 30 min and incubated overnight at 4 °C in polyclonal rabbit antiTRPV3 antiserum (1:5000, Sigma). The sections were incubated in biotinylated goat anti-rabbit IgG (Vector Laboratories, USA) and the immunoreaction was amplified using Alexa FluorTM 488 Tyramide SuperboostTM kit (Cat. # B40922; ThermoFisher Scientific). After rinsing in PBS, sections were mounted on glass slides, coverslipped with mounting medium containing (Vector). Double immunofluorescence was employed to find out whether Purkinje neurons in the cerebellum co-express TRPV3. One set of coronal sections through the rostrocaudal extent of the cerebellum of each animal were rinsed in PBS, treated with 0.5% triton X-100 in PBS for 20 min, and immersed in 3% normal horse serum for 30 min. Sections were incubated overnight at 4 °C in a mixture of polyclonal rabbit anti-TRPV3 antiserum (1:5000) and mouse monoclonal Calbindin D28K (1:500, Sigma, Cat. # C9848) antibody. TRPV3 was amplified using BT amplification as described above. Calbindin D28k was visualized using AlexaFluor-594 conjugated anti-mouse IgG (Life Technologies, 1:500). The sections were washed in PBS, mounted on glass slides, and coverslipped using mounting medium (Vector). To find out whether the Purkinje neurons are equipped with TRPV3 during postnatal stages of development, brains of rats (P4, P8, P16, and P42; n = 3 each stage) were dissected out, cerebellum sectioned, and the sections were prepared for TRPV3 immunofluorescence as described above. The specificity of the TRPV3 antiserum used in the present study has already been established (Singh et al., 2016b). The TRPV3 antiserum was replaced with normal serum and the sections were processed for immunofluorescence as described above. The sections were observed under an AxioImager M2 fluorescence microscope (Carl Zeiss), images were captured using AxioCam Camera (Carl Zeiss), adjusted for brightness and contrast and merged using Adobe Photoshop CS6 software. Stereotaxic surgery for intra-cerebellum drug administration Intra-cerebellum cannulations and drug infusions were performed as per the procedure reported previously (Upadhya et al., 2012; Shelkar et al., 2015). Briefly, the

3

rats were anesthetized with an intraperitoneal injection of a mixture of ketamine (Themis Medicare Ltd., India; 100 mg/kg body weight) and xylazine (Indian Immunologicals Ltd., India; 10 mg/kg body weight). Under stereotaxic control, the stainless steel guide cannulae (Kokare et al., 2011) were implanted bilaterally in the cerebellum using coordinates AP:
11.6 mm, DL: ± 2.3 mm, DV:
4.6 mm (Paxinos and Watson, 1998). The cannulae were secured with stainless steel screws and dental cement, and the injector was designed to project 0.5 mm below the guide cannula. Post-surgical care was taken during the recovery period. The rats were allowed to recover from the surgery for 7 days and subjected to training for behavioral assays.

206

Intra-cerebellum TRPV3 agonist and inhibitor administration

220

Ruthenium red (Sigma), eugenol (Sigma), and isopentenyl pyrophosphate (IPP, Echelon Biosciences) were administered intra-cerebellum. Eugenol has previously been used as TRPV3-agonist (Xu et al., 2006; Vogt-Eisele et al., 2007; Singh et al., 2016b). Ruthenium red and IPP serves as TRPV3-inhibitors (Bang et al., 2011; Pires et al., 2015). Just before the injections, eugenol was dissolved in dimethyl sulfoxide (DMSO) and the freshly prepared stock solution was further diluted in artificial cerebrospinal fluid (aCSF) such that the final concentration of DMSO was less than 0.05% in both vehicle as well as eugenol-treated groups. IPP was dissolved in aCSF as described previously (Singh et al., 2016b). The rats were randomly divided in different groups (n = 6–8/group) and subjected to the intra-cerebellum injection of (i) vehicle (0.5 ml/side/rat), (ii) eugenol (250 ng/0.5 ml/side/rat), (iii) IPP (50 ng/0.5 ml/ side/rat) or (iv) ruthenium red (25 ng/0.5 ml/side/rat). The animals were subjected to toe footprint analyses, locomotor activity, walking pattern, swimming speed, and retention time on a rotating rod, as described below.

222

Behavioral assays

243

Toe footprint analyses. To quantify the gait abnormalities, method described by Klapdor et al. (1997) was employed. Briefly, the rats were allowed to walk on an inclined gangway (100 cm  12 cm  10 cm with 30° inclination) leading to a darkened enclosure. The gangway was lined with white paper and the foreand hind-paws of the animals were dipped in two different non-toxic water colors to monitor the footprints. The walking pattern was recorded twice for each animal, after which the colors on toes were washed off; wet areas were dried and returned to their cages. The footprints were analyzed for parameters viz. footprint length and stride length.

244

Locomotor count using actophotometer. Locomotor activity was monitored in rats with an actophotometer (Centroniks Electronic, India) of 38 cm diameter and 16 cm height, equipped with photocells that automatically recorded the movements of rat (Goyal

257

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

207 208 209 210 211 212 213 214 215 216 217 218 219

221

223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242

245 246 247 248 249 250 251 252 253 254 255 256

258 259 260 261

NSC 19350

No. of Pages 12

7 November 2019

4 262 263 264 265 266 267 268 269 270

271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290

291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

et al., 2006). Any movement of the rat that interrupted photo beam was recorded as a motor count. Each rat was injected aCSF or TRPV3 modulators intracerebellum in their home cages and placed in the actophotometer 15 min after the treatment. Spontaneous locomotor activity of each rat was measured for 10 min. Animals were used only once and after each test the actophotometer grid floor was carefully cleaned. The data is expressed as mean number of counts per 10 min. Number of crossovers using open field test (OFT). Although OFT is used to study the anxiety-like behavior in rodents, it is also routinely employed and validated animal paradigm to assess the walking pattern in animals (Damianopoulos and Carey, 1992; Van Der Staay et al., 1999; Leroy et al., 2009; Singh et al., 2016b). Each rat was placed at the center of the open field apparatus designed as previously described (Gray and Lalljee, 1974; Redmond et al., 1997). The field consists of a circular arena divided into 60 squares of 10  10 cm each. The entire arena was provided with a 75 cm high aluminum walls at the periphery. A 60 W light bulb was positioned 90 cm above the center of the arena, and provided the only source of illumination in the testing room. Each animal was placed in the center of the open field apparatus, and the number of crossovers was measured during a 5 min period. A line crossing was counted when all four paws of animal crossed over the line. After each exposure, floor of the apparatus was wiped, cleaned to remove excreta and pheromones. Swimming speed using Morris water maze (MWM). To find out the escape latency as a measure of learning or swimming speed, rats receiving different treatments were placed, one at a time, into an MWM. The MWM apparatus was designed and built according to the specifications of Morris, (1984) and Panakhova et al., (1984) with slight modifications as described previously (Upadhya et al., 2011). The circular swimming pool measured 180 cm in diameter and 60 cm in height was filled daily with water (25 °C) upto 40 cm and whitened by the addition of milk (1 L/300 L). The pool was arbitrarily divided into 4 compass quadrants and the platform (10 cm in diameter, invisible and placed 1 cm below the water surface) was always placed into the middle of one of the cardinal radii (N, E, S and W) of the pool. The naturally-lighted room contained a number of cues that were clearly visible from the pool: a cue light, a window, a door, metal cupboards etc. These cues helped the rat to navigate in the pool. Each rat was given four training trials per day for four consecutive days with same starting location. The rat was immersed in the water facing the pool wall, and for 120 s was allowed to search for the platform. This period was designated as the escape latency, and if it failed to escape within this time, it was placed on the platform. Whether the rat found the platform, or was manually placed there, it was allowed to remain on the platform for 30 s. The rat was then removed and given additional three trials with 10 min inter-trial interval and finally returned to its home cage. For each rat, the platform position remained constant throughout the four training

days. Escape latency was recorded at each trial using a stopwatch. The rats were considered as trained when they showed escape latency around 10 s as reported in previous studies (Morris, 1984). Twenty-four hours after the last trial, trained rats received either vehicle, IPP, ruthenium red or eugenol directly in the cerebellum, and subjected to MWM following 15 min. The latency was observed as a parameter for swimming speed.

321

Retention time using rotarod performances. Rotarod test was performed to assess the motor co-ordination in rats by testing the ability of rats to remain on revolving rod (Dunham and Miya, 1957). The rats were placed on the rotating rod and the time spent by each rat on the rod was measured. The apparatus consists of the 80 cm horizontal rough metal rod which was 8 cm in diameter. The rod was fixed in the wooden chamber at 50 cm height to discourage the rats from escape. The rod was attached to the rotating drum and divided into 5 segments of 10 cm each using black painted acrylic glass. The rats were trained to walk on rotating rod at increasing speed from 1 to 50 rpm for 5 min daily for 3 days. On the test day in the 5 min test sessions the latency of rats to fall down was measured at the speed of 50 rpm.

329

Hot plate test. Sharma et al. (2012) demonstrated analgesic effect of eugenol during acute thermal nociception. To determine the efficacy of eugenol used in the present study, rats were intraperitoneally injected with either vehicle (DMSO + saline; n = 4) or eugenol (25 mg/kg, n = 4) and 30 min later subjected to hot plate test. Briefly, the hot plate test consisted of a metal plate (15  20 cm) maintained at 52.0 ± 0.5 °C and covered by plexiglas walls (15  20  30 cm). The paw withdrawal latency (PWL) was measured as latency between the time the rat was placed on the surface and the time it licks either of its hind paws or tried escaping the surface. Each rat was tested at least three times at an interval of 10 min and the readings were converted to average latency of three trials. The cut off time was kept as 30 s to avoid any thermal damage to the rats.

344

Image and statistical analysis

360

Tissue sections of cerebellum immunolabelled with TRPV3 antiserum and Calbindin D28K were observed under the fluorescence microscope. The images were captured and processed as described previously (Singh et al., 2016b). To study the postnatal stage dependent changes in TRPV3-immunoreactivity in the cerebellum of rats, relative quantitative analysis of the percent fluorescent area of TRPV3-immunoreactivity in the section of cerebellum was analyzed by automatic quantification using Image J software (NIH) (Singh et al., 2016a,b). The photomicrographs of TRPV3-immunoreactivity were captured using a fluorescence microscope with attached CCD camera. The percent fluorescent area occupied by the TRPV3-immunoreactivity in the cerebellum of P4, P8, P16, and P42 were analyzed using Image J software. The settings like objective, exposure time, and fluorescence intensity were kept constant during analysis. The threshold of captured images adjusted to include the

361

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

322 323 324 325 326 327 328

330 331 332 333 334 335 336 337 338 339 340 341 342 343

345 346 347 348 349 350 351 352 353 354 355 356 357 358 359

362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378

NSC 19350

No. of Pages 12

7 November 2019

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx 379 380 381 382 383 384 385 386 387 388 389 390 391 392

immunoreactivity, the background was subtracted, and the percent TRPV3-immunoreactive area determined. The data from each animal from each postnatal stage were pooled separately, averaged and the mean ± SEM was calculated. Data was analyzed using GraphPad Prism software (Graphpad Software, CA, USA). For comparison between the groups, statistical analysis was carried out using one-way ANOVA, followed by post-hoc Bonferroni’s multiple comparison test. No adjustments were employed for multiple comparisons. All the data are expressed as mean ± SEM, statistical tests were two-tailed, and P < 0.05 was considered statistically significant.

RESULTS

393 394

TRPV3 expression in the cerebellum

395

Using RT-PCR, expression of N- and C-terminal fragments of TRPV3 mRNA were observed in the cerebellum tissue of rat (Fig. 1), suggesting the presence of full-length TRPV3 in the rat cerebellum. Immunofluorescence using anti-TRPV3 specific antiserum resulted in labelling of cells and fibers in the cerebellum (Fig. 2A–C). Double immunofluorescence revealed the colocalization of TRPV3 and calbindin D28k in the Purkinje cells (Fig. 2A–I). All calbindin D28k-positive Purkinje cells were TRPV3immunoreactive (Fig. 2G–I). Replacement of the TRPV3 antiserum with normal serum from the immunofluorescence protocol did not produce any immunoreactivity signal in the cerebellum. TRPV3immunoreactive Purkinje cells were not seen in the cerebellum of P4 rats (Fig. 3A). While isolated weak TRPV3-immunoreactive cells were seen in the cerebellum of P8 rats (Fig. 3B), distinct neurons were seen in P16 and P42 animals (Fig. 3C, D). Compared to

396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413

Fig. 1. TRPV3 mRNA expression in the cerebellum of rat. RT-PCR of cerebellum tissue of rat showing expression of N- (514 bp) and C(348 bp) terminal fragments of TRPV3 mRNA.

5

the P4 and P8 rats, a significant increase (P < 0.001) in the percent fluorescent area of TRPV3-immunoreactivity was observed in the cerebellum of P16 and P42 rats (Fig. 3E).

414

Effect of intra-cerebellum TRPV3 agonist and inhibitors on gait patterns

418

The gait parameters of the vehicle- and eugenol-treated rats were comparable (P > 0.05) (Fig. 4A–C). Following administration of IPP or ruthenium red, splayed paws and movement incoordination (wobbling gait) was observed (Fig. 4A). The stride and foot print (Fig. 4A) lengths were significantly affected in the animals treated with ruthenium red or IPP. Compared to control, TRPV3-inhbitor treatment resulted in significant decrease in the stride length (P < 0.001, Fig. 4B) but increased footprint length (P < 0.01, Fig. 4C).

420

Effect of intra-cerebellum TRPV3 agonist and inhibitors on locomotor counts and number of crossovers

430

Compared to the vehicle-treated controls, ruthenium red or IPP administered directly into the cerebellum significantly decreased the locomotor counts (P < 0.001, Fig. 5). Eugenol administration did not alter the normal locomotor activity (Fig. 5A; P > 0.05). In the OFT, compared to vehicle-treated rats, ruthenium red or IPP injections decreased the number of crossovers from 168.30 ± 5.1 to 56.8 ± 6.7 and 58.4 ± 5.6, respectively (P < 0.001, Fig. 5B). The number of crossovers in the eugenol-treated rats was comparable to those in the vehicle-treated control rats but significantly more as compared to that of the ruthenium red- or IPP-treated rats (Fig. 5B).

433

Effect of intra-cerebellum TRPV3 agonist and inhibitors on swimming performance

446

Rats trained in MWM showed escape latency of 12.8 ± 3.6 s on day 4. On day 5 trained rats were treated with vehicle, ruthenium red, IPP, or eugenol and screened for escape latency as a measure of swimming speed performance in MWM. Compared to controls, ruthenium red- or IPP- treated rats showed significant increase in the escape latency (P < 0.001, Fig. 6A). The escape latencies of control and eugenol-treated rats were comparable (P > 0.05).

448

Effect of intra-cerebellum TRPV3 agonist and inhibitors on rotarod performance

457

Intra-cerebellar IPP decreased retention time on rotarod (Fig. 6B). The control rats showed the retention time of 62.5 ± 5.7 s on the revolving rod at a speed of 50 rpm. Compared to controls, the intra-cerebellar treatment of ruthenium red or IPP decreased the retention time to 12.4 ± 3.5 s (P < 0.001). The retention time on rotarod in control and eugenol-treated rats was comparable (control: 62.5 ± 5.7 s vs. eugenol: 56.9 ± 4.8 s).

459

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

415 416 417

419

421 422 423 424 425 426 427 428 429

431 432

434 435 436 437 438 439 440 441 442 443 444 445

447

449 450 451 452 453 454 455 456

458

460 461 462 463 464 465 466

NSC 19350

No. of Pages 12

7 November 2019

6

467 468 469 470

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

increased in the rats following intraperitoneal injection of eugenol.

471

DISCUSSION

473

In the present study, we explored the expression and role of TRPV3 in the cerebellum of rat. Expression of both N- and Cterminal fragments of TRPV3 mRNA suggests the presence of full-length TRPV3 in the rat cerebellum whereas application of immunofluorescence shows the presence of channel protein in the Purkinje neurons. While the treatment with TRPV3 inhibitors produced gait abnormalities, intracerebellum TRPV3 agonist did not affect this behavior. The TRPV3immunoreactivity in the Purkinje neurons showed developmental stage dependent expression with its distinct appearance in the cerebellum of P16 and P42 rats. Fig. 2. TRPV3-immunoreactivity in the cerebellum of rat. Fluorescence photomicrographs showing The Purkinje neurons serve as (A–C) TRPV3 (green) and (D–F) Calbindin D28K (red) immunoreactivity in the cerebellum. (G–I) the primary output neuronal TRPV3 and calbindin D28K are colocalized in the Purkinje neurons. Colocalized Purkinje neurons component of the cerebellar appear yellow due to color mixing (arrows). Scale bar = 50 mm. (For interpretation of the references to cortex and Ca2+ signaling seem color in this figure legend, the reader is referred to the web version of this article.) to play crucial role in the input as well as output translation process in these neurons (Gruol et al., 2012; Kitamura and Kano, 2013). A range of molecular components including the voltage-gated calcium channels and cationic channels, G-protein coupled receptors, ion channels located on the endoplasmic reticulum, Ca2+ binding proteins, and Ca2+ pumps have been suggested to regulate Ca2+ signaling in Purkinje neurons (Empson and Kno¨pfel, 2012; Gruol et al., 2012). While TRP channels have emerged as novel cationic channels, evidence suggest role of TRPV channels in neural regulation and signaling. These ion channels may serve as novel component of the cerebellar PurkFig. 3. TRPV3-immunoreactivity in the cerebellum of rat during early postnatal development. inje neuronal and candidate reguFluorescence photomicrographs showing TRPV3-immunoreactivity in the cerebellum of rat during lators of Ca2+ dynamics and early postnatal (P) development stages (A) P4, (B) P8, (C) P16, and (D) P42. (E) Semiquantitative signaling in the Purkinje neurons image analysis of the percent fluorescent area of TRPV3-immunoreactivity in the cerebellum of P4P42 rats. ***P < 0.001 compared to P4 and P8; ns, non-significant. Scale bar = 50 mm. since these channels possess voltage-gating properties (Ahern and Premkumar, 2002; Chung et al., 2005; Nilius et al., 2005), Effect of eugenol on paw withdrawal latency (PWL) in serve as major downstream effectors of G-protein couhot plate test pled receptors and activation of these receptors alters In the host plate test, compared to controls the paw channel activity (Veldhuis et al., 2015), interact with IP3 withdrawal latencies were significantly (P < 0.001) receptor and coupling between the TRPV ion channel Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

472

474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529

NSC 19350

No. of Pages 12

7 November 2019

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

7

Fig. 4. Intra-cerebellar TRPV3-inhibitor alter footprint and stride length. (A) Footprint pattern and stride length of rats infused with either intracerebellum vehicle, TRPV3 inhibitors [ruthenium red or isopentenyl pyrophosphate (IPP)], or TRPV3 agonist (eugenol). The paw patterns were assessed for (B) stride length and (C) footprint length following treatments with TRPV3 agonist or inhibitors. Note significantly wider footprint and reduced stride length after ruthenium red and IPP administration. *P < 0.05, **P < 0.01, and ***P < 0.001 vs control. Displayed values are mean ± SEM.

530 531 532

and intracellular Ca2+ store plays role initiating and maintaining the Ca2+ signal (Fernandes et al., 2008). Further, TRPV is expressed in the cerebellar tissue (Kunert-Keil

et al., 2006; Kumar et al., 2017a,b), and the neuronal firing and hyperactivity/reflexes were associated with cerebellar temperature modulation (Ga¨hwiler et al., 1972;

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

533 534 535

NSC 19350

No. of Pages 12

7 November 2019

8

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

Fig. 5. Intra-cerebellar TRPV3-inhibitor decreases locomotor activity. The motor performance of animals shown as locomotor counts (A) and number of crossovers (B) is significantly impaired after intracerebellar infusion of TRPV3 inhibitors [ruthenium red or isopentenyl pyrophosphate (IPP)]. Note a decrease in the number of locomotor counts and crossovers following TRPV3-inhibitor infusion. ns, nonsignificant; ***P < 0.001 vs control. Displayed values are mean ± SEM.

536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552

Friedlander et al., 1976; Womack and Khodakhah, 2004). Given the emerging importance of TRPV channels in neuronal regulation and Ca2+-signaling, the presence of TRPV3 in Purkinje neurons is interesting. We suggest that TRPV3 in the Purkinje neurons in the cerebellum may contribute to the regulation of neural signaling and motor coordination function. Purkinje cells serve as the important computational units of the cerebellum and the recent reports have underscored the significance of TRP channels in the modulation of these neurons (Kim et al., 2003; KunertKeil et al., 2006). While the mRNA expression of nonselective TRPV (1–6) ion channels has been demonstrated in the cerebellum (Kunert-Keil et al., 2006), information about the neuroanatomical organization and functional significance of TRPV sub-family ion channels in the cerebellum is scanty. Cristino et al. (2006) observed

Fig. 6. Intra-cerebellar TRPV3-inhibitors increases escape latency in Morris water maze (MWM) test and decreases retention time in Rotarod. Escape latency analyzed using MWM and (B) retention time on Rotarod following intra-cerebellar infusion of vehicle, TRPV3inhibitors [ruthenium red or isopentenyl pyrophosphate (IPP)], or TRPV3 agonist (eugenol). Note increase in the escape latency and decrease in retention time following TRPV3-inhibitor administration. ***P < 0.001 vs control. Displayed values are mean ± SEM.

TRPV1 immunoreactivity in the presynaptic terminals surrounding the cell body and axons of the Purkinje neurons whereas TRPV5 and 6 immunoreactivity was observed in the Purkinje neurons (Kumar et al., 2017a,b). Using RTPCR, we observed the expression of N- and C-terminal fragments of TRPV3 mRNA in the cerebellum of rat. The results are in agreement with previous findings showing TRPV3 mRNA expression in the cerebellum (KunertKeil et al., 2006). Calbindin D28K antiserum has widely been used as a reliable marker for Purkinje neurons (Whitney et al., 2008). Using double immunofluorescence, all Calbindin-D28K positive Purkinje neurons were also TRPV3-immunoreactive. The results suggest that TRPV3 transcript is expressed in cerebellum of rat and the Purkinje neurons are equipped with the channel protein. We analyzed effect of TRPV3 agonist and inhibitors on gait abnormalities in rats based upon the pattern of their footprints. While the control rats displayed a normal alternating gait along a straight line, rats

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572

NSC 19350

No. of Pages 12

7 November 2019

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633

administered with TRPV3 inhibitors intra-cerebellum displayed gait with broader width and abnormal step patterns. Following intra-cerebellum ruthenium red or IPP, a significant reduction in stride length but increase in foot print length was observed. These observations are in accordance with the earlier findings where impaired cerebellar function results in gait disturbances and lack of coordination of voluntary movements, and mice with cerebellar defects display alterations in footprint and rota rod measures (Goddyn et al., 2006; Meng et al., 2007; Cendelı´ n et al., 2010). Since, rota rod procedures are widely used to assess the cerebellum-based performance (Sherrard, 2011), the reduced retention time on rota rod suggests the motor incoordination in rats. Further, the locomotor counts and number of crossovers were also significantly reduced following these treatments. The assessment of motor coordination by other behavioral tests show that the inhibition of TRPV3 severely affected the ability of the animal to maintain their balance to walk across the beam, displayed reduced crossovers in OFT, and increased escape latency in MWM test. Evidence suggest that cerebellum projects information directly to the structures involved in the execution of movement to control motor coordination and equilibrium by processing the ascending sensory information and descending motor impulses (Sherrard, 2011). The moonwalker (Mwk) mice, an animal model of cerebellar ataxia harboring mutation in TRPC3 ion channel, display motor coordination defects comparable to the ataxic mouse mutants (Becker et al., 2009). Based on these reports and our observations, we suggest that the TRP channels may serve as novel modulators of cerebellar functions. We have used TRPV3 inhibitor ruthenium red and TRPV3 agonist, eugenol to study the functional significance of the ion channel in the cerebellum. While eugenol activates TRPV1 and TRPV3 (Yang et al., 2003; Xu et al., 2006), ruthenium red inhibits the activity of these ion channels (Yang et al., 2003; Xu et al., 2006; Billen et al., 2015; Zhang et al., 2018). Since TRPV1 immunoreactivity was observed surrounding the soma and axon of cerebellar Purkinje neurons (Cristino et al., 2006), we used another TRPV3 specific inhibitor, IPP (Bang et al., 2011; Nilius et al., 2014) to determine whether the behavioral response is TRPV3 specific. Both, the ruthenium red and IPP showed comparable effects on different behaviors after their intra-cerebellum infusions. Distinct TRPV3-immunoreactivity was observed in the Purkinje neurons during early postnatal development. While we do not know the significance of TRPV3 in the Purkinje neurons during early development, TRPV3 has been shown to be involved in the proliferation, differentiation and apoptosis of keratinocytes (CalsGrierson and Ormerod, 2004; Miyamoto et al., 2011; Radtke et al., 2011; Cao et al., 2012; Nilius et al., 2014). TRP channels also play role in neuronal development (Goswami and Hucho, 2007; Goswami et al., 2007). The role of thermosensitive TRPV channels was observed in adult neurogenesis. The cannabinoid receptor-1 antagonist, SR141716A seem to act on VR-1 vanilloid receptor and block the neurogenesis in mice (Jin et al., 2004). Recent study on brain temperature mea-

9

surement in rats and healthy neonates has shown 37 °C as the basal temperature for cerebellum (Kiyatkin, 2010). Temperature plays an important role in neural tissue development in Atlantic herring, Clupea harengus L. (Hill and Johnston, 1997). While delayed motor axon outgrowth was seen at lower temperature, at higher temperature developmental timing of motor axon was advanced (Hill and Johnston, 1997). Becker et al. (2009) observed TRPC3 expression from the second postnatal week and the expression peaked at three weeks. Purkinje cells develop an extensive dendritic arborization till third postnatal week (McKay and Turner, 2005) which strengthens the motor coordination (McKay and Turner, 2005). In 3week old TRPC3 mutant mice, the dendritic arbors were reduced (Becker et al., 2009). Whether thermosensitive TRPV channels acts as molecular transducer for development of neuronal tissue is not well understood. We observed the presence of distinct TRPV3 labeled Purkinje neurons in the cerebellum of P16 and P42 rats. Given the importance of TRP ion channels in cerebellar function, Purkinje neuron dendritic arborization (Pietrobon, 2002; Kim et al., 2003; Becker et al., 2009), and developmental stage-dependent expression pattern of TRPV3 in the Purkinje neurons, we suggest that the ion channels may play role in cellular arborization and calcium-dependent regulation of Purkinje neurons during development to strengthen motor coordination. Purkinje cells are intrinsically active in the absence of synaptic inputs (Ha¨usser and Clark, 1997; Raman and Bean, 1997; Womack and Khodakhah, 2002). They show spontaneous electrical activity (Nam and Hockberger, 1997), and exhibit intrinsic tonic firing behavior (Ha¨usser and Clark, 1997; Womack and Khodakhah, 2002). In addition, the tonically firing Purkinje neurons are temperature sensitive and show spontaneous firing activity at 35 °C (Womack and Khodakhah, 2002). Further, the effect of elevated cerebellar temperature on motor reflex has been demonstrated in the goldfish (Friedlander et al., 1976). While TRPV3 is activated by temperature in the range of 31–39 °C in heterologous expression system (Peier et al., 2002; Xu et al., 2002), the ion channel is constitutively active at 32 °C in the skin (Cheng et al., 2010). The temperature measurements in rat and healthy neonates showed 37 °C as the basal cerebellar temperature (Kiyatkin, 2010). We suggest that the TRPV3 ion channels in cerebellum may remain constitutively active at this basal temperature and contribute to the normal physiological regulation and motor coordination function. As demonstrated earlier (Sharma et al., 2012), on hot plate the rats showed increased paw withdrawal latency following intraperitoneal injection of eugenol as compared to the controls. However, the effects of intra-cerebellum TRPV3 agonist, eugenol on different behaviors were comparable to that seen in the control animals. In view of the thermo-sensitive nature of Purkinje neurons, we speculate that the TRPV3 channels may contribute to the spontaneous firing activity in these neurons and therefore agonist treatment might produce the ceiling effect, which may not further activate these channels. Electrophysiological studies would be helpful in determining the effect of eugenol on Purkinje neuron activity. In addition to

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694

NSC 19350

No. of Pages 12

7 November 2019

10

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

707

TRPV, evidence shows the involvement of other TRP channels in cerebellar function. While TRPC1 is present in the glutamatergic parallel fiber-Purkinje cell synapse and its significance in motor coordination suggested (Kim et al., 2003; Kunert-Keil et al., 2006), TRPC3 regulate cerebellum development and function (Huang et al., 2007; Hartmann et al., 2008; Becker, 2014). A point mutation in TRPC3 leads to cerebral ataxia with abnormal Purkinje cell development and dysfunction (Becker et al., 2009). The regulation of cerebellar function by TRP ion channels therefore seems complex and more studies are required to further probe their significance in the cerebellum.

708

UNCITED REFERENCES

695 696 697 698 699 700 701 702 703 704 705 706

709

Ramsey et al. (2006).

710

ACKNOWLEDGEMENTS

711

715

We thank the Department of Atomic Energy, Govt. of India and NISER, Bhubaneswar for their financial support. We also record our thanks to Dr. Saurabh Chawla, Scientific Officer and In-charge of the Animal House facility, NISER for his assistance.

716

REFERENCES

717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755

Ahern GP, Premkumar LS (2002) Voltage-dependent priming of rat vanilloid receptor: Effects of agonist and protein kinase C activation. J Physiol. Balchen T, Diemer NH (1992) The AMPA antagonist, NBQX, protects against ischemia-induced loss of cerebellar Purkinje cells. NeuroReport 3:785–788. Bang S, Yoo S, Yang TJ, Cho H, Hwang SW (2011) Isopentenyl pyrophosphate is a novel antinociceptive substance that inhibits TRPV3 and TRPA1 ion channels. Pain 152:1156–1164. Becker EBE (2014) The Moonwalker mouse: new insights into TRPC3 function, cerebellar development, and ataxia. Cerebellum 13:628–636. Becker EBE, Oliver PL, Glitsch MD, Banks GT, Achilli F, Hardy A, Nolan PM, Fisher EMC, Davies KE (2009) A point mutation in TRPC3 causes abnormal Purkinje cell development and cerebellar ataxia in moonwalker mice. Proc Natl Acad Sci USA 106:6706–6711. Billen B, Brams M, Debaveye S, Remeeva A, Alpizar YA, Waelkens E, Kreir M, Bru¨ggemann A, Talavera K, Nilius B, Voets T, Ulens C (2015) Different ligands of the TRPV3 cation channel cause distinct conformational changes as revealed by intrinsic tryptophan fluorescence quenching. J Biol Chem 290:12964–12974. Cals-Grierson MM, Ormerod AD (2004) Nitric oxide function in the skin. Nitric Oxide 10:179–193. Cao X, Yang F, Zheng JWK (2012) Intracellular proton-mediated activation of TRPV3 channels accounts for exfoliation effect of ahydroxyl acids on keratinocytes. J Biol Chem 287:25905–25916. Cavelier P, Bossu J-L (2003) Dendritic low-threshold Ca2+ channels in rat cerebellar Purkinje cells: possible physiological implications. Cerebellum 2:196–205. Cendelı´ n J, Voller J, Vozˇeh F (2010) Ataxic gait analysis in a mouse model of the olivocerebellar degeneration. Behav Brain Res 210:8–15. Cheng X, Jin J, Hu L, Shen D, Dong XP, Samie MA, Knoff J, Eisinger B, Liu ML, Huang SM, Caterina MJ, Dempsey P, Michael LE, Dlugosz AA, Andrews NC, Clapham DE, Xu H (2010) TRP channel regulates EGFR signaling in hair morphogenesis and skin barrier formation. Cell 141:331–343.

712 713 714

Chung MK, Gu¨ler AD, Caterina MJ (2005) Biphasic currents evoked by chemical or thermal activation of the heat-gated ion channel, TRPV3. J Biol Chem 280:15928–15941. Clapham DE (2003) TRP channels as cellular sensors. Nature 426:517–524. Crepel F, Mariani J, Delhaye-Bouchaud N (1976) Evidence for a multiple innervation of Purkinje cells by climbing fibers in the immature rat cerebellum. J Neurobiol 7:567–578. Cristino L, de Petrocellis L, Pryce G, Baker D, Guglielmotti V, Di Marzo V (2006) Immunohistochemical localization of cannabinoid type 1 and vanilloid transient receptor potential vanilloid type 1 receptors in the mouse brain. Neuroscience 139:1405–1415. Damianopoulos EN, Carey RJ (1992) Conditioning, habituation and behavioral reorganization factors in chronic cocaine effects. Behav Brain Res 49:149–157. Duen˜as AM, Goold R, Giunti P (2006) Molecular pathogenesis of spinocerebellar ataxias. Brain 129:1357–1370. Dunham NW, Miya TS (1957) A note on a simple apparatus for detecting neurological deficit in rats and mice. J Am Pharm Assoc Am Pharm Assoc 46:208–209. Empson RM, Kno¨pfel T (2012) Functional integration of calcium regulatory mechanisms at purkinje neuron synapses. Cerebellum 11:640–650. Fernandes J, Lorenzo IM, Andrade YN, Garcia-Elias A, Serra SA, Ferna´ndez-Ferna´ndez JM, Valverde MA (2008) IP3 sensitizes TRPV4 channel to the mechano-and osmotransducing messenger 50 -60 -epoxyeicosatrienoic acid. J Cell Biol. Flockerzi V (2007) An introduction on TRP channels. Hand book Exp Pharmacol 179:1–19. Flockerzi V, Nilius B (2014) TRPs: truly remarkable proteins. Handb Exp Pharmacol. pp 222:1-12. Friedlander MJ, Kotchabhakdi N, Prosser CL (1976) Effects of cold and heat on behavior and cerebellar function in goldfish. J Comp Physiol 112:19–45. Ga¨hwiler BH, Mamoon AM, Schlafer WT, Tobias CA (1972) Effects of temperature on spontaneous bioelectric activity of cultured nerve cells. Brain Res 40:527–533. Goddyn H, Leo S, Meert T, D’Hooge R (2006) Differences in behavioural test battery performance between mice with hippocampal and cerebellar lesions. Behav Brain Res 173:138–147. Goswami C, Hucho T (2007) TRPV1 expression-dependent initiation and regulation of filopodia. J Neurochem 103:1319–1333. Goswami C, Schmidt H, Hucho F (2007) TRPV1 at nerve endings regulates growth cone morphology and movement through cytoskeleton reorganization. FEBS J 274:760–772. Goyal SN, Kokare DM, Chopde CT, Subhedar NK (2006) Alphamelanocyte stimulating hormone antagonizes antidepressant-like effect of neuropeptide Y in Porsolt’s test in rats. Pharmacol Biochem Behav 85:369–377. Gray JA, Lalljee B (1974) Sex differences in emotional behaviour in the rat: correlation between open-field defecation and active avoidance. Anim Behav 22:856–861. Gruol D, Manto M, Haines D (2012) Ca2+ signaling in cerebellar purkinje neurons. Cerebellum 11:605–608. Guatteo E, Chung KKH, Bowala TK, Bernardi G, Mercuri NB, Lipski J (2005) Temperature sensitivity of dopaminergic neurons of the substantia nigra pars compacta: involvement of transient receptor potential channels. J Neurophysiol 94:3069–3080. Hartmann J, Dragicevic E, Adelsberger H, Henning HA, Sumser M, Abramowitz J, Blum R, Dietrich A, Freichel M, Flockerzi V, Birnbaumer L, Konnerth A (2008) TRPC3 channels are required for synaptic transmission and motor coordination. Neuron 59:392–398. Ha¨usser M, Clark BA (1997) Tonic synaptic inhibition modulates neuronal output pattern and spatiotemporal synaptic integration. Neuron 19:665–678. Hashimoto K, Tsujita M, Miyazaki T, Kitamura K, Yamazaki M, Shin H-S, Watanabe M, Sakimura K, Kano M (2011) Postsynaptic P/Qtype Ca2+ channel in Purkinje cell mediates synaptic competition

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825

NSC 19350

No. of Pages 12

7 November 2019

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895

and elimination in developing cerebellum. Proc Natl Acad Sci USA 108:9987–9992. Hill J, Johnston IA (1997) Temperature and neural development of the atlantic herring (Clupea harengus L.). Comp Biochem Physiol A Physiol 117:457–462. Hoffmann A, Grimm C, Kraft R, Goldbaum O, Wrede A, Nolte C, Hanisch UK, Richter-Landsberg C, Bru¨ck W, Kettenmann H, Harteneck C (2010) TRPM3 is expressed in sphingosineresponsive myelinating oligodendrocytes. J Neurochem 114:654–665. Huang WC, Young JS, Glitsch MD (2007) Changes in TRPC channel expression during postnatal development of cerebellar neurons. Cell Calcium 42:1–10. Huguenard JR (1996) Low-threshold calcium currents in central nervous system neurons. Annu Rev Physiol 58:329–348. Iwasaki S, Momiyama A, Uchitel OD, Takahashi T (2000) Developmental changes in calcium channel types mediating central synaptic transmission. J Neurosci 20:59–65. Jardı´ n I, Lo´pez JJ, Diez R, Sa´nchez-Collado J, Cantonero C, Albarra´n L, Woodard GE, Redondo PC, Salido GM, Smani T, Rosado JA (2017) TRPs in pain sensation. Front Physiol 8:392. Jin K, Xie L, Kim SH, Parmentier- Batteur S, Sun Y, Mao XO, Childs J, Greenberg DA (2004) Defective adult neurogenesis in CB1 cannabinoid receptor knockout mice. Mol Pharmacol 66:204–208. Kauer JA, Gibson HE (2009) Hot flash: TRPV channels in the brain. Trends Neurosci 32:215–224. Kim SJ, Kim YS, Yuan JP, Petralia RS, Worley PF, Linden DJ (2003) Activation of the TRPC1 cation channel by metabotropic glutamate receptor mGluR1. Nature 426:285–291. Kitamura K, Kano M (2013) Dendritic calcium signaling in cerebellar Purkinje cell. Neural Networks 47:11–17. Kiyatkin EA (2010) Brain temperature homeostasis: physiological fluctuations and pathological shifts. Front Biosci 15:73–92. Klapdor K, Dulfer BG, Hammann A, Van Der Staay FJ (1997) A lowcost method to analyse footprint patterns. J Neurosci Methods 75:49–54. Kokare DM, Shelkar GP, Borkar CD, Nakhate KT, Subhedar NK (2011) A simple and inexpensive method to fabricate a cannula system for intracranial injections in rats and mice. J Pharmacol Toxicol Methods 64:246–250. Ramsey IS, Delling M, Clapham DE (2006) An introduction to TRP channels. Annu Rev Physiol 68:619–647. Kumar S, Singh U, Goswami CSP (2017a) Transient receptor potential vanilloid 5 (TRPV5), a highly Ca2+-selective TRP channel in the rat brain: Relevance to neuroendocrine regulation. J Neuroendocrinol 29. Kumar S, Singh U, Singh O, Goswami CSP (2017b) Transient receptor potential vanilloid 6 (TRPV6) in the mouse brain: distribution and estrous cycle-related changes in the hypothalamus. Neuroscience 344:204–216. Kunert-Keil C, Bisping F, Kru¨ger J, Brinkmeier H (2006) Tissuespecific expression of TRP channel genes in the mouse and its variation in three different mouse strains. BMC Genomics 7:159. Leitch B, Shevtsova O, Gue’vremont D, Williams J (2009) Loss of calcium channels in the cerebellum of the ataxic and epileptic stargazer mutant mouse. Brain Res 1279:156–167. Leroy T, Silva M, D’Hooge R, Aerts JM, Berckmans D (2009) Automated gait analysis in the open-field test for laboratory mice. Behav Res Methods 41:148–153. McKay BE, Turner RW (2005) Physiological and morphological development of the rat cerebellar Purkinje cell. J Physiol 567:829–850. Meng H, Larson SK, Gao R, Qiao X (2007) BDNF transgene improves ataxic and motor behaviors in stargazer mice. Brain Res 1160:47–57. Miyamoto T, Petrus MJ, Dubin AE, Patapoutian A (2011) TRPV3 regulates nitric oxide synthase-independent nitric oxide synthesis in the skin. Nat Commun 2:369. Morris R (1984) Developments of a water-maze procedure for studying spatial learning in the rat. J Neurosci Methods 11:47–60.

11

Nam SC, Hockberger PE (1997) Analysis of spontaneous electrical activity in cerebellar Purkinje cells acutely isolated from postnatal rats. J Neurobiol 33:18–32. Nilius B, Bı´ ro´ T, Owsianik G (2014) TRPV3: time to decipher a poorly understood family member! J Physiol 592:295–304. Nilius B, Talavera K, Owsianik G, Prenen J, Droogmans G, Voets T (2005) Gating of TRP channels: a voltage connection? J Physiol 567:35–44. Panakhova E, Buresova O, Bures J (1984) Persistence of spatial memory in the morris water tank task. Int J Psychophysiol 2:5–10. Paxinos G, Watson C (1998) The rat brain in stereotaxic coordinates. 4th ed. Academic Press. Peier AM, Reeve AJ, Andersson DA, Moqrich A, Earley TJ, Hergarden AC, Story GM, Colley S, Hogenesch JB, McIntyre P, Bevan SPA (2002) A heat-sensitive TRP channel expressed in keratinocytes. Science 80(296):2046–2049. Pietrobon D (2002) Calcium channels and channelopathies of the central nervous system. Mol Neurobiol 25:31–50. Piochon C, Levenes C, Ohtsuki G, Hansel C (2010) Purkinje cell NMDA receptors assume a key role in synaptic gain control in the mature cerebellum. J Neurosci 30:15330–15335. Pires P, Sullivan M, Prichard H, Robinson J, Earley S (2015) Unitary TRPV3 channel Ca2+ influx events elicit endothelium-dependent dilation of cerebral parenchymal arterioles. Am J Physiol Hear Circ Physiol 309:H2031–H2041. Radtke C, Sinis N, Sauter M, Jahn S, Kraushaar U, Guenther E, Rodemann HP, Rennekampff HO (2011) TRPV channel expression in human skin and possible role in thermally induced cell death. J Burn Care Res 32:150–159. Raman IM, Bean BP (1997) Resurgent sodium current and action potential formation in dissociated cerebellar Purkinje neurons. J Neurosci 17:4517–4526. Redmond AM, Kelly JP, Leonard BE (1997) Behavioural and neurochemical effects of dizocilpine in the olfactory bulbectomized rat model of depression. Pharmacol Biochem Behav 58:355–359. Servais L, Hourez R, Bearzatto B, Gall D, Schiffmann SN, Cheron G (2007) Purkinje cell dysfunction and alteration of long-term synaptic plasticity in fetal alcohol syndrome. Proc Natl Acad Sci USA 104:9858–9863. Sharma N, Raunier GP, Das BP (2012) Experiemntal study of various central nervous system effects of eugenol in mice and rats. Health Renaiss 10:208–214. Shelkar GP, Kale AD, Singh U, Singru PS, Subhedar NK, Kokare DM (2015) Alpha-melanocyte stimulating hormone modulates ethanol self-administration in posterior ventral tegmental area through melanocortin-4 receptors. Addict Biol 20:302–315. Sherrard RM (2011) Cerebellar control of fine motor function. In: Lane EL, Dunnett SB, editors. Animal models of movement disorders. Humana Press. p. 263–279. Singh O, Kumar S, Singh U, Kumar V, Lechan RM, Singru PS (2016a) Cocaine-and amphetamine regulated transcript peptide (CART) in the brain of zebra finch, Taeniopygia guttata: organization, interaction with neuropeptide Y, and response to changes in energy status. J Comp Neurol 524:3014–3041. Singh U, Kumar S, Shelkar GP, Yadav M, Kokare DM, Goswami C, Lechan RMSP (2016b) Transient receptor potential vanilloid 3 (TRPV3) in the ventral tegmental area of rat: Role in modulation of the mesolimbic-dopamine reward pathway. Neuropharmacology 110:198–210. Upadhya MA, Nakhate KT, Kokare DM, Singh U, Singru PS, Subhedar NK (2012) CART peptide in the nucleus accumbens shell acts downstream to dopamine and mediates the reward and reinforcement actions of morphine. Neuropharmacology 62:1823–1833. Upadhya MA, Nakhate KT, Kokare DM, Singru PS, Subhedar NK (2011) Cocaine- and amphetamine-regulated transcript peptide increases spatial learning and memory in rats. Life Sci 88:322–334.

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964

NSC 19350

No. of Pages 12

7 November 2019

12 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988

U. Singh et al. / Neuroscience xxx (2019) xxx–xxx

Usowicz MM, Sugimori M, Cherksey B, Llina´s R (1992) P-type calcium channels in the somata and dendrites of adult cerebellar Purkinje cells. Neuron 9:1185–1199. Van Der Staay FJ, Fanelli RJ, Blokland A, Schmidt BH (1999) Behavioral effects of apamin, a selective inhibitor of the SK(Ca)channel, in mice and rats. Neurosci Biobehav Rev 23:1087–1110. Veldhuis NA, Poole DP, Grace M, McIntyre P, Bunnett NW (2015) The G protein-coupled receptor-transient receptor potential channel axis: molecular insights for targeting disorders of sensation and inflammation. Pharmacol Rev 67:36–73. Venkatachalam K, Montell C (2007) TRP channels. Annu Rev Biochem 76:387–417. Vogt-Eisele AK, Weber K, Sherkheli MA, Vielhaber G, Panten J, Gisselmann G, Hatt H (2007) Monoterpenoid agonists of TRPV3. Br J Pharmacol 151:530–540. Voogd J, Glickstein M (1998) The anatomy of the cerebellum. Trends Neurosci 21:370–375. Whitney ER, Kemper TL, Bauman ML, Rosene DL, Blatt GJ (2008) Cerebellar Purkinje cells are reduced in a subpopulation of autistic brains: a stereological experiment using calbindin-D28k. J Neurosci Methods 168:42–47. Womack M, Khodakhah K (2002) Active contribution of dendrites to the tonic and trimodal patterns of activity in cerebellar Purkinje neurons. J Neurosci 22:10603–10612.

Womack MD, Khodakhah K (2004) Dendritic control of spontaneous bursting in cerebellar Purkinje cells. J Neurosci 24:3511–3521. Xu H, Delling M, Jun JC, Clapham DE (2006) Oregano, thyme and clove-derived flavors and skin sensitizers activate specific TRP channels. Nat Neurosci 9:628–635. Xu H, Ramsey IS, Kotecha SA, Moran MM, Chong JA, Lawson D, Ge P, Lilly J, Silos-Santiago I, Xie Y, DiStefano PS, Curtis R, Clapham DE (2002) TRPV3 is a calcium-permeable temperaturesensitive cation channel. Nature 418:181–186. Yang BH, Piao ZG, Kim YB, Lee CH, Lee JK, Park K, Kim JS, Oh SB (2003) Activation of vanilloid receptor 1 (VR1) by Eugenol. J Dent Res 82:781–785. Zamudio-Bulcock PA, Everett J, Harteneck C, Valenzuela CF (2011) Activation of steroid-sensitive TRPM3 channels potentiates glutamatergic transmission at cerebellar Purkinje neurons from developing rats. J Neurochem 119:474–485. Zhang Q, Qi H, Cao Y, Shi P, Song C, Ba L, Chen Y, Gao J, Li S, Li BSH (2018) Activation of transient receptor potential vanilloid 3 channel (TRPV3) aggravated pathological cardiac hypertrophy via calcineurin/NFATc3 pathway in rats. J Cell Mol Med 22:6055–6067.

Please cite this article in press as: Singh U et al. Transient Receptor Potential Vanilloid 3 (TRPV3) in the Cerebellum of Rat and Its Role in Motor Coordination. Neuroscience (2019), https://doi.org/10.1016/j. neuroscience.2019.10.047

989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010