- Email: [email protected]
Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function
Materials Science and Engineering C 54 (2015) 61–68
Contents lists available at ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function Jiraporn Sangsuwan a,b, Supreya Wanichpakorn b, Ureporn Kedjarune-Leggat b,⁎ a b
Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand
a r t i c l e
i n f o
Article history: Received 25 November 2014 Received in revised form 13 March 2015 Accepted 21 April 2015 Available online 24 April 2015 Keywords: TCTP Glass ionomer cement Chitosan Osteoblast Bone cement
a b s t r a c t The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Glass ionomer cements (GICs) were originally used for dental restorations. They were based on the acid–base reaction between fluoroaluminosilicate glass powder and polyalkenoic acids, mainly poly (acrylic acid) [1]. Because of their chemical property as adhesive cements that could bind with bone, metals and synthetic materials with good biocompatibility to oral tissue as well as bone cells [2,3], they also had medical applications being modified as bone cements in orthopedic surgery. GICs were used in otologic surgery [4,5] and resin modified glass ionomer cement (RMGIC) was used in periodontal surgery [6, 7]. The development of GICs for promoting bone healing or regeneration may contribute to the clinical application of using these materials as bone cements or bioactive implant material. Recently, the combination of chitosan and albumin in GIC has been shown to promote the release of protein or growth factor [8,9]. Chitosan is a co-polymer of glucosamine and N-acetyl-D-glucosamine, a deacetylation product of chitin, a natural polymer found in shells of marine crustaceans and cell walls of fungi. This polymer has been widely used in pharmaceutical and biomedical applications due to its antibacterial property, ability to assist in drug delivery, biodegradability and biocompatibility [10,11]. Chitosan
⁎ Corresponding author.
http://dx.doi.org/10.1016/j.msec.2015.04.036 0928-4931/© 2015 Elsevier B.V. All rights reserved.
can promote dental pulp cell proliferation and early osteogenic differentiation in vitro [12] and free chitosan can promote osteoblast proliferation and osteogenesis in mesenchymal stem cells [13]. Translationally controlled tumor protein (TCTP) is a highly conserved protein that is widely expressed in all eukaryotic organisms. TCTP is involved in many cellular processes, such as cell growth and cell cycle progression and it can protect cells from various stress conditions. It was recently found that this protein can reduce RMGIC induced apoptotic cells and can also promote pulp cell mineralization [14]. The hypothesis of this study is to prove that supplementing TCTP in the BIO-GIC, which came from the addition of chitosan and albumin in the conventional GIC, will improve its property of inducing bone cell proliferation and function. 2. Materials and methods 2.1. Expression and purification of translationally controlled tumor protein (TCTP) TCTP gene derived from Penaeus merguiensis was cloned and expressed in the bacteria Escherichia coli (E. coli) strain BL21. The protein was purified following the methods described by Wanachottrakul et al. [14]. Briefly, E. coli strain BL21 harboring pGEX-Pmer-TCTP was inoculated and induced by 1 mM IPTG (isopropyl β-D-thiogalactopyronositol). After
62
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
induction, the bacteria cells were harvested by centrifugation and the GST-TCTP protein was purified by using Glutathione Sepharose 4 Fast Flow (GE Healthcare Bio-Science, Piscataway, NJ, USA) and thrombin. The purified Pmer-TCTP protein with molecular mass about 19.2 kDa was analyzed by SDS-PAGE and protein concentration was determined by a BCA protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA).
2.2. Osteoblast culture Normal human osteoblast cells (NHost cells) from human long bones (femur) were purchased from Cambrex (Lonza Walkersville, Inc., USA). The NHost cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2 in grown medium Alpha-modified Eagle's medium (α-MEM) supplemented with 20% fetal bovine serum (FBS), 100 units/ml penicillin, 100 mg/ml streptomycin and 100 mg/ml antibiotic-antimycotic (Invitrogen Corporation, Grand Island, NY). The culture medium was replenished every 2–3 days. After reaching 90% confluence, cells were trypsinized using 0.01% trypsin with EDTA. NHost cells passage between two and six were used in this study.
2.4. Cell viability assay The effect of TCTP at various concentrations at two time periods (24 and 72 h) on cell viability was determined by 3-(4, 5-dimethylthiazol-2yl)-2,5-diphenylterrazolium bromide or MTT assay. NHost cells at 5 × 103 cells/well were seeded in 96-well plates at 37 °C in a humidified atmosphere containing 5% CO2. After 24 h, the culture medium was changed with fresh medium mixed with TCTP at various concentrations from 0.01 μg/ml to 15 μg/ml for 24 and 72 h. The control group was a normal culture medium without TCTP and each group had 6 replications. After that, the medium was removed, 200 μl of fresh medium containing 10 mM HEPES pH 7.4 was added to each well, and 50 μl MTT solution at 5 mg/ml in phosphate buffer solution (PBS) at pH 7.4 was added to each well and incubated in the dark for 3 h at 37 °C in a humidified atmosphere containing 5% CO2. The medium and MTT were then removed and 200 μl of DMSO and 25 μl of Sorensen's glycine buffer (0.1 M glycine plus 0.1 M NaCl equilibrated to pH 10.5 with 0.1 M NaOH) were added. The optical density (OD) was measured at 570 nm. The OD values corrected for blank (medium as culture) of the experimental groups will be divided by the control and expressed as a percentage of the control, which represented the percentage of viable cells.
2.3. Specimen preparation
2.5. Cell proliferation ELISA, BrdU (colorimetric) assay
GIC used in this study was a conventional material 3 M™ (3 M ESPE Ketac™ Molar Easymix, St Paul, MN, USA). The powder (batch no. 56,633) was composed of Al–Ca–La fluorosilicate glass and 5% copolymer acid (acrylic and maleic acid) and the liquid was composed of polyalkenoic acid, tartaric acid and water. The new formulation of GIC in this study was assigned as BIO-GIC. The powder of BIO-GIC was composed of GIC powder incorporated with 15% (by weight) of chitosan and 5% (by weight) of bovine serum albumin (BSA). The liquid part of BIOGIC was composed of polyalkenoic acid, tartaric acid and water, the same components as in the liquid part of GIC. Chitosan used in this study had a molecular weight of about 62 kDa and 89.1% degree of deacetylation (TMECO, Thailand). The groups of different GICs and their compositions have been described in Table 1. Two sizes of disk specimens prepared by Teflon molds (7 mm diameter and 1 mm thickness for cell viability and cell proliferative assay, 12 mm diameter and 1 mm thickness for alkaline phosphatase and Alizarin assay) were used. The cements were hand-mixed following the manufacturer's instruction. One scoop of powder was mixed with one drop of liquid using a stainless steel spatula and then packed into split ring Teflon molds at a room temperature of 22 ± 3 °C. TCTP (solution concentration, 2 μg/μl) was added at this time for the two groups with TCTP supplement (GIC + TCTP and BIO-GIC + TCTP). The uniform mixing cement was then transferred into the ring Teflon molds. A polythene sheet and glass slide was then placed over the filled mold after which light hand pressure was applied. Specimens were retained in the mold during storage in an incubator at 37 °C for 1 h. After storage in an incubator, the specimens were removed from their molds and ready for further experiments.
The effect of GICs and TCTP on osteoblast cells was determined by cell proliferative assay using a commercial kit, Cell Proliferation ELISA, BrdU (colorimetric) (Roche, Mannheim, Germany). This assay was designed to quantitate cell proliferation based on the measurement of 5bromo-2-deoxyuridine (BrdU) incorporation during DNA synthesis in proliferating cells. From the result of MTT assay, the concentrations of TCTP that can promote cell growth in culture media was 1 ng/ml and 10 ng/ml. The amount of TCTP supplemented in GIC and BIO-GIC (size 12 mm diameter and 1 mm thickness) was estimated about 100 times based on our previous study [8]. So in specimen groups GIC + 1 ng, and BIO-GIC + 1 ng, TCTP at 100 ng was added in each specimen during mixing the cement while in groups GIC + 10 ng and BIO-GIC + 10 ng, TCTP at 100 ng per specimen was supplemented. The specimens were divided into seven groups and each group composed of 6 replicates. Six groups of the specimens were GIC, BIO-GIC, GIC + TCTP and BIOGIC + TCTP, at 2 concentrations. NHost cells were seeded at 7000 cells directly on each specimen, which was placed on 96-well culture plate. The control group was cells cultured at the same density without any specimen. Cells were fed with 200 μl of normal culture medium. The culture plates were kept for 72 h before the BrdU assays were performed. The assay was followed the manufacturer's instruction. Briefly, the culture medium was removed and refreshed with 100 μl/well normal medium pre-mixed with BrdU labeling solution and left for 2 h at 37 °C. Then the labeling medium was removed and FixDenat was added; following which, it was incubated for 30 min at 25 °C. FixDenat solution was then removed and anti-BrdU-POD working solution was added. It was then incubated for 90 min at 25 °C. The antibody conjugate was then removed and washed three times with PBS at pH 7.4 and substrate solution was added until color development was sufficient for photometric detection. Then, 25 μl 1 M H2SO4 was added to each well and incubated for 1 min on the shaker at 300 rpm. The absorbance of the sample was measured at 450 nm against its own blank. The blank of each group was the similar specimen or the culture plate without seeded cells but was treated using the same procedure as the groups that had seeded cells.
Table 1 Compositions of the powder of different groups of GIs specimens. Group of specimens
Powder compositions
GIC
Calcium fluoroaluminosilicate glass and 5% copolymer acid (acrylic and maleic acid) Calcium fluoroaluminosilicate glass and 5% copolymer acid (acrylic and maleic acid) with added TCTP during mixing the cement Calcium fluoroaluminosilicate glass, 5% copolymer acid (acrylic and maleic acid), 15% chitosan and 5% BSA Calcium fluoroaluminosilicate glass, 5% copolymer acid (acrylic and maleic acid), 15% chitosan and 5% BSA with added TCTP during mixing the cement
GIC + TCTP BIO-GIC BIO-GIC + TCTP
2.6. Western blotting The TCTP released from BIO-GIC + TCTP and GIC + TCTP respectively was investigated by western blot assay. TCTP at 100 ng/specimen was supplemented in each group of the specimens during mixing the powder and liquid components that has been described above, while the
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
negative control groups were BIO-GIC and GIC without TCTP. Each specimen was placed in plastic tube with 1 ml of PBS. The PBS with 1 ng/ml of TCTP in a plastic tube was used as a positive control. All tubes were kept for 1 h in shaking incubator at 37 °C and 170 rpm. Then each immersed PBS was concentrated with the freeze dryer at 80 °C and was reconstituted with 10 μl PBS before being analyzed with western blot and the amount of protein was determined by BCA protein assay kit (Pierce, Rockford, IL, USA). Briefly, equal amounts of protein from each sample was mixed with Laemmli sample buffer with reducing agent and subjected to electrophoresis on a 12% polyacrylamide gel along with pre-stained high molecular weight standards (Bio-Rad, Hercules, CA, USA). The proteins were transferred to nitrocellulose membrane (Pierce, Rockford, IL, USA) using a trans-blot cell (Gibco BRL, Carlsbad, CA, USA) at 15 V for 90 min. The nitrocellulose was incubated in 5% non-fat milk (Difco, Sparks, MD, USA) for 1 h and incubated with primary monoclonal antibody of mouse anti-Penaeus merguiensis TCTP (Abmart, Shanghai, China) diluted at 1:1000 with 5% skim milk in TBS-T (0.5% Tween® 20, 154 mM NaCl, 48 mM Tris-base, 40 mM Tris-base) for 1 h and washed 15 min each for six times with TBS-T buffer. The membrane was incubated with secondary antibody of horseradish peroxidase (HRP)conjugated anti-mouse IgG (Jackson Immunoresearch, USA) diluted at 1:50,000 with 5% skim milk in TBS-T for 1 h and washed six times with TBS-T buffer. Bound antibodies were detected by using an equal volume of Supersignal West Pico stable/peroxide solution with Supersignal West Pico luminol/enhancer solution (1:1) for 5 min (SuperSignal Wignal West Pico Chemiluminescent Substrate, PIRCE) and the final reaction was detected by X-ray radiography. 2.7. Alkaline phosphatase (ALP) activity assay The effect of different GICs specimens on osteoblast differentiation was determined by ALP activity. There were 4 groups of the specimens (see Table 1). The total amount of TCTP added in group GIC + TCTP and BIO-GIC + TCTP was 100 ng per specimen and the control group was cells cultured without the specimens (n = 5 in each group). NHost cells at 4 × 104 cells were seeded on each specimen that had been placed on 24-well culture plate with normal culture media supplemented with 50 μg/ml of ascorbic acid. The medium was changed every 2 days for 7 and 14 days before the assay. The ALP activity was measured using p-nitrophenol phosphate as a substrate. Cells were rinsed twice with PBS pH 7.4 and scraped in 0.2 ml of alkaline lysis buffer (2 mM MgCl2, 10 mM Tris–HCl, 0.1% Triton-X 100, pH 10). Centrifuged at 1000 ×g at 4 °C for 5 min, the supernatant was collected and analyzed for the total protein and ALP activity. For ALP activity, 5 μl of each sample was mixed with 50 μl of buffer containing 2 mg/ml p-nitrophenol phosphate in 0.1 M 2-amino-2-methyl-1-propanol (AMP), 2 mM MgCl2, pH 10.5 as a substrate and incubated at 37 °C for 30 min. Then the reaction was stopped with 0.8 ml 50 mM NaOH and the absorbance was measured at 405 nm against its own blank. The total protein of sample was investigated by using BCA kit. ALP activity was calculated as nanomolar of pnitrophenol per μg of total protein and then adjusted to the percentage compared to the control, which was cells cultured without any specimen. 2.8. Alizarin red S (ARS) assay Alizarin red staining (ARS) assay [15] was used to determine calcium deposition. There were four groups of specimens assigned the same size of the specimen and the same amount of TCTP supplemented as in ALP experiment: GIC and BIO-GIC with and without TCTP with cells, two groups: GIC and BIO-GIC without cells and the positive control group was cells cultured in an inductive medium, which was composed of 10 mM β-glycerophosphate, 100 units/ml penicillin, 100 mg/ml streptomycin and 100 mg/ml antibiotic-antimycotic in α-MEM with 20% fetal calf serum. NHost cells (4 × 104 cells/well) were seeded on specimens (12 mm diameter and 1 mm thickness) that had been placed on
63
24-well plate. The cells were fed with 500 μl/well of inductive medium at 37 °C in a humidified atmosphere containing 5% CO2. After the first 24 h, the medium was refreshed and then the medium was replaced every 2 days. After 7 and 14 days the medium was removed and cells were washed with PBS pH 7.4 and fixed in 10% (v/v) formaldehyde (Sigma, Life Science, USA) at room temperature for 15 min and washed twice with 500 μl/well of 40 mM ARS pH 4.1 in ultrapure water at room temperature for 30 min. After removal of ARS, the plate was washed four times with ultrapure water, while shaking for 5 min, dry extraction and then stored at −20 °C. For quantification of the staining, 100 μl of 10% (v/v) acetic acid was added to each well and incubated at room temperature for 30 min with shaking. This was then transferred to 1.5 ml tube with 100 μl mineral oil (Sigma, Life Science, USA) added, heated to exactly 85 °C for 10 min and transferred to ice for 5 min. It was then centrifuged at 20,000 ×g for 15 min, 100 μl of the supernatant was taken to a 96-well plate and 40 μl of 10% (v/v) ammonium hydroxide was added. The absorbance of the sample was measured in an ELISA reader at 405 nm against its own blank.
2.9. Gene expression Quantitative real-time PCR (qRT-PCR) was used to determine the effect of each specimen on osteoblast differentiation. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expression were investigated and GAPDH was selected to be an internal control. The primers (5′- and 3′-) were designed from the select sequences and synthesized as shown in Table 2. There were 4 groups of the specimens (see Table 1) 34 mm in diameter and 0.5 mm in thickness. TCTP at 700 ng/specimen was supplemented in the groups GIC + TCTP and BIO-GIC + TCTP. Each specimen had been placed on contact grid cultured plate (34 mm in diameter and 0.5 mm in thickness). NHost cells at 1 × 107 cells were seeded on each specimen and fed with 3000 μl/well of normal medium. After 24 h, the medium was refreshed and then changed every 2 days. After 24, 72 h and 7 days the medium was removed and cells were washed with PBS pH 7.4. Total RNA of cells were extracted and purified by RNeasy® Plus Micro kits (Qiagen, USA) and converted to cDNA with SuperScript™ III RT (Invitrogen, USA). The thermal profile for RT-PCR, under denaturing conditions was 65 °C for 5 min followed by cDNA synthesis at 50 °C for 30 min. The reaction was terminated at 85 °C for 5 min then the remaining RNA was removed by adding 1 μl of RNase H at 37 °C for 20 min and 5 μl of cDNA products was fractionated by 1.2% agarose gel electrophoresis and visualized by ethidium bromide staining by UV transillumination. The amount of cDNA products was calculated using spectrophotometer with the absorbance at 260 nm. SYBR Green PCR master mix (Roche, Mannheim, Germany) was used for qPCR analysis. The qPCR mix consisted of 2 μl of cDNA, 0.8 μl of forward and reverse primer, 10 μl of SYBR Green and 6.6 μl of nuclease-free water, and the negative control was distilled water instead of cDNA sample. The reaction was performed manually in duplicates in each sample, at a final volume of 20 μl. The thermal profile for amplification of the investigated gene was followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 30 s and then elongation at 72 °C for 30 s. After the end of the last cycle, the final quantification was reported as an amount after normalization to reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Table 2 Primers used for qRT-PCR. Gene
Sequence (5′ → 3′)
GenBank accession no.
OPN
F:ACACATATTGATGGCCGAAGGTGA R:TGTGAGGTGATGTCCTCGTCTGT F:GCTTCCGCCTGTTTGTGTTTG R:AAGAGACATGTGAGGATTAGCAGGT F: GCACCGTCAAGGCTGAGAAC R: ATGGTGGTGAAGACGCCAGT
(NM_00582)
BMP-2 GAPDH
(NM_007553.2) (NM_002046)
64
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
Relative values were analyzed using comparative cycle threshold (CT) method (ΔΔCT method). 2.10. Statistics analysis The result was analyzed for normality testing using the Shapiro and Wilk method. The quantitative data were expressed as means ± standard deviations. Statistical significance was evaluated using the one-way ANOVA and Tukey post hoc-test. P-values less than 0.05 were considered as statistically significant. 3. Results 3.1. Effect of TCTP on NHost cell viability NHost cells were exposed to various concentrations of Pmer-TCTP for 24 and 72 h and then cell viability was investigated by MTT assay. The Pmer-TCTP significantly increased cell viability, as measured by the activity of mitochondrial dehydrogenase on NHost cells in a dose- and time-dependent manner. It was found that cells exposed to Pmer-TCTP had less viability than the control (medium only) after culturing for 24 h. However, after 72 h, it was found that Pmer-TCTP at low concentration, especially 1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml and 10 μg/ml had significantly higher cells viability than the control (Fig. 1) (P b 0.05, t-test). High concentrations of TCTP at 15 μg/ml had a significant inhibitory effect on cell viability. It was apparent that after cells cultured for 72 h, Pmer-TCTP at 1 ng/ml and 10 ng/ml gave significantly (P b 0.05, t-test) higher optical density and percentages of viable cells (7% and 12% higher than control). Based from this result, it was decided that TCTP concentration in culture medium between 1–10 ng/ml should be used in order to promote cells growth and function for further studies. 3.2. TCTP released from different GICs The result of the released Pmer-TCTP band was shown in Fig. 2. The specimen group BIO-GIC with added Pmer-TCTP released higher quantity of the protein than group GIC with added Pmer-TCTP compared to control. In addition, protein Pmer-TCTP released from GIC with added Pmer-TCTP was lower than the control. However, group GIC and BIOGIC without Pmer-TCTP cannot detect the released protein.
Fig. 2. Western blot of TCTP release from GIs with added Pmer-TCTP. Lane 1, 2: TCTP control, Lane 3: Pmer-TCTP release from GIC, Lane 4: TCTP release from BIO-GIC.
(P b 0.05) and the percentages of proliferation cells were over 100% compared to control (medium only). In addition, the group BIO-GIC + 10 ng had cell proliferation significantly less than group BIO-GIC + 1 ng (P b 0.05). However, it was noted that the groups GIC, GIC + 1 ng, GIC + 10 ng and BIO-GIC had cell proliferation lower than the control. 3.4. Alkaline phosphatase (ALP) activity of NHost cells The ALP activity of NHost cells after being cultured on GICs with added Pmer-TCTP for 7 and 14 days has been shown in Fig. 4. The ALP activity of cell group BIO-GIC with and without Pmer-TCTP cultured for 7 days was significantly (P b 0.05) higher than the ALP activity of cells after cultured with the same group of the specimen for 14 days. The ALP activity of cells cultured on BIO-GIC added PmerTCTP for 7 days was significantly higher (P b 0.05) than the group BIOGIC without Pmer-TCTP. However, the ALP activities of cells on GIC with and without TCTP were lower than other groups in both 7 and 14 days. 3.5. Mineralization of NHost cells The result of calcium deposition from NHost cells exposed to different GICs for 7 and 14 days investigated by alizarin red S (ARS) assay was shown in Fig. 5. It was found that the level of calcium content group BIOGIC added Pmer-TCTP after culture for 14 days was higher than the other specimen groups, but lower than the control (P b 0.05).
3.3. Effect of GICs supplemented with TCTP on proliferation of NHost cells 3.6. Gene expression The result of cell proliferation investigated by BrdU assay was shown in Fig. 3. It was found that the specimens of BIO-GIC added Pmer-TCTP at 1 ng/specimen promoted cells proliferation higher than other groups
Fig. 1. The effect of Pmer-TCTP on human osteoblasts viability investigated by MTT assay (n = 6 in each group).
The pattern of BMP-2 was different between each group. The response of BMP-2 gene was reported as an average of fold expression (Fig. 6 A). In BIO-GIC with TCTP group, the BMP-2 gene expression increased gradually during culture. The expression of BMP-2 mRNA increased in the early phase of osteoblasts culture. A higher level of expression was observed in the Pmer-TCTP group on day 3 of the culture (P b 0.05), later than the up-regulation of BMP-2 gene on day 3, and the expression of BMP-2 gene down-regulated on day 7. However, the down-regulation of BMP-2 gene was significantly indicated in GIC and BIO-GIC without added Pmer-TCTP on day 1 and day 7. Although a significant expression of BMP-2 gene was observed between GIC and BIO-GIC on day 3, either with or without added Pmer-TCTP on day 1 and GIC and GIC added Pmer-TCTP on day 7. In addition, Pmer-TCTP resulted in slightly up-regulated in BIO-GIC with Pmer-TCTP cells immediately until day 3 compared with each time period of without added Pmer-TCTP group. The expression of OPN gene was lower than control in all groups (Fig. 6 B). BIO-GIC with and without Pmer-TCTP slightly up-regulation on day 1 until on day 3 and down-regulated on day 7 (P b 0.05). GIC added Pmer-TCTP demonstrated down-regulation on day 3 (P b 0.05) compared to the control. However, the down-regulation of OPN gene
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
65
Fig. 3. Effect of GICs supplemented with TCTP on NHost cells proliferation investigated by BrdU assay. *, ** and different letters denote significant difference (P b 0.05, one-way ANOVA with Tukey multiple comparison test, n = 10 in each group).
was significantly indicated in BIO-GIC without added Pmer-TCTP on both day 1 and day 3. A significant expression of OPN gene was observed between GIC and BIO-GIC at day 1 either with or without added Pmer-TCTP on day 3 and GIC and GIC added Pmer-TCTP on day 7. The fold change of both BMP-2 and OPN gene expression of cells cultured on specimens with added Pmer-TCTP increased gradually with up-regulation after day 1 and reach the highest on day 3 then downregulation on day 7. 4. Discussion BIO-GIC is a conventional glass ionomer cement that has been modified by adding chitosan and albumin in order to prolong the release of the supplemented protein with its retained biological properties [8,9]. This study evaluated the effect of Pmer-TCTP, the supplemented protein, in this novel material on osteoblast cells. Low concentrations of PmerTCTP at 1 and 10 ng/ml are not cytotoxic to human osteoblasts. In contrast, they can increase cell viability after exposure for 72 h, which is similar to the result of a previous study that found that TCTP can
increase cell viability of human dental pulp cells [14]. However, it was noted that cells exposed to low concentrations of TCTP after 24 h had less viability than control and after 72 h had higher cell viability than control. This means that TCTP might not only directly promote cell proliferation. It was also found that TCTP could reduce cell death or act as an anti-apoptotic, which was controlled by a negative feedback loop with P53 [16]. Cells treated with certain concentrations of TCTP may have less cell death and led to higher number of cell proliferation than the control after 72 h. Another explanation is that TCTP may increase the expression of other growth factors especially BMP-2, as shown in Fig. 6. GIC + TCTP and BIO-GIC + TCTP had higher BMP-2 expression on day 1 and highest expression on day 3 than the materials without TCTP and the control. BMP-2 can increase osteoblast proliferation and differentiation [17]. The concentration of TCTP added in the specimen was based on the result from the MTT assay, size of the specimen and our previous study, which found that protein release from the specimen at the early phase was approximately 1/100 of the added protein [8]. From the result in Fig. 2, BIO-GIC with added Pmer-TCTP protein released higher quantity of the protein than the group GIC with
Fig. 4. ALP activity of NHost cells cultured on with and without Pmer-TCTP supplemented GICs for 7 and 14 days. *Denotes significant difference compared with control group (culture medium) at P b 0.05. #Denotes significant difference compared within group at P b 0.05 (n = 5 in each group).
66
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
Fig. 5. Cell mineralization measured by ARS assay. *Denotes significant difference compared within group at P b 0.05 (n = 5 in each group).
added Pmer-TCTP, supported the previous report that chitosan and albumin added in glass ionomer cement can prolong and increase the release of protein [8]. This might be due to the formation of
polyelectric complexes between the anionic groups of poly (acrylic acid) and the cationic groups of chitosan that used to prolong drug delivery [18].
Fig. 6. The fold change of BMP-2 expression (A) and OPN expression (B) of NHost cells cultured on GIs supplemented with and without Pmer-TCTP determined by qRT-PCR. *, **, ***Significant difference compared with control group (culture medium) at P b 0.05. #Significant difference compared between groups at P b 0.05.
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
In Fig. 3, the cell proliferation of BIO-GIC was lower than that in control. In Fig. 1, the cell viability of TCTP at 1 ng/ml was almost the same as control group (cell cultured in medium only). This means that BIOGIC may release some cytotoxic substances, which cells had been exposed for 3 days. But it did not mean that BIO-GIC cannot promote bone cell growth in the long term. In Fig. 3, the average (mean) percentage of cell proliferation of GIC was about 7% of the control, while GIC + TCTP had the mean percentage of cell proliferation about 39%, which is about 5 times that of the GIC group. This may reveal the high cytotoxicity of GIC after cells cultured for 3 days and the effect of TCTP to reduce cell death. It was also noted that BIO-GIC had a mean percentage of cell proliferation of about 72%, which was about 10 times higher than GIC. BIO-GIC had less cytotoxicity than GIC to osteoblasts, the same results to dental pulp cells in previous studies [8,9]. The cell proliferation of BIOGIC + 1 ng TCTP was 360% of the control. That means, the combination of BIO-GIC and TCTP showed high promotion of cell proliferation. The mechanism of chitosan, one component of BIO-GIC, to reduce cytotoxicity is not known, but free chitosan has been found to promote osteoblast proliferation [13]. Whereas BSA itself has the property to bind toxic chemical [19] which may reduce the cytotoxicity of BIO-GIC. The low concentration of TCTP may reduce cell death from the cytotoxicity of the material and promote cell proliferation. The proliferation promotion of TCTP may also result from the increased BMP-2 expression more than 3 times of the control as shown in Fig. 6. This protein can act as a proliferative factor in osteoblasts [17]. However, further investigation will be required. Moreover, BIO-GIC also had higher ALP activity (Fig. 4) as well as calcium deposition (Fig. 5) than the GIC group, which could be the effect of chitosan according to a recent study found that free chitosan can promote osteoblast proliferation and osteogenesis in mesenchymal stem cells [13]. TCTP added in BIO-GIC obviously increased cell proliferation, increased ALP activity and promoted calcium deposition. In this study, we used Pmer-TCTP from banana prawn, which also had biological effect on human osteoblasts (NHost cells). This may come from its conserved protein that can promote cell proliferation and differentiation. TCTP is a highly conserved protein and is involved in important cellular processes, cell growth and cell cycle progression, and can protect cells from various stress conditions and apoptosis due to its biological properties [19]. The result from MTT assay and BrdU assay suggested that the PmerTCTP at low concentration 1–100 ng/ml promote cells growth, while at high concentration may gave the opposite result. The recent study found that TCTP can function as a growth promoter and the high levels of TCTP expression were associated with tumorigenesis, while P53 prevented the growth and survival of potentially malignant cells [20]. So the high concentration of Pmer-TCTP (10–20 μg/ml) resulted in slightly reduced cell proliferation, which may be due to the excess of TCTP that may activate antagonism like P53 to balance cells proliferation. BMP-2 was highly involved in the induction of osteoblast differentiation and enhancing bone matrix production [21,22]. This study showed that TCTP can promote BMP-2 expression as noted in the group GIC + TCTP and BIO-GIC + TCTP. However, BIO-GIC + TCTP had upregulate BMP-2 expression earlier (days 1 and 3) than GIC + TCTP group and nearly about 3 times higher, which may be due to the higher amount of TCTP released from BIO-GIC + TCTP than GIC + TCTP and the higher cytotoxicity of GIC than BIO-GIC. OPN, a highly phosphorylated sialoprotein, is a major component of the mineralized extracellular matrix of bone. The role of OPN in bone mineralization is not clear. It may modulate hydroxyapatite formation, either by preventing crystal growth in “inappropriate” areas or by regulating crystal growth in size and shape [23]. However, OPN did not affect osteoblast cell development in vitro [24]. In this study, the expressions of OPN in BIO-GIC and BIO-GIC with TCTP were higher than GIC but lower than the control, which may confirm the higher cytotoxicity of GIC than BIO-GIC and BIO-GIC with TCTP.
67
5. Conclusion Low concentrations of TCTP can increase cell viability after exposure for 72 h. BIO-GIC is a modified GIC by adding chitosan and albumin. BIO + GIC added TCTP can release greater quantities of the protein than GIC + TCTP. Human osteoblasts cultured on BIO-GIC + TCTP had demonstrably higher cell proliferation, up-regulated BMP-2 expression earlier (days 1 and 3), higher ALP activity and higher calcium deposition compared to GIC and GIC + TCTP. Further studies about this material are required; however, this modified glass ionomer cement shows some promise for further development in assisting regeneration of bone tissue. Acknowledgments This work was supported by the Higher Education Research Promotion and National Research University Project of Thailand and the Center of Excellence in Medical Biotechnology: CEMB, PERDO, The Office of the Higher Education Commission, Thailand, as well as a Postgraduate grant, Prince of Songkla University. References [1] A.D. Wilson, B.E. Kent, A new translucent cement for dentistry. The glass ionomer cement, Br. Dent. J. 132 (1972) 133–135. [2] P.V. Hatton, K. Hurrell-Gillingham, I.M. Brook, Biocompatibility of glass-ionomer bone cements, J. Dent. 34 (2006) 598–601. [3] A. Oliva, F. Della Ragione, A. Salerno, V. Riccio, G. Tartaro, A. Cozzolino, S. D'Amato, G. Pontoni, V. Zappia, Biocompatibility studies on glass ionomer cements by primary cultures of human osteoblasts, Biomaterials 17 (1996) 1351–1356. [4] G. Babighian, Use of a glass ionomer cement in otological surgery. A preliminary report, J. Laryngol. Otol. 106 (1992) 954–959. [5] G.M. Serin, B. Cam, U. Derinsu, M. Sari, C. lar Batman, Incus augmentation with glass ionomer cement in primary and revision stapes surgery, Ear Nose Throat J. 89 (2010) 589–593. [6] B.T. Harris, R. Caicedo, W.S. Lin, D. Morton, Treatment of a maxillary central incisor with class III invasive cervical resorption and compromised ferrule: a clinical report, J. Prosthet. Dent. 111 (2014) 356–361. [7] M.P. Santamaria, D. da Silva Feitosa, M.Z. Casati, F.H. Nociti Jr., A.W. Sallum, E.A. Sallum, Randomized controlled clinical trial evaluating connective tissue graft plus resin-modified glass ionomer restoration for the treatment of gingival recession associated with non-carious cervical lesion: 2-year follow-up, J. Periodontol. 84 (2013) e1–8. [8] A. Limapornvanich, S. Jitpukdeebodintra, C. Hengtrakool, U. Kedjarune-Leggat, Bovine serum albumin release from novel chitosan-fluoro-aluminosilicate glass ionomer cement: stability and cytotoxicity studies, J. Dent. 37 (2009) 686–690. [9] N. Rakkiettiwong, C. Hengtrakool, K. Thammasitboon, U. Kedjarune-Leggat, Effect of novel chitosan-fluoroaluminosilicate glass ionomer cement with added transforming growth factor beta-1 on pulp cells, J. Endod. 37 (2011) 367–371. [10] L. Casettari, D. Vllasaliu, J.K. Lam, M. Soliman, L. Illum, Biomedical applications of amino acid-modified chitosans: a review, Biomaterials 33 (2012) 7565–7583. [11] L. Hu, Y. Sun, Y. Wu, Advances in chitosan-based drug delivery vehicles, Nanoscale 5 (2013) 3103–3111. [12] L.R. Amir, D.F. Suniarti, S. Utami, B. Abbas, Chitosan as a potential osteogenic factor compared with dexamethasone in cultured macaque dental pulp stromal cells, Cell Tissue Res. 358 (2014) 407–415. [13] M.L. Tan, P. Shao, A.M. Friedhuber, M. van Moorst, M. Elahy, S. Indumathy, D.E. Dunstan, Y. Wei, C.R. Dass, The potential role of free chitosan in bone trauma and bone cancer management, Biomaterials 35 (2014) 7828–7838. [14] N. Wanachottrakul, W. Chotigeat, U. Kedjarune-Leggat, Translationally controlled tumor protein against apoptosis from 2-hydroxy-ethyl methacrylate in human dental pulp cells, J. Mater. Sci. Mater. Med. 22 (2011) 1479–1487. [15] C.A. Gregory, W.G. Gunn, A. Peister, D.J. Prockop, An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction, Anal. Biochem. 329 (2004) 77–84. [16] M. Nagano-Ito, S. Ichikawa, Biological effects of mammalian translationally controlled tumor protein (TCTP) on cell death, proliferation, and tumorigenesis, Biochem. Res. Int. 2012 (2012) 204960. [17] A. Robubi, C. Berger, M. Schmid, K.R. Huber, A. Engel, W. Krugluger, Gene expression profiles induced by growth factors in in vitro cultured osteoblasts, Bone Joint Res. 3 (2014) 236–240. [18] P.M. de la Torre, G. Torrado, S. Torrado, Poly (acrylic acid) chitosan interpolymer complexes for stomach controlled antibiotic delivery, J. Biomed. Mater. Res. B Appl. Biomater. 72 (2005) 191–197. [19] U.A. Bommer, B.J. Thiele, The translationally controlled tumour protein (TCTP), Int. J. Biochem. Cell Biol. 36 (2004) 379–385. [20] R. Amson, S. Pece, A. Lespagnol, R. Vyas, G. Mazzarol, D. Tosoni, I. Colaluca, G. Viale, S. Rodrigues-Ferreira, J. Wynendaele, O. Chaloin, J. Hoebeke, J.C. Marine, P.P. Di Fiore, A. Telerman, Reciprocal repression between P53 and TCTP, Nat. Med. 18 (2011) 91–99.
68
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
[21] D. Chen, M. Zhao, G.R. Mundy, Bone morphogenetic proteins, Growth Factors 22 (2004) 233–241. [22] O.F. Zouani, L. Rami, Y. Lei, M.C. Durrieu, Insights into the osteoblast precursor differentiation towards mature osteoblasts induced by continuous BMP-2 signaling, Biol. Open 2 (2013) 872–881.
[23] G.K. Hunter, Role of osteopontin in modulation of hydroxyapatite formation, Calcif. Tissue Int. 93 (2013) 348–354. [24] E. Holm, J.S. Gleberzon, Y. Liao, E.S. Sorensen, F. Beier, G.K. Hunter, H.A. Goldberg, Osteopontin mediates mineralization and not osteogenic cell development in vitro, Biochem. J. 464 (2014) 355–364.
Contents lists available at ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Translationally controlled tumor protein supplemented chitosan modified glass ionomer cement promotes osteoblast proliferation and function Jiraporn Sangsuwan a,b, Supreya Wanichpakorn b, Ureporn Kedjarune-Leggat b,⁎ a b
Department of Molecular Biology and Bioinformatics, Center for Genomics and Bioinformatics Research, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand Department of Oral Biology and Occlusion, Faculty of Dentistry, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand
a r t i c l e
i n f o
Article history: Received 25 November 2014 Received in revised form 13 March 2015 Accepted 21 April 2015 Available online 24 April 2015 Keywords: TCTP Glass ionomer cement Chitosan Osteoblast Bone cement
a b s t r a c t The objective of this study was to evaluate the effect of translationally controlled tumor protein (TCTP) supplemented in a novel glass ionomer cement (BIO-GIC) on normal human osteoblasts (NHost cells). BIO-GIC was a glass ionomer cement (GIC) modified by adding chitosan and albumin to promote the release of TCTP. NHost cells were seeded on specimens of GIC, GIC + TCTP, BIO-GIC and BIO-GIC + TCTP. Cell proliferation was determined by BrdU assay. It was found that BIO-GIC + TCTP had significantly higher proliferation of cells than other specimens. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expressions assessed by quantitative real time PCR and alkaline phosphatase (ALP) activity were used to determine cell differentiation. Bone cell function was investigated by calcium deposition using alizarin assay. Both BMP-2 and OPN gene expressions of cells cultured on specimens with added TCTP increased gradually up-regulation after day 1 and reached the highest on day 3 then down-regulation on day 7. The ALP activity of cells cultured on BIO-GIC + TCTP for 7 days and calcium content after 14 days were significantly higher than other groups. BIO-GIC + TCTP can promote osteoblast cells proliferation, differentiation and function. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Glass ionomer cements (GICs) were originally used for dental restorations. They were based on the acid–base reaction between fluoroaluminosilicate glass powder and polyalkenoic acids, mainly poly (acrylic acid) [1]. Because of their chemical property as adhesive cements that could bind with bone, metals and synthetic materials with good biocompatibility to oral tissue as well as bone cells [2,3], they also had medical applications being modified as bone cements in orthopedic surgery. GICs were used in otologic surgery [4,5] and resin modified glass ionomer cement (RMGIC) was used in periodontal surgery [6, 7]. The development of GICs for promoting bone healing or regeneration may contribute to the clinical application of using these materials as bone cements or bioactive implant material. Recently, the combination of chitosan and albumin in GIC has been shown to promote the release of protein or growth factor [8,9]. Chitosan is a co-polymer of glucosamine and N-acetyl-D-glucosamine, a deacetylation product of chitin, a natural polymer found in shells of marine crustaceans and cell walls of fungi. This polymer has been widely used in pharmaceutical and biomedical applications due to its antibacterial property, ability to assist in drug delivery, biodegradability and biocompatibility [10,11]. Chitosan
⁎ Corresponding author.
http://dx.doi.org/10.1016/j.msec.2015.04.036 0928-4931/© 2015 Elsevier B.V. All rights reserved.
can promote dental pulp cell proliferation and early osteogenic differentiation in vitro [12] and free chitosan can promote osteoblast proliferation and osteogenesis in mesenchymal stem cells [13]. Translationally controlled tumor protein (TCTP) is a highly conserved protein that is widely expressed in all eukaryotic organisms. TCTP is involved in many cellular processes, such as cell growth and cell cycle progression and it can protect cells from various stress conditions. It was recently found that this protein can reduce RMGIC induced apoptotic cells and can also promote pulp cell mineralization [14]. The hypothesis of this study is to prove that supplementing TCTP in the BIO-GIC, which came from the addition of chitosan and albumin in the conventional GIC, will improve its property of inducing bone cell proliferation and function. 2. Materials and methods 2.1. Expression and purification of translationally controlled tumor protein (TCTP) TCTP gene derived from Penaeus merguiensis was cloned and expressed in the bacteria Escherichia coli (E. coli) strain BL21. The protein was purified following the methods described by Wanachottrakul et al. [14]. Briefly, E. coli strain BL21 harboring pGEX-Pmer-TCTP was inoculated and induced by 1 mM IPTG (isopropyl β-D-thiogalactopyronositol). After
62
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
induction, the bacteria cells were harvested by centrifugation and the GST-TCTP protein was purified by using Glutathione Sepharose 4 Fast Flow (GE Healthcare Bio-Science, Piscataway, NJ, USA) and thrombin. The purified Pmer-TCTP protein with molecular mass about 19.2 kDa was analyzed by SDS-PAGE and protein concentration was determined by a BCA protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA).
2.2. Osteoblast culture Normal human osteoblast cells (NHost cells) from human long bones (femur) were purchased from Cambrex (Lonza Walkersville, Inc., USA). The NHost cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2 in grown medium Alpha-modified Eagle's medium (α-MEM) supplemented with 20% fetal bovine serum (FBS), 100 units/ml penicillin, 100 mg/ml streptomycin and 100 mg/ml antibiotic-antimycotic (Invitrogen Corporation, Grand Island, NY). The culture medium was replenished every 2–3 days. After reaching 90% confluence, cells were trypsinized using 0.01% trypsin with EDTA. NHost cells passage between two and six were used in this study.
2.4. Cell viability assay The effect of TCTP at various concentrations at two time periods (24 and 72 h) on cell viability was determined by 3-(4, 5-dimethylthiazol-2yl)-2,5-diphenylterrazolium bromide or MTT assay. NHost cells at 5 × 103 cells/well were seeded in 96-well plates at 37 °C in a humidified atmosphere containing 5% CO2. After 24 h, the culture medium was changed with fresh medium mixed with TCTP at various concentrations from 0.01 μg/ml to 15 μg/ml for 24 and 72 h. The control group was a normal culture medium without TCTP and each group had 6 replications. After that, the medium was removed, 200 μl of fresh medium containing 10 mM HEPES pH 7.4 was added to each well, and 50 μl MTT solution at 5 mg/ml in phosphate buffer solution (PBS) at pH 7.4 was added to each well and incubated in the dark for 3 h at 37 °C in a humidified atmosphere containing 5% CO2. The medium and MTT were then removed and 200 μl of DMSO and 25 μl of Sorensen's glycine buffer (0.1 M glycine plus 0.1 M NaCl equilibrated to pH 10.5 with 0.1 M NaOH) were added. The optical density (OD) was measured at 570 nm. The OD values corrected for blank (medium as culture) of the experimental groups will be divided by the control and expressed as a percentage of the control, which represented the percentage of viable cells.
2.3. Specimen preparation
2.5. Cell proliferation ELISA, BrdU (colorimetric) assay
GIC used in this study was a conventional material 3 M™ (3 M ESPE Ketac™ Molar Easymix, St Paul, MN, USA). The powder (batch no. 56,633) was composed of Al–Ca–La fluorosilicate glass and 5% copolymer acid (acrylic and maleic acid) and the liquid was composed of polyalkenoic acid, tartaric acid and water. The new formulation of GIC in this study was assigned as BIO-GIC. The powder of BIO-GIC was composed of GIC powder incorporated with 15% (by weight) of chitosan and 5% (by weight) of bovine serum albumin (BSA). The liquid part of BIOGIC was composed of polyalkenoic acid, tartaric acid and water, the same components as in the liquid part of GIC. Chitosan used in this study had a molecular weight of about 62 kDa and 89.1% degree of deacetylation (TMECO, Thailand). The groups of different GICs and their compositions have been described in Table 1. Two sizes of disk specimens prepared by Teflon molds (7 mm diameter and 1 mm thickness for cell viability and cell proliferative assay, 12 mm diameter and 1 mm thickness for alkaline phosphatase and Alizarin assay) were used. The cements were hand-mixed following the manufacturer's instruction. One scoop of powder was mixed with one drop of liquid using a stainless steel spatula and then packed into split ring Teflon molds at a room temperature of 22 ± 3 °C. TCTP (solution concentration, 2 μg/μl) was added at this time for the two groups with TCTP supplement (GIC + TCTP and BIO-GIC + TCTP). The uniform mixing cement was then transferred into the ring Teflon molds. A polythene sheet and glass slide was then placed over the filled mold after which light hand pressure was applied. Specimens were retained in the mold during storage in an incubator at 37 °C for 1 h. After storage in an incubator, the specimens were removed from their molds and ready for further experiments.
The effect of GICs and TCTP on osteoblast cells was determined by cell proliferative assay using a commercial kit, Cell Proliferation ELISA, BrdU (colorimetric) (Roche, Mannheim, Germany). This assay was designed to quantitate cell proliferation based on the measurement of 5bromo-2-deoxyuridine (BrdU) incorporation during DNA synthesis in proliferating cells. From the result of MTT assay, the concentrations of TCTP that can promote cell growth in culture media was 1 ng/ml and 10 ng/ml. The amount of TCTP supplemented in GIC and BIO-GIC (size 12 mm diameter and 1 mm thickness) was estimated about 100 times based on our previous study [8]. So in specimen groups GIC + 1 ng, and BIO-GIC + 1 ng, TCTP at 100 ng was added in each specimen during mixing the cement while in groups GIC + 10 ng and BIO-GIC + 10 ng, TCTP at 100 ng per specimen was supplemented. The specimens were divided into seven groups and each group composed of 6 replicates. Six groups of the specimens were GIC, BIO-GIC, GIC + TCTP and BIOGIC + TCTP, at 2 concentrations. NHost cells were seeded at 7000 cells directly on each specimen, which was placed on 96-well culture plate. The control group was cells cultured at the same density without any specimen. Cells were fed with 200 μl of normal culture medium. The culture plates were kept for 72 h before the BrdU assays were performed. The assay was followed the manufacturer's instruction. Briefly, the culture medium was removed and refreshed with 100 μl/well normal medium pre-mixed with BrdU labeling solution and left for 2 h at 37 °C. Then the labeling medium was removed and FixDenat was added; following which, it was incubated for 30 min at 25 °C. FixDenat solution was then removed and anti-BrdU-POD working solution was added. It was then incubated for 90 min at 25 °C. The antibody conjugate was then removed and washed three times with PBS at pH 7.4 and substrate solution was added until color development was sufficient for photometric detection. Then, 25 μl 1 M H2SO4 was added to each well and incubated for 1 min on the shaker at 300 rpm. The absorbance of the sample was measured at 450 nm against its own blank. The blank of each group was the similar specimen or the culture plate without seeded cells but was treated using the same procedure as the groups that had seeded cells.
Table 1 Compositions of the powder of different groups of GIs specimens. Group of specimens
Powder compositions
GIC
Calcium fluoroaluminosilicate glass and 5% copolymer acid (acrylic and maleic acid) Calcium fluoroaluminosilicate glass and 5% copolymer acid (acrylic and maleic acid) with added TCTP during mixing the cement Calcium fluoroaluminosilicate glass, 5% copolymer acid (acrylic and maleic acid), 15% chitosan and 5% BSA Calcium fluoroaluminosilicate glass, 5% copolymer acid (acrylic and maleic acid), 15% chitosan and 5% BSA with added TCTP during mixing the cement
GIC + TCTP BIO-GIC BIO-GIC + TCTP
2.6. Western blotting The TCTP released from BIO-GIC + TCTP and GIC + TCTP respectively was investigated by western blot assay. TCTP at 100 ng/specimen was supplemented in each group of the specimens during mixing the powder and liquid components that has been described above, while the
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
negative control groups were BIO-GIC and GIC without TCTP. Each specimen was placed in plastic tube with 1 ml of PBS. The PBS with 1 ng/ml of TCTP in a plastic tube was used as a positive control. All tubes were kept for 1 h in shaking incubator at 37 °C and 170 rpm. Then each immersed PBS was concentrated with the freeze dryer at 80 °C and was reconstituted with 10 μl PBS before being analyzed with western blot and the amount of protein was determined by BCA protein assay kit (Pierce, Rockford, IL, USA). Briefly, equal amounts of protein from each sample was mixed with Laemmli sample buffer with reducing agent and subjected to electrophoresis on a 12% polyacrylamide gel along with pre-stained high molecular weight standards (Bio-Rad, Hercules, CA, USA). The proteins were transferred to nitrocellulose membrane (Pierce, Rockford, IL, USA) using a trans-blot cell (Gibco BRL, Carlsbad, CA, USA) at 15 V for 90 min. The nitrocellulose was incubated in 5% non-fat milk (Difco, Sparks, MD, USA) for 1 h and incubated with primary monoclonal antibody of mouse anti-Penaeus merguiensis TCTP (Abmart, Shanghai, China) diluted at 1:1000 with 5% skim milk in TBS-T (0.5% Tween® 20, 154 mM NaCl, 48 mM Tris-base, 40 mM Tris-base) for 1 h and washed 15 min each for six times with TBS-T buffer. The membrane was incubated with secondary antibody of horseradish peroxidase (HRP)conjugated anti-mouse IgG (Jackson Immunoresearch, USA) diluted at 1:50,000 with 5% skim milk in TBS-T for 1 h and washed six times with TBS-T buffer. Bound antibodies were detected by using an equal volume of Supersignal West Pico stable/peroxide solution with Supersignal West Pico luminol/enhancer solution (1:1) for 5 min (SuperSignal Wignal West Pico Chemiluminescent Substrate, PIRCE) and the final reaction was detected by X-ray radiography. 2.7. Alkaline phosphatase (ALP) activity assay The effect of different GICs specimens on osteoblast differentiation was determined by ALP activity. There were 4 groups of the specimens (see Table 1). The total amount of TCTP added in group GIC + TCTP and BIO-GIC + TCTP was 100 ng per specimen and the control group was cells cultured without the specimens (n = 5 in each group). NHost cells at 4 × 104 cells were seeded on each specimen that had been placed on 24-well culture plate with normal culture media supplemented with 50 μg/ml of ascorbic acid. The medium was changed every 2 days for 7 and 14 days before the assay. The ALP activity was measured using p-nitrophenol phosphate as a substrate. Cells were rinsed twice with PBS pH 7.4 and scraped in 0.2 ml of alkaline lysis buffer (2 mM MgCl2, 10 mM Tris–HCl, 0.1% Triton-X 100, pH 10). Centrifuged at 1000 ×g at 4 °C for 5 min, the supernatant was collected and analyzed for the total protein and ALP activity. For ALP activity, 5 μl of each sample was mixed with 50 μl of buffer containing 2 mg/ml p-nitrophenol phosphate in 0.1 M 2-amino-2-methyl-1-propanol (AMP), 2 mM MgCl2, pH 10.5 as a substrate and incubated at 37 °C for 30 min. Then the reaction was stopped with 0.8 ml 50 mM NaOH and the absorbance was measured at 405 nm against its own blank. The total protein of sample was investigated by using BCA kit. ALP activity was calculated as nanomolar of pnitrophenol per μg of total protein and then adjusted to the percentage compared to the control, which was cells cultured without any specimen. 2.8. Alizarin red S (ARS) assay Alizarin red staining (ARS) assay [15] was used to determine calcium deposition. There were four groups of specimens assigned the same size of the specimen and the same amount of TCTP supplemented as in ALP experiment: GIC and BIO-GIC with and without TCTP with cells, two groups: GIC and BIO-GIC without cells and the positive control group was cells cultured in an inductive medium, which was composed of 10 mM β-glycerophosphate, 100 units/ml penicillin, 100 mg/ml streptomycin and 100 mg/ml antibiotic-antimycotic in α-MEM with 20% fetal calf serum. NHost cells (4 × 104 cells/well) were seeded on specimens (12 mm diameter and 1 mm thickness) that had been placed on
63
24-well plate. The cells were fed with 500 μl/well of inductive medium at 37 °C in a humidified atmosphere containing 5% CO2. After the first 24 h, the medium was refreshed and then the medium was replaced every 2 days. After 7 and 14 days the medium was removed and cells were washed with PBS pH 7.4 and fixed in 10% (v/v) formaldehyde (Sigma, Life Science, USA) at room temperature for 15 min and washed twice with 500 μl/well of 40 mM ARS pH 4.1 in ultrapure water at room temperature for 30 min. After removal of ARS, the plate was washed four times with ultrapure water, while shaking for 5 min, dry extraction and then stored at −20 °C. For quantification of the staining, 100 μl of 10% (v/v) acetic acid was added to each well and incubated at room temperature for 30 min with shaking. This was then transferred to 1.5 ml tube with 100 μl mineral oil (Sigma, Life Science, USA) added, heated to exactly 85 °C for 10 min and transferred to ice for 5 min. It was then centrifuged at 20,000 ×g for 15 min, 100 μl of the supernatant was taken to a 96-well plate and 40 μl of 10% (v/v) ammonium hydroxide was added. The absorbance of the sample was measured in an ELISA reader at 405 nm against its own blank.
2.9. Gene expression Quantitative real-time PCR (qRT-PCR) was used to determine the effect of each specimen on osteoblast differentiation. Bone morphogenetic protein-2 (BMP-2) and osteopontin (OPN) gene expression were investigated and GAPDH was selected to be an internal control. The primers (5′- and 3′-) were designed from the select sequences and synthesized as shown in Table 2. There were 4 groups of the specimens (see Table 1) 34 mm in diameter and 0.5 mm in thickness. TCTP at 700 ng/specimen was supplemented in the groups GIC + TCTP and BIO-GIC + TCTP. Each specimen had been placed on contact grid cultured plate (34 mm in diameter and 0.5 mm in thickness). NHost cells at 1 × 107 cells were seeded on each specimen and fed with 3000 μl/well of normal medium. After 24 h, the medium was refreshed and then changed every 2 days. After 24, 72 h and 7 days the medium was removed and cells were washed with PBS pH 7.4. Total RNA of cells were extracted and purified by RNeasy® Plus Micro kits (Qiagen, USA) and converted to cDNA with SuperScript™ III RT (Invitrogen, USA). The thermal profile for RT-PCR, under denaturing conditions was 65 °C for 5 min followed by cDNA synthesis at 50 °C for 30 min. The reaction was terminated at 85 °C for 5 min then the remaining RNA was removed by adding 1 μl of RNase H at 37 °C for 20 min and 5 μl of cDNA products was fractionated by 1.2% agarose gel electrophoresis and visualized by ethidium bromide staining by UV transillumination. The amount of cDNA products was calculated using spectrophotometer with the absorbance at 260 nm. SYBR Green PCR master mix (Roche, Mannheim, Germany) was used for qPCR analysis. The qPCR mix consisted of 2 μl of cDNA, 0.8 μl of forward and reverse primer, 10 μl of SYBR Green and 6.6 μl of nuclease-free water, and the negative control was distilled water instead of cDNA sample. The reaction was performed manually in duplicates in each sample, at a final volume of 20 μl. The thermal profile for amplification of the investigated gene was followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 30 s and then elongation at 72 °C for 30 s. After the end of the last cycle, the final quantification was reported as an amount after normalization to reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Table 2 Primers used for qRT-PCR. Gene
Sequence (5′ → 3′)
GenBank accession no.
OPN
F:ACACATATTGATGGCCGAAGGTGA R:TGTGAGGTGATGTCCTCGTCTGT F:GCTTCCGCCTGTTTGTGTTTG R:AAGAGACATGTGAGGATTAGCAGGT F: GCACCGTCAAGGCTGAGAAC R: ATGGTGGTGAAGACGCCAGT
(NM_00582)
BMP-2 GAPDH
(NM_007553.2) (NM_002046)
64
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
Relative values were analyzed using comparative cycle threshold (CT) method (ΔΔCT method). 2.10. Statistics analysis The result was analyzed for normality testing using the Shapiro and Wilk method. The quantitative data were expressed as means ± standard deviations. Statistical significance was evaluated using the one-way ANOVA and Tukey post hoc-test. P-values less than 0.05 were considered as statistically significant. 3. Results 3.1. Effect of TCTP on NHost cell viability NHost cells were exposed to various concentrations of Pmer-TCTP for 24 and 72 h and then cell viability was investigated by MTT assay. The Pmer-TCTP significantly increased cell viability, as measured by the activity of mitochondrial dehydrogenase on NHost cells in a dose- and time-dependent manner. It was found that cells exposed to Pmer-TCTP had less viability than the control (medium only) after culturing for 24 h. However, after 72 h, it was found that Pmer-TCTP at low concentration, especially 1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml and 10 μg/ml had significantly higher cells viability than the control (Fig. 1) (P b 0.05, t-test). High concentrations of TCTP at 15 μg/ml had a significant inhibitory effect on cell viability. It was apparent that after cells cultured for 72 h, Pmer-TCTP at 1 ng/ml and 10 ng/ml gave significantly (P b 0.05, t-test) higher optical density and percentages of viable cells (7% and 12% higher than control). Based from this result, it was decided that TCTP concentration in culture medium between 1–10 ng/ml should be used in order to promote cells growth and function for further studies. 3.2. TCTP released from different GICs The result of the released Pmer-TCTP band was shown in Fig. 2. The specimen group BIO-GIC with added Pmer-TCTP released higher quantity of the protein than group GIC with added Pmer-TCTP compared to control. In addition, protein Pmer-TCTP released from GIC with added Pmer-TCTP was lower than the control. However, group GIC and BIOGIC without Pmer-TCTP cannot detect the released protein.
Fig. 2. Western blot of TCTP release from GIs with added Pmer-TCTP. Lane 1, 2: TCTP control, Lane 3: Pmer-TCTP release from GIC, Lane 4: TCTP release from BIO-GIC.
(P b 0.05) and the percentages of proliferation cells were over 100% compared to control (medium only). In addition, the group BIO-GIC + 10 ng had cell proliferation significantly less than group BIO-GIC + 1 ng (P b 0.05). However, it was noted that the groups GIC, GIC + 1 ng, GIC + 10 ng and BIO-GIC had cell proliferation lower than the control. 3.4. Alkaline phosphatase (ALP) activity of NHost cells The ALP activity of NHost cells after being cultured on GICs with added Pmer-TCTP for 7 and 14 days has been shown in Fig. 4. The ALP activity of cell group BIO-GIC with and without Pmer-TCTP cultured for 7 days was significantly (P b 0.05) higher than the ALP activity of cells after cultured with the same group of the specimen for 14 days. The ALP activity of cells cultured on BIO-GIC added PmerTCTP for 7 days was significantly higher (P b 0.05) than the group BIOGIC without Pmer-TCTP. However, the ALP activities of cells on GIC with and without TCTP were lower than other groups in both 7 and 14 days. 3.5. Mineralization of NHost cells The result of calcium deposition from NHost cells exposed to different GICs for 7 and 14 days investigated by alizarin red S (ARS) assay was shown in Fig. 5. It was found that the level of calcium content group BIOGIC added Pmer-TCTP after culture for 14 days was higher than the other specimen groups, but lower than the control (P b 0.05).
3.3. Effect of GICs supplemented with TCTP on proliferation of NHost cells 3.6. Gene expression The result of cell proliferation investigated by BrdU assay was shown in Fig. 3. It was found that the specimens of BIO-GIC added Pmer-TCTP at 1 ng/specimen promoted cells proliferation higher than other groups
Fig. 1. The effect of Pmer-TCTP on human osteoblasts viability investigated by MTT assay (n = 6 in each group).
The pattern of BMP-2 was different between each group. The response of BMP-2 gene was reported as an average of fold expression (Fig. 6 A). In BIO-GIC with TCTP group, the BMP-2 gene expression increased gradually during culture. The expression of BMP-2 mRNA increased in the early phase of osteoblasts culture. A higher level of expression was observed in the Pmer-TCTP group on day 3 of the culture (P b 0.05), later than the up-regulation of BMP-2 gene on day 3, and the expression of BMP-2 gene down-regulated on day 7. However, the down-regulation of BMP-2 gene was significantly indicated in GIC and BIO-GIC without added Pmer-TCTP on day 1 and day 7. Although a significant expression of BMP-2 gene was observed between GIC and BIO-GIC on day 3, either with or without added Pmer-TCTP on day 1 and GIC and GIC added Pmer-TCTP on day 7. In addition, Pmer-TCTP resulted in slightly up-regulated in BIO-GIC with Pmer-TCTP cells immediately until day 3 compared with each time period of without added Pmer-TCTP group. The expression of OPN gene was lower than control in all groups (Fig. 6 B). BIO-GIC with and without Pmer-TCTP slightly up-regulation on day 1 until on day 3 and down-regulated on day 7 (P b 0.05). GIC added Pmer-TCTP demonstrated down-regulation on day 3 (P b 0.05) compared to the control. However, the down-regulation of OPN gene
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
65
Fig. 3. Effect of GICs supplemented with TCTP on NHost cells proliferation investigated by BrdU assay. *, ** and different letters denote significant difference (P b 0.05, one-way ANOVA with Tukey multiple comparison test, n = 10 in each group).
was significantly indicated in BIO-GIC without added Pmer-TCTP on both day 1 and day 3. A significant expression of OPN gene was observed between GIC and BIO-GIC at day 1 either with or without added Pmer-TCTP on day 3 and GIC and GIC added Pmer-TCTP on day 7. The fold change of both BMP-2 and OPN gene expression of cells cultured on specimens with added Pmer-TCTP increased gradually with up-regulation after day 1 and reach the highest on day 3 then downregulation on day 7. 4. Discussion BIO-GIC is a conventional glass ionomer cement that has been modified by adding chitosan and albumin in order to prolong the release of the supplemented protein with its retained biological properties [8,9]. This study evaluated the effect of Pmer-TCTP, the supplemented protein, in this novel material on osteoblast cells. Low concentrations of PmerTCTP at 1 and 10 ng/ml are not cytotoxic to human osteoblasts. In contrast, they can increase cell viability after exposure for 72 h, which is similar to the result of a previous study that found that TCTP can
increase cell viability of human dental pulp cells [14]. However, it was noted that cells exposed to low concentrations of TCTP after 24 h had less viability than control and after 72 h had higher cell viability than control. This means that TCTP might not only directly promote cell proliferation. It was also found that TCTP could reduce cell death or act as an anti-apoptotic, which was controlled by a negative feedback loop with P53 [16]. Cells treated with certain concentrations of TCTP may have less cell death and led to higher number of cell proliferation than the control after 72 h. Another explanation is that TCTP may increase the expression of other growth factors especially BMP-2, as shown in Fig. 6. GIC + TCTP and BIO-GIC + TCTP had higher BMP-2 expression on day 1 and highest expression on day 3 than the materials without TCTP and the control. BMP-2 can increase osteoblast proliferation and differentiation [17]. The concentration of TCTP added in the specimen was based on the result from the MTT assay, size of the specimen and our previous study, which found that protein release from the specimen at the early phase was approximately 1/100 of the added protein [8]. From the result in Fig. 2, BIO-GIC with added Pmer-TCTP protein released higher quantity of the protein than the group GIC with
Fig. 4. ALP activity of NHost cells cultured on with and without Pmer-TCTP supplemented GICs for 7 and 14 days. *Denotes significant difference compared with control group (culture medium) at P b 0.05. #Denotes significant difference compared within group at P b 0.05 (n = 5 in each group).
66
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
Fig. 5. Cell mineralization measured by ARS assay. *Denotes significant difference compared within group at P b 0.05 (n = 5 in each group).
added Pmer-TCTP, supported the previous report that chitosan and albumin added in glass ionomer cement can prolong and increase the release of protein [8]. This might be due to the formation of
polyelectric complexes between the anionic groups of poly (acrylic acid) and the cationic groups of chitosan that used to prolong drug delivery [18].
Fig. 6. The fold change of BMP-2 expression (A) and OPN expression (B) of NHost cells cultured on GIs supplemented with and without Pmer-TCTP determined by qRT-PCR. *, **, ***Significant difference compared with control group (culture medium) at P b 0.05. #Significant difference compared between groups at P b 0.05.
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
In Fig. 3, the cell proliferation of BIO-GIC was lower than that in control. In Fig. 1, the cell viability of TCTP at 1 ng/ml was almost the same as control group (cell cultured in medium only). This means that BIOGIC may release some cytotoxic substances, which cells had been exposed for 3 days. But it did not mean that BIO-GIC cannot promote bone cell growth in the long term. In Fig. 3, the average (mean) percentage of cell proliferation of GIC was about 7% of the control, while GIC + TCTP had the mean percentage of cell proliferation about 39%, which is about 5 times that of the GIC group. This may reveal the high cytotoxicity of GIC after cells cultured for 3 days and the effect of TCTP to reduce cell death. It was also noted that BIO-GIC had a mean percentage of cell proliferation of about 72%, which was about 10 times higher than GIC. BIO-GIC had less cytotoxicity than GIC to osteoblasts, the same results to dental pulp cells in previous studies [8,9]. The cell proliferation of BIOGIC + 1 ng TCTP was 360% of the control. That means, the combination of BIO-GIC and TCTP showed high promotion of cell proliferation. The mechanism of chitosan, one component of BIO-GIC, to reduce cytotoxicity is not known, but free chitosan has been found to promote osteoblast proliferation [13]. Whereas BSA itself has the property to bind toxic chemical [19] which may reduce the cytotoxicity of BIO-GIC. The low concentration of TCTP may reduce cell death from the cytotoxicity of the material and promote cell proliferation. The proliferation promotion of TCTP may also result from the increased BMP-2 expression more than 3 times of the control as shown in Fig. 6. This protein can act as a proliferative factor in osteoblasts [17]. However, further investigation will be required. Moreover, BIO-GIC also had higher ALP activity (Fig. 4) as well as calcium deposition (Fig. 5) than the GIC group, which could be the effect of chitosan according to a recent study found that free chitosan can promote osteoblast proliferation and osteogenesis in mesenchymal stem cells [13]. TCTP added in BIO-GIC obviously increased cell proliferation, increased ALP activity and promoted calcium deposition. In this study, we used Pmer-TCTP from banana prawn, which also had biological effect on human osteoblasts (NHost cells). This may come from its conserved protein that can promote cell proliferation and differentiation. TCTP is a highly conserved protein and is involved in important cellular processes, cell growth and cell cycle progression, and can protect cells from various stress conditions and apoptosis due to its biological properties [19]. The result from MTT assay and BrdU assay suggested that the PmerTCTP at low concentration 1–100 ng/ml promote cells growth, while at high concentration may gave the opposite result. The recent study found that TCTP can function as a growth promoter and the high levels of TCTP expression were associated with tumorigenesis, while P53 prevented the growth and survival of potentially malignant cells [20]. So the high concentration of Pmer-TCTP (10–20 μg/ml) resulted in slightly reduced cell proliferation, which may be due to the excess of TCTP that may activate antagonism like P53 to balance cells proliferation. BMP-2 was highly involved in the induction of osteoblast differentiation and enhancing bone matrix production [21,22]. This study showed that TCTP can promote BMP-2 expression as noted in the group GIC + TCTP and BIO-GIC + TCTP. However, BIO-GIC + TCTP had upregulate BMP-2 expression earlier (days 1 and 3) than GIC + TCTP group and nearly about 3 times higher, which may be due to the higher amount of TCTP released from BIO-GIC + TCTP than GIC + TCTP and the higher cytotoxicity of GIC than BIO-GIC. OPN, a highly phosphorylated sialoprotein, is a major component of the mineralized extracellular matrix of bone. The role of OPN in bone mineralization is not clear. It may modulate hydroxyapatite formation, either by preventing crystal growth in “inappropriate” areas or by regulating crystal growth in size and shape [23]. However, OPN did not affect osteoblast cell development in vitro [24]. In this study, the expressions of OPN in BIO-GIC and BIO-GIC with TCTP were higher than GIC but lower than the control, which may confirm the higher cytotoxicity of GIC than BIO-GIC and BIO-GIC with TCTP.
67
5. Conclusion Low concentrations of TCTP can increase cell viability after exposure for 72 h. BIO-GIC is a modified GIC by adding chitosan and albumin. BIO + GIC added TCTP can release greater quantities of the protein than GIC + TCTP. Human osteoblasts cultured on BIO-GIC + TCTP had demonstrably higher cell proliferation, up-regulated BMP-2 expression earlier (days 1 and 3), higher ALP activity and higher calcium deposition compared to GIC and GIC + TCTP. Further studies about this material are required; however, this modified glass ionomer cement shows some promise for further development in assisting regeneration of bone tissue. Acknowledgments This work was supported by the Higher Education Research Promotion and National Research University Project of Thailand and the Center of Excellence in Medical Biotechnology: CEMB, PERDO, The Office of the Higher Education Commission, Thailand, as well as a Postgraduate grant, Prince of Songkla University. References [1] A.D. Wilson, B.E. Kent, A new translucent cement for dentistry. The glass ionomer cement, Br. Dent. J. 132 (1972) 133–135. [2] P.V. Hatton, K. Hurrell-Gillingham, I.M. Brook, Biocompatibility of glass-ionomer bone cements, J. Dent. 34 (2006) 598–601. [3] A. Oliva, F. Della Ragione, A. Salerno, V. Riccio, G. Tartaro, A. Cozzolino, S. D'Amato, G. Pontoni, V. Zappia, Biocompatibility studies on glass ionomer cements by primary cultures of human osteoblasts, Biomaterials 17 (1996) 1351–1356. [4] G. Babighian, Use of a glass ionomer cement in otological surgery. A preliminary report, J. Laryngol. Otol. 106 (1992) 954–959. [5] G.M. Serin, B. Cam, U. Derinsu, M. Sari, C. lar Batman, Incus augmentation with glass ionomer cement in primary and revision stapes surgery, Ear Nose Throat J. 89 (2010) 589–593. [6] B.T. Harris, R. Caicedo, W.S. Lin, D. Morton, Treatment of a maxillary central incisor with class III invasive cervical resorption and compromised ferrule: a clinical report, J. Prosthet. Dent. 111 (2014) 356–361. [7] M.P. Santamaria, D. da Silva Feitosa, M.Z. Casati, F.H. Nociti Jr., A.W. Sallum, E.A. Sallum, Randomized controlled clinical trial evaluating connective tissue graft plus resin-modified glass ionomer restoration for the treatment of gingival recession associated with non-carious cervical lesion: 2-year follow-up, J. Periodontol. 84 (2013) e1–8. [8] A. Limapornvanich, S. Jitpukdeebodintra, C. Hengtrakool, U. Kedjarune-Leggat, Bovine serum albumin release from novel chitosan-fluoro-aluminosilicate glass ionomer cement: stability and cytotoxicity studies, J. Dent. 37 (2009) 686–690. [9] N. Rakkiettiwong, C. Hengtrakool, K. Thammasitboon, U. Kedjarune-Leggat, Effect of novel chitosan-fluoroaluminosilicate glass ionomer cement with added transforming growth factor beta-1 on pulp cells, J. Endod. 37 (2011) 367–371. [10] L. Casettari, D. Vllasaliu, J.K. Lam, M. Soliman, L. Illum, Biomedical applications of amino acid-modified chitosans: a review, Biomaterials 33 (2012) 7565–7583. [11] L. Hu, Y. Sun, Y. Wu, Advances in chitosan-based drug delivery vehicles, Nanoscale 5 (2013) 3103–3111. [12] L.R. Amir, D.F. Suniarti, S. Utami, B. Abbas, Chitosan as a potential osteogenic factor compared with dexamethasone in cultured macaque dental pulp stromal cells, Cell Tissue Res. 358 (2014) 407–415. [13] M.L. Tan, P. Shao, A.M. Friedhuber, M. van Moorst, M. Elahy, S. Indumathy, D.E. Dunstan, Y. Wei, C.R. Dass, The potential role of free chitosan in bone trauma and bone cancer management, Biomaterials 35 (2014) 7828–7838. [14] N. Wanachottrakul, W. Chotigeat, U. Kedjarune-Leggat, Translationally controlled tumor protein against apoptosis from 2-hydroxy-ethyl methacrylate in human dental pulp cells, J. Mater. Sci. Mater. Med. 22 (2011) 1479–1487. [15] C.A. Gregory, W.G. Gunn, A. Peister, D.J. Prockop, An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction, Anal. Biochem. 329 (2004) 77–84. [16] M. Nagano-Ito, S. Ichikawa, Biological effects of mammalian translationally controlled tumor protein (TCTP) on cell death, proliferation, and tumorigenesis, Biochem. Res. Int. 2012 (2012) 204960. [17] A. Robubi, C. Berger, M. Schmid, K.R. Huber, A. Engel, W. Krugluger, Gene expression profiles induced by growth factors in in vitro cultured osteoblasts, Bone Joint Res. 3 (2014) 236–240. [18] P.M. de la Torre, G. Torrado, S. Torrado, Poly (acrylic acid) chitosan interpolymer complexes for stomach controlled antibiotic delivery, J. Biomed. Mater. Res. B Appl. Biomater. 72 (2005) 191–197. [19] U.A. Bommer, B.J. Thiele, The translationally controlled tumour protein (TCTP), Int. J. Biochem. Cell Biol. 36 (2004) 379–385. [20] R. Amson, S. Pece, A. Lespagnol, R. Vyas, G. Mazzarol, D. Tosoni, I. Colaluca, G. Viale, S. Rodrigues-Ferreira, J. Wynendaele, O. Chaloin, J. Hoebeke, J.C. Marine, P.P. Di Fiore, A. Telerman, Reciprocal repression between P53 and TCTP, Nat. Med. 18 (2011) 91–99.
68
J. Sangsuwan et al. / Materials Science and Engineering C 54 (2015) 61–68
[21] D. Chen, M. Zhao, G.R. Mundy, Bone morphogenetic proteins, Growth Factors 22 (2004) 233–241. [22] O.F. Zouani, L. Rami, Y. Lei, M.C. Durrieu, Insights into the osteoblast precursor differentiation towards mature osteoblasts induced by continuous BMP-2 signaling, Biol. Open 2 (2013) 872–881.
[23] G.K. Hunter, Role of osteopontin in modulation of hydroxyapatite formation, Calcif. Tissue Int. 93 (2013) 348–354. [24] E. Holm, J.S. Gleberzon, Y. Liao, E.S. Sorensen, F. Beier, G.K. Hunter, H.A. Goldberg, Osteopontin mediates mineralization and not osteogenic cell development in vitro, Biochem. J. 464 (2014) 355–364.