- Email: [email protected]
Transplant drugs affect the expression of phase II and antioxidant enzymes in human carcinoma cells HepG2 but not in primary cultures of human hepatocytes: In vitro comparative study
Pharmacological Reports 68 (2016) 1008–1014
Contents lists available at ScienceDirect
Pharmacological Reports journal homepage: www.elsevier.com/locate/pharep
Original article
Transplant drugs affect the expression of phase II and antioxidant enzymes in human carcinoma cells HepG2 but not in primary cultures of human hepatocytes: In vitro comparative study Radim Vrzal* , Peter Illes, Zdenek Dvorak Department of Cell Biology and Genetics, Faculty of Science, Palacky University, [29_TD$IF]Olomouc, Czech Republic
A R T I C L E I N F O
A B S T R A C T
Article history: Received 31 March 2016 Received in revised form 2 May 2016 Accepted 2 June 2016 Available online 17 July 2016
Background: We carried out a test whether or not transplant drugs such as cyclosporine A, Rapamycin (Sirolimus), Tacrolimus, Everolimus and Mycophenolate mofetil affects the expression of phase II enzymes comprising of UDP-glucuronosyltransferases (UGTs) and glutathione-S-transferases (GSTs), and antioxidant enzymes that consist of glutathione reductase (GSR), glutathione peroxidase 1 (GPX1) and heme-oxygenase 1 (HMOX1). Methods: Experiments were performed in primary cultures of human hepatocytes and in human hepatocarcinoma HepG2 cells, the models of metabolically competent and incompetent cells, respectively. We used quantitative real-time PCR. Results: We found that none of the tested compounds affected the expression of investigated genes in human hepatocytes. On the other hand, Mycophenolate mofetil induced GPX1 mRNA, although it suppressed mRNA level of UGT1A4/1A9/2B7/2B10, GSTA1/O1/T1, GSR and HMOX1 in HepG2 cells. Conclusion: We showed that the tested transplant drugs have no effect on the expression of selected phase II and antioxidant enzymes in human hepatocytes. Nevertheless, the experiments carried out in two common and frequently used [31_TD$IF]in vitro cellular models, we emphasize that finding based solely on carcinoma cells must be taken with caution when transposing to [32_TD$IF]in vivo situations. ã 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Sp. z o.o. All rights reserved.
Keywords: Human hepatocytes Mycophenolate mofetil UGT1A GPX1
Introduction In the metabolism of xenobiotics, the phase II enzymes play a crucial role, considering they conjugate polarized metabolite from phase I with endogenous compounds. They can be found relatively in every tissue with predominant and abundant localization in the liver, intestine and kidney [1,2]. And their expression is mainly regulated by tissue-specific transcription factors, though some nuclear receptors acting like ligand-activated transcription factors were described to be involved in their regulation as well, e.g. arylhydrocarbon receptor (AhR), pregnane X receptor (PXR) or glucocorticoid receptor (GR) [3–5]. Unlike phase I enzymes, most importantly cytochromes P450 (CYPs), phase II enzymes were significantly less studied. On one hand, phase II enzymes allow the excretion of several xenobiotics, but they are also efficient for the formation of toxic substances [6]. Moreover, reactive oxygen species (ROS) are generated during phase I. Thus, investigation of
* Corresponding author. E-mail address: [email protected] (R. Vrzal).
the change in the expression of phase II and antioxidant enzymes is of general interest given that following the reactive metabolites from phase I, ROS must be eliminated in order to prevent cellular damage. During the treatment of transplant patients with immunosuppressive or immunomodulatory drugs, patients are usually exposed to two or three different types of drugs simultaneously at minimum. The first drug is used to suppress the immune system while the second ought to deal with the side effect of immunosuppression having the presence of bacterial or fungi infection. Hence, the induction or a reduction in the expression of phase II enzymes, may be as relevant during phase I enzymes, e.g. due to the existence of drug-drug interactions. In a recent paper, we described the effect of some drugs used in transplant patients on CYPs expression in the primary cultures of human hepatocytes [7]. We tested the following compounds: Cyclosporine A (CPA) and Tacrolimus (TAC; FK-506), the inhibitors of calcineurin complex; Rapamycin (RAP; Sirolimus) and its analog Everolimus (EVE), the inhibitors of serine-threonine kinase mTORC1 (mammalian target of rapamycin complex); and Mycophenolate mofetil (MYC), the inhibitor of inosine monophosphate dehydrogenase (IMPDH).
http://dx.doi.org/10.1016/j.pharep.2016.06.001 1734-1140/ ã 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Sp. z o.o. All rights reserved.
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
In our recent work, we discovered that none of the tested compounds had a significant effect on expression of tested cytochromes P450 in human hepatocytes within therapeutic and toxic concentrations. We illustrated the potentiating effect of rapamycin (sirolimus), everolimus on the AhR- and GR-driven luciferase activity in a stable transfected cell line. The greatest effects displayed mycophenolate mofetil since it is completely abolished dexamethasone-mediated GR-driven luciferase activity and induced AhR-driven luciferase activity. Therefore, in the current work, we investigated the effects of transplant drugs on phase II enzymes, including UDP-glucuronosyltransferases (UGTs) and glutathione-S-transferases (GSTs) in primary culture of human hepatocytes and human hepatocarcinoma HepG2 cells, the models of metabolically competent an incompetent cells, respectively. Furthermore, we measured the expression of three prominent antioxidant enzymesnamely; glutathione peroxidase 1 (GPX1), glutathione reductase (GSR) and heme-oxygenase 1 (HMOX1), given that some studies described anti-oxidative properties of certain transplant drugs [8,9]. The genes selection was given by an insufficient knowledge in this field, the importance of these genes in detoxification and antioxidant response of the cells. The spectrum of immunosuppressive drugs, used in this study, was based on the relatively frequent used in transplant medicine and sometimes incomplete knowledge in the field of phase II/ antioxidant enzyme expression. In the present study, we have been using transplant drugs with their toxic concentrations only [10] because we anticipated no effect for therapeutic concentrations due to our recent study [7]. Materials and methods Compounds and reagents Dimethylsulfoxide (DMSO), rifampicin (RIF), Cyclosporine A, FK-506 monohydrate (Tacrolimus), Mycophenolate mofetil, Rapamycin (Sirolimus) and Everolimus were purchased from SigmaAldrich (Prague, Czech Republic). 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) was obtained from Ultra Scientific (RI, USA). Oligonucleotide primers used in RT-PCR reactions were synthesized by Generi Biotech (Hradec Kralove, Czech Republic). LightCycler 480 Probes Master was purchased from Roche Diagnostic Corporation (Intes Bohemia, Czech Republic). All other chemicals of the highest quality were commercially available. Cell cultures
Quantitative reverse transcriptase polymerase chain reaction (qRTPCR) Total RNA isolation, synthesis of cDNA and PCR were described subsequently [7]. The levels of all mRNAs were determined using primers and Universal Probes Library (UPL; Roche Diagnostic Corporation, Prague, Czech Republic) technology (Table 1). Statistical analysis The data were subjected to either Paired Student’s t test within one experiment or to one-way ANOVA among the independent biological replicates. All statistical analyses were performed using Microsoft Excel [3_TD$IF]2007; p < 0.05 was considered to be statistically significant. Results HepG2 cells under the influence of transplant drugs First, we measured the expression of selected phase II and antioxidant enzymes in HepG2 cells after 24 h of incubation with Cyclosporine A (CPA; 500 ng/ml), Tacrolimus (TAC; 25 ng/ml), Rapamycin (RAP; 20 ng/ml), Everolimus (EVE; 20 ng/ml), Mycophenolate mofetil (MYC; 10 mg/ml), TCDD (5 nM) and/or DMSO (0,1%; v/v) as a negative control. Since AhR-signaling pathway is functional in HepG2 cells and some of the phase II enzymes are regulated by AhR [3], hence TCDD was used as positive control for this purpose. We observed that TCDD induced UGT1A1, UGT1A4, UGT1A6 and UGT1A9 mRNAs though it causes the decreased in UGT2B7 and UGT2B10 mRNAs (Fig. 1A–F). However, among the compounds tested, only MYC displayed a significant suppressive effect on UGT1A4, UGT1A9, UGT2B7 and UGT2B10 mRNAs. We therefore observed a significant decrease in GSTA1 mRNA by TCDD, but this did not occur in other measured GSTs (Fig. 2A–D). MYC significantly decreased the level of GSTA1, GSTO1, GSTT1, GSR and HMOX1 mRNAs (Figs. 2[34_TD$IF][25D, 3), while it increases mRNA for GPX1 Table 1 List of primers with corresponding UPL probes used for PCR. Name of the gene
Primer sequences (F/R)
UPL number
UGT1A1
ATATGGTTTTTGTTGGTGGAATC GCATTAATGTAGGCTTCAAATTCCT CAAGTCTTGCCTCTGAGCTTTT ACACGGATGCATAGCTGACA GGCAAAATCCCTCAGACAGT GTTCGCAAGATTCGATGGTC ACTATCCCAAACCCGTGATG TCTCCAGAAGCATTAATGTAGGC ACCAAATGTTGATTTTGTTGGA CACCACAACACCATTTTCTCC TCCTCATCCATTCTTACCAAATG TCTGTACAAACTCCTCCATTTCC ACGGTGACAGCGTTTAACAA CCGTGCATTGAAGTAGTGGA ACGGGGACTTCACCTTGAC GACCTTATATTTGCGCGTCAG CTGCAAACCCCAGAGGAG GGCAGAACCTCATGCTGTAGA TTTCTGACCTCATCGCTGGT TCTCCCACTTGCTTCAGGAC CACGGAGGAGCTGGAGAAC ACTTCCAAGCCCGACAAAG AACCAGTTTGGGCATCAGG GTTCACCTCGCACTTCTCG CAGTCAGGCAGAGGGTGATAG CCTGCAACTCCTCAAAGAGC CTCTGCTCCTCCTGTTCGAC ACGACCAAATCCGTTGACTC
8
UGT1A4 UGT1A6
Human Caucasian hepatocellular carcinoma cells HepG2 (ECACC No. 85011430) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% of fetal calf serum, 100 U/ml streptomycin, 100 mg/ml penicillin, 4 mM L-glutamine, 1% non-essential amino acids and 1 mM sodium pyruvate. The cells were maintained at 37 C with 5% of CO2 in a humidified incubator.
UGT1A9 UGT2B7 UGT2B10 GSTA1 GSTT1
Human hepatocytes GSTO1
Human hepatocytes were isolated from human liver which is obtained from multiorgan donors: LH50 (F, 55 years), LH51 (F, 58 years) and LH52 (F, 60 years); The requirements issued by the local ethical commission in the Czech Republic, was in accordance with tissue acquisition protocol. Cells were plated into collagen-coated dishes in a hormonally and chemically defined medium consisting of a mixture of William’s E and Ham’s F-12 [1:1 (v/v)] and then it was maintained at 37 C and 5% CO2 in a humidified incubator. Hepatocytes were incubated with the tested compounds, inducers and/or vehicle (DMSO; 0.1% v/v) for 24 h.
1009
GSTZ1 GSR GPX1 HMOX1 GAPDH
138 47 119 86 86 53 15 60 42 14 77 15 60
1010
[(Fig._1)TD$IG]
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
Fig. 1. The effect of tested drugs on mRNAs level of UGTs in human hepatocellular carcinoma HepG2 cells. HepG2 cells were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM) and DMSO (0.1% v/v) as a vehicle of control. Bar graphs show RT-PCR analyses of UGT1A1 (A), UGT1A4 (B), UGT1A6 (C), UGT1A9 (D), UGT2B7 (E), UGT2B10 (F) mRNAs. The data are the mean from triplicate measurements which are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels. *[27_TD$IF]Value is significantly different from untreated cells (UT; p < 0.05).
[(Fig._2)TD$IG]
Fig. 2. The effect of tested drugs on mRNAs level of GSTs in human hepatocellular carcinoma HepG2 cells. HepG2 cells were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM) and DMSO (0.1% v/v) as a vehicle of control. Bar graphs show RT-PCR analyses of GSTA1 (A), GSTO1 (B), GSTT1 (C), GSTZ1 (D) mRNAs. The data are the mean from triplicate measurements which are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels. *[27_TD$IF]Value is significantly different from untreated cells (UT; p < 0.05).
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
[(Fig._3)TD$IG]
1011
Fig. 3. The effect of tested drugs on mRNAs level of antioxidant enzymes in human hepatocellular carcinoma HepG2 cells. HepG2 cells were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs show RT-PCR analyses of GPX1 (A), GSR (B), and HMOX1 (C) mRNAs. The data are the mean from triplicate measurements which are also expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels. *[27_TD$IF]Value is significantly different from untreated cells (UT; p < 0.05).
(Fig. 3A). Everolimus decreased all mRNAs of tested GSTs’ forms (Fig. 2A–D). Rapamycin substantially decreased GSTA1 mRNA, although it induced GSTZ1 mRNA (Fig. 2A and D). Human hepatocytes under the influence of transplant drugs Thereafter, we evaluated the expression of phase II and antioxidant enzymes in three primary cultures of human hepatocytes. Unlike in HepG2, where signaling via PXR is slightly impaired based on weak CYP3A4 induction by rifampicin (RIF) [11], we employed PXR activator rifampicin as a positive control alongside TCDD as a result of the reported involvement of PXR in phase II expression as well [3]. In hepatocyte cultures, both RIF and TCDD induced mRNAs of UGT1A1, UGT1A4, UGT1A6 and UGT1A9 (Fig. 4A–D). And their effect on UGT2B7 and UGT2B10 mRNA was modulatory which probably reflected inter-individual variability between the donors (Fig. 4E and F). The same can be claimed for tested drugs as no trend can be observed among cultures. The effect of tested drugs on mRNAs level of GSTs’ isoforms was negligible with random and irreproducible inductions among
[(Fig._4)TD$IG]
cultures with the exception of positive control, RIF at GSTA1 mRNA level (Fig. 5A–D). A similar profile in the case of GSTs was observed for antioxidant enzymes, i.e. in most cases, modulatory effect of tested drugs (Fig. 6A–C) but a repeated induction of HMOX1 mRNA by RIF (Fig. 6C). Comparative analysis of mRNA levels for phase II and antioxidant enzymes genes When comparing the inducibility in different cell systems, it is important to have the knowledge of the basal expression levels of monitored genes. To this objective, we decided to compare the expression levels between HepG2 cells with each hepatocyte culture. Since the HepG2 cells represent genotypically and phenotypically uniform system which is contrary to heterogeneous hepatocytes with polymorphisms in each donor, the expression levels were represented as fold induction to untreated control of HepG2 cells (Fig. 7). As it can be seen, the major difference between HepG2 cells and hepatocytes lies especially in the expression of UGT1A subfamily members, as we detected
Fig. 4. The effect of tested drugs on mRNAs level of UGTs in primary cultures of human hepatocytes. Primary human hepatocytes, cultures LH50/51/52, were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM), RIF (10 mM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs show RT-PCR analyses of UGT1A1 (A), UGT1A4 (B), UGT1A6 (C), UGT1A9 (D), UGT2B7 (E), UGT2B10 (F) mRNAs. The data are the mean from triplicate measurements which are also expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels.
1012
[(Fig._5)TD$IG]
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
Fig. 5. The effect of tested drugs on mRNAs level of GSTs in primary cultures of human hepatocytes. Primary human hepatocytes, cultures LH50/51/52, were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM), RIF (10 mM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs shows RT-PCR analyses of:GSTA1 (A), GSTO1 (B), GSTT1 (C), GSTZ1 (D) mRNAs. The data are the mean from triplicate measurements and are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels.
[(Fig._6)TD$IG]
Fig. 6. The effect of tested drugs on mRNAs level of antioxidant enzymes in primary cultures of human hepatocytes. Primary human hepatocytes, cultures LH50/51/52, were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM), RIF (10 mM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs show RT-PCR analyses of:GPX1 (A), GSR (B), HMOX1 (C) [28_TD$IF]mRNAs. The data are the mean of triplicate measurements and are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels.
approximately 40-, 1000-, 80- and 500-times higher expression of UGT1A1, 1A4, 1A6 and 1A9 in hepatocytes than in HepG2 cells, respectively (Fig. 7A–D). Next to 1A subfamily, the expressions of 2B family members were equal to HepG2 cells (UGT2B7, Fig. 7E) or strongly suppressed (UGT2B10, Fig. 7F). The isoforms of GSTs had the expression either suppressed (GSTA1/O1; Figs. 7G and H) or was comparable to HepG2 cells (GSTT1/Z1; Figs. 7I and J). The expression levels of antioxidant genes were increased (GPX1, Fig. 7K), suppressed (GSR, Fig. 7L) or equal (HMOX1, Fig. 7M) to HepG2 cells. The culture LH52 among these genes most likely reflects the individuality of the donor or the culture of less quality. Discussion In the current paper, we described the effect of selected transplant drugs on the expression of selected phase II, and the antioxidant enzymes in primary cultures of human hepatocytes
and human hepatocarcinoma HepG2 cells, the models of metabolically competent and incompetent cells, respectively. Our aim was to investigate if the concentrations described as toxic may have any impact on the expression of selected genes. We assumed that therapeutic concentrations will be without any effect in regard to our recent study with CYPs [7] such that higher concentrations, usually described as toxic in plasma, can be anticipated in the portal vein and may be the real ones, the hepatocytes are exposed to. We may expect that our data from human hepatocytes indicates none of the tested compounds affect expression of phase II and antioxidant genes owing to the fact that, these drugs are usually taken orally. Moreover, data obtained from this study are remarkable from the mechanistic point of view such that, as long as HepG2 cells lack significant metabolizing activity in comparison with human hepatocytes. We may also speculate that the effect of MYC on the expression of selected genes probably involves changes
[(Fig._7)TD$IG]
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
1013
Fig. 7. The comparison of expression levels of monitored genes between HepG2 cells and primary cultures of human hepatocytes. The equal amounts of cDNAs of untreated controls of HepG2 cells from three independent passages were mixed simultaneously, such that, the expression levels of monitored genes were determined. In contrast, due to the genotypical and the phenotypical individuality of each donor of human hepatocytes, the expression levels were determined in each culture and compared to uniform HepG2 cells. The data are the mean of triplicate measurements and are expressed as a fold-induction compared to DMSO-treated HepG2 cells. The data were normalized per GAPDH mRNA levels. Bar graphs show RT-PCR analyses of UGT1A1 (A), UGT1A4 (B), UGT1A6 (C), UGT1A9 (D), UGT2B7 (E), UGT2B10 (F), GSTA1 (G), GSTO1 (H), GSTT1 (I), GSTZ1 (J), GPX1 (K), GSR (L), HMOX1 (M) mRNAs.
1014
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
in stability or inducibility of a given mRNAs. A good example of these are UGT1As in HepG2 cells, where slight, but insignificant, induction was observed for both UGT1A1 and UGT1A6 mRNAs, though UGT1A4 and UGT1A9 mRNAs were drastically decreased upon MYC treatment (Fig. 1A–D). In our recent paper we found that MYC is capable of AhR activation as well as weak CYP1A1 induction [7]. Thus, its inducing effect might reflect AhR involvement in the process. This would be logical as some UGTs were reported to be regulated by AhR via dioxin responsive element (DRE) [1]. On the other hand, MYC is primarily known based on ability to inhibit IMPDH. Therefore, one of the explanations of MYC-mediated down-regulation in the case of UGT1A4/1A9 mRNAs could be the decreased availability of nucleosides due to the limited synthesis de novo. The reason why there is no effect in human hepatocytes could be the rapid metabolism of MYC by liver esterases [12] and consequently by UGT1A9 and UGT2B7 [13]. This hypothesis is likely due to the approx. 500-times higher expression of UGT1A9 in hepatocytes alongside HepG2 cells (Fig. 7D). Of course, considering we observed a strong antagonistic effect of MYC on glucocorticoid receptor [7] in which GR is least present in HepG2 cells [14], an involvement of GR in the decrease of mRNAs for certain UGTs, all GSTs, GSR and HMOX1, can be expected. Hence, there are few studies, which suggest such scenario [15,16]. Another important effect is the opposite action of RAP and EVE on mRNA of GSTZ1 (Fig. 2D). Meanwhile these two compounds have a similar structures, they both decreases mRNA in GSTA1 (Fig. 2A) although only EVE decreases GSTO1 and GSTT1 mRNAs (Figs. 2B and C). They displayed almost completely opposite effect on GSTZ1 mRNA. This is quite intriguing in that we expect a similar mode of action due to their mTORC1 inhibiting activities. However, apparently a little addition to the structure of molecule (hydroxyethyl in the case of EVE) may lead to different effect which in this view may not be related to mTORC1 inhibition. In conclusion, tested transplant drugs have no impact on the expression of phase II and antioxidant enzymes genes in human hepatocytes. It is probably positive finding since it excludes possible drug-drug interactions based on the induction of enzymes involved in pharmacokinetic of the drugs. The effect of MYC in metabolically less competent tissues is unlikely especially after oral administration. Moreover, it shades the doubts on toxicological together with pharmacological studies which were performed solely in metabolically incompetent cells (like HepG2 in our case), hence, the conclusions made for the impact of tested compounds on in vivo systems, may be excessively overestimated. Conflict of interest None.
Acknowledgements This work was supported by the grant from the Czech Ministry of Health IGA NT/13591, by the project POST-UP, reg. No. CZ.1.07/ 2.3.00/30.0004 and by the grant from Gran Agency of Czech Republic GACR P303/12/G163. References [1] Hu DG, Meech R, McKinnon RA, Mackenzie PI. Transcriptional regulation of human UDP-glucuronosyltransferase genes. Drug Metab Rev 2014;46:421–58. [2] Riches Z, Stanley EL, Bloomer JC, Coughtrie MW. Quantitative evaluation of the expression and activity of five major sulfotransferases (SULTs) in human tissues: the SULT pie. Drug Metab Dispos 2009;37:2255–61. [3] Buckley DB, Klaassen CD. Induction of mouse UDP-glucuronosyltransferase mRNA expression in liver and intestine by activators of aryl-hydrocarbon receptor, constitutive androstane receptor, pregnane X receptor, peroxisome proliferator-activated receptor alpha, and nuclear factor erythroid 2-related factor 2. Drug Metab Dispos 2009;37:847–56. [4] Chen C, Staudinger JL, Klaassen CD. Nuclear receptor, pregname X receptor, is required for induction of UDP-glucuronosyltranferases in mouse liver by pregnenolone-16 alpha-carbonitrile. Drug Metab Dispos 2003;31:908–15. [5] Li Y, Buckley D, Wang S, Klaassen CD, Zhong XB. Genetic polymorphisms in the TATA box and upstream phenobarbital-responsive enhancer module of the UGT1A1 promoter have combined effects on UDP-glucuronosyltransferase 1A1 transcription mediated by constitutive androstane receptor, pregnane X receptor, or glucocorticoid receptor in human liver. Drug Metab Dispos 2009;37:1978–86. [6] Ritter JK. Roles of glucuronidation and UDP-glucuronosyltransferases in xenobiotic bioactivation reactions. Chem Biol Interact 2000;129:171–93. [7] Vrzal R, Zenata O, Bachleda P, Dvorak Z. The effects of drugs with immunosuppressive or immunomodulatory activities on xenobioticsmetabolizing enzymes expression in primary human hepatocytes. Toxicol In Vitro 2015;29:1088–99. [8] Dalmarco EM, Budni P, Parisotto EB, Wilhelm Filho D, Frode TS. Antioxidant effects of mycophenolate mofetil in a murine pleurisy model. Transpl Immunol 2009;22:12–7. [9] Ozdemir G, Kilinc M, Ergun Y, Sahin E. Rapamycin inhibits oxidative and angiogenic mediators in diabetic retinopathy. Can J Ophthalmol 2014;49: 443–9. [10] Schulz M, Schmoldt A. Therapeutic and toxic blood concentrations of more than 800 drugs and other xenobiotics. Pharmazie 2003;58:447–74. [11] Doricakova A, Novotna A, Vrzal R, Pavek P, Dvorak Z. The role of residues T248: Y249 and T422 in the function of human pregnane X receptor. Arch Toxicol 2013;87:291–301. [12] Bullingham RE, Nicholls AJ, Kamm BR. Clinical pharmacokinetics of mycophenolate mofetil. Clin Pharmacokinet 1998;34:429–55. [13] Picard N, Ratanasavanh D, Premaud A, Le Meur Y, Marquet P. Identification of the UDP-glucuronosyltransferase isoforms involved in mycophenolic acid phase II metabolism. Drug Metab Dispos 2005;33:139–46. [14] Dvorak Z, Vrzal R, Pavek P, Ulrichova J. An evidence for regulatory cross-talk between aryl hydrocarbon receptor and glucocorticoid receptor in HepG2 cells. Physiol Res 2008;57:427–35. [15] Kratschmar DV, Calabrese D, Walsh J, Lister A, Birk J, Appenzeller-Herzog C, et al. Suppression of the Nrf2-dependent antioxidant response by glucocorticoids and 11beta-HSD1-mediated glucocorticoid activation in hepatic cells. PLoS One 2012;7:e36774. [16] Assaf N, Shalby AB, Khalil WK, Ahmed HH. Biochemical and genetic alterations of oxidant/antioxidant status of the brain in rats treated with dexamethasone: protective roles of melatonin and acetyl-L-carnitine. J Physiol Biochem 2012;68:77–90.
Contents lists available at ScienceDirect
Pharmacological Reports journal homepage: www.elsevier.com/locate/pharep
Original article
Transplant drugs affect the expression of phase II and antioxidant enzymes in human carcinoma cells HepG2 but not in primary cultures of human hepatocytes: In vitro comparative study Radim Vrzal* , Peter Illes, Zdenek Dvorak Department of Cell Biology and Genetics, Faculty of Science, Palacky University, [29_TD$IF]Olomouc, Czech Republic
A R T I C L E I N F O
A B S T R A C T
Article history: Received 31 March 2016 Received in revised form 2 May 2016 Accepted 2 June 2016 Available online 17 July 2016
Background: We carried out a test whether or not transplant drugs such as cyclosporine A, Rapamycin (Sirolimus), Tacrolimus, Everolimus and Mycophenolate mofetil affects the expression of phase II enzymes comprising of UDP-glucuronosyltransferases (UGTs) and glutathione-S-transferases (GSTs), and antioxidant enzymes that consist of glutathione reductase (GSR), glutathione peroxidase 1 (GPX1) and heme-oxygenase 1 (HMOX1). Methods: Experiments were performed in primary cultures of human hepatocytes and in human hepatocarcinoma HepG2 cells, the models of metabolically competent and incompetent cells, respectively. We used quantitative real-time PCR. Results: We found that none of the tested compounds affected the expression of investigated genes in human hepatocytes. On the other hand, Mycophenolate mofetil induced GPX1 mRNA, although it suppressed mRNA level of UGT1A4/1A9/2B7/2B10, GSTA1/O1/T1, GSR and HMOX1 in HepG2 cells. Conclusion: We showed that the tested transplant drugs have no effect on the expression of selected phase II and antioxidant enzymes in human hepatocytes. Nevertheless, the experiments carried out in two common and frequently used [31_TD$IF]in vitro cellular models, we emphasize that finding based solely on carcinoma cells must be taken with caution when transposing to [32_TD$IF]in vivo situations. ã 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Sp. z o.o. All rights reserved.
Keywords: Human hepatocytes Mycophenolate mofetil UGT1A GPX1
Introduction In the metabolism of xenobiotics, the phase II enzymes play a crucial role, considering they conjugate polarized metabolite from phase I with endogenous compounds. They can be found relatively in every tissue with predominant and abundant localization in the liver, intestine and kidney [1,2]. And their expression is mainly regulated by tissue-specific transcription factors, though some nuclear receptors acting like ligand-activated transcription factors were described to be involved in their regulation as well, e.g. arylhydrocarbon receptor (AhR), pregnane X receptor (PXR) or glucocorticoid receptor (GR) [3–5]. Unlike phase I enzymes, most importantly cytochromes P450 (CYPs), phase II enzymes were significantly less studied. On one hand, phase II enzymes allow the excretion of several xenobiotics, but they are also efficient for the formation of toxic substances [6]. Moreover, reactive oxygen species (ROS) are generated during phase I. Thus, investigation of
* Corresponding author. E-mail address: [email protected] (R. Vrzal).
the change in the expression of phase II and antioxidant enzymes is of general interest given that following the reactive metabolites from phase I, ROS must be eliminated in order to prevent cellular damage. During the treatment of transplant patients with immunosuppressive or immunomodulatory drugs, patients are usually exposed to two or three different types of drugs simultaneously at minimum. The first drug is used to suppress the immune system while the second ought to deal with the side effect of immunosuppression having the presence of bacterial or fungi infection. Hence, the induction or a reduction in the expression of phase II enzymes, may be as relevant during phase I enzymes, e.g. due to the existence of drug-drug interactions. In a recent paper, we described the effect of some drugs used in transplant patients on CYPs expression in the primary cultures of human hepatocytes [7]. We tested the following compounds: Cyclosporine A (CPA) and Tacrolimus (TAC; FK-506), the inhibitors of calcineurin complex; Rapamycin (RAP; Sirolimus) and its analog Everolimus (EVE), the inhibitors of serine-threonine kinase mTORC1 (mammalian target of rapamycin complex); and Mycophenolate mofetil (MYC), the inhibitor of inosine monophosphate dehydrogenase (IMPDH).
http://dx.doi.org/10.1016/j.pharep.2016.06.001 1734-1140/ ã 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Sp. z o.o. All rights reserved.
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
In our recent work, we discovered that none of the tested compounds had a significant effect on expression of tested cytochromes P450 in human hepatocytes within therapeutic and toxic concentrations. We illustrated the potentiating effect of rapamycin (sirolimus), everolimus on the AhR- and GR-driven luciferase activity in a stable transfected cell line. The greatest effects displayed mycophenolate mofetil since it is completely abolished dexamethasone-mediated GR-driven luciferase activity and induced AhR-driven luciferase activity. Therefore, in the current work, we investigated the effects of transplant drugs on phase II enzymes, including UDP-glucuronosyltransferases (UGTs) and glutathione-S-transferases (GSTs) in primary culture of human hepatocytes and human hepatocarcinoma HepG2 cells, the models of metabolically competent an incompetent cells, respectively. Furthermore, we measured the expression of three prominent antioxidant enzymesnamely; glutathione peroxidase 1 (GPX1), glutathione reductase (GSR) and heme-oxygenase 1 (HMOX1), given that some studies described anti-oxidative properties of certain transplant drugs [8,9]. The genes selection was given by an insufficient knowledge in this field, the importance of these genes in detoxification and antioxidant response of the cells. The spectrum of immunosuppressive drugs, used in this study, was based on the relatively frequent used in transplant medicine and sometimes incomplete knowledge in the field of phase II/ antioxidant enzyme expression. In the present study, we have been using transplant drugs with their toxic concentrations only [10] because we anticipated no effect for therapeutic concentrations due to our recent study [7]. Materials and methods Compounds and reagents Dimethylsulfoxide (DMSO), rifampicin (RIF), Cyclosporine A, FK-506 monohydrate (Tacrolimus), Mycophenolate mofetil, Rapamycin (Sirolimus) and Everolimus were purchased from SigmaAldrich (Prague, Czech Republic). 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) was obtained from Ultra Scientific (RI, USA). Oligonucleotide primers used in RT-PCR reactions were synthesized by Generi Biotech (Hradec Kralove, Czech Republic). LightCycler 480 Probes Master was purchased from Roche Diagnostic Corporation (Intes Bohemia, Czech Republic). All other chemicals of the highest quality were commercially available. Cell cultures
Quantitative reverse transcriptase polymerase chain reaction (qRTPCR) Total RNA isolation, synthesis of cDNA and PCR were described subsequently [7]. The levels of all mRNAs were determined using primers and Universal Probes Library (UPL; Roche Diagnostic Corporation, Prague, Czech Republic) technology (Table 1). Statistical analysis The data were subjected to either Paired Student’s t test within one experiment or to one-way ANOVA among the independent biological replicates. All statistical analyses were performed using Microsoft Excel [3_TD$IF]2007; p < 0.05 was considered to be statistically significant. Results HepG2 cells under the influence of transplant drugs First, we measured the expression of selected phase II and antioxidant enzymes in HepG2 cells after 24 h of incubation with Cyclosporine A (CPA; 500 ng/ml), Tacrolimus (TAC; 25 ng/ml), Rapamycin (RAP; 20 ng/ml), Everolimus (EVE; 20 ng/ml), Mycophenolate mofetil (MYC; 10 mg/ml), TCDD (5 nM) and/or DMSO (0,1%; v/v) as a negative control. Since AhR-signaling pathway is functional in HepG2 cells and some of the phase II enzymes are regulated by AhR [3], hence TCDD was used as positive control for this purpose. We observed that TCDD induced UGT1A1, UGT1A4, UGT1A6 and UGT1A9 mRNAs though it causes the decreased in UGT2B7 and UGT2B10 mRNAs (Fig. 1A–F). However, among the compounds tested, only MYC displayed a significant suppressive effect on UGT1A4, UGT1A9, UGT2B7 and UGT2B10 mRNAs. We therefore observed a significant decrease in GSTA1 mRNA by TCDD, but this did not occur in other measured GSTs (Fig. 2A–D). MYC significantly decreased the level of GSTA1, GSTO1, GSTT1, GSR and HMOX1 mRNAs (Figs. 2[34_TD$IF][25D, 3), while it increases mRNA for GPX1 Table 1 List of primers with corresponding UPL probes used for PCR. Name of the gene
Primer sequences (F/R)
UPL number
UGT1A1
ATATGGTTTTTGTTGGTGGAATC GCATTAATGTAGGCTTCAAATTCCT CAAGTCTTGCCTCTGAGCTTTT ACACGGATGCATAGCTGACA GGCAAAATCCCTCAGACAGT GTTCGCAAGATTCGATGGTC ACTATCCCAAACCCGTGATG TCTCCAGAAGCATTAATGTAGGC ACCAAATGTTGATTTTGTTGGA CACCACAACACCATTTTCTCC TCCTCATCCATTCTTACCAAATG TCTGTACAAACTCCTCCATTTCC ACGGTGACAGCGTTTAACAA CCGTGCATTGAAGTAGTGGA ACGGGGACTTCACCTTGAC GACCTTATATTTGCGCGTCAG CTGCAAACCCCAGAGGAG GGCAGAACCTCATGCTGTAGA TTTCTGACCTCATCGCTGGT TCTCCCACTTGCTTCAGGAC CACGGAGGAGCTGGAGAAC ACTTCCAAGCCCGACAAAG AACCAGTTTGGGCATCAGG GTTCACCTCGCACTTCTCG CAGTCAGGCAGAGGGTGATAG CCTGCAACTCCTCAAAGAGC CTCTGCTCCTCCTGTTCGAC ACGACCAAATCCGTTGACTC
8
UGT1A4 UGT1A6
Human Caucasian hepatocellular carcinoma cells HepG2 (ECACC No. 85011430) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% of fetal calf serum, 100 U/ml streptomycin, 100 mg/ml penicillin, 4 mM L-glutamine, 1% non-essential amino acids and 1 mM sodium pyruvate. The cells were maintained at 37 C with 5% of CO2 in a humidified incubator.
UGT1A9 UGT2B7 UGT2B10 GSTA1 GSTT1
Human hepatocytes GSTO1
Human hepatocytes were isolated from human liver which is obtained from multiorgan donors: LH50 (F, 55 years), LH51 (F, 58 years) and LH52 (F, 60 years); The requirements issued by the local ethical commission in the Czech Republic, was in accordance with tissue acquisition protocol. Cells were plated into collagen-coated dishes in a hormonally and chemically defined medium consisting of a mixture of William’s E and Ham’s F-12 [1:1 (v/v)] and then it was maintained at 37 C and 5% CO2 in a humidified incubator. Hepatocytes were incubated with the tested compounds, inducers and/or vehicle (DMSO; 0.1% v/v) for 24 h.
1009
GSTZ1 GSR GPX1 HMOX1 GAPDH
138 47 119 86 86 53 15 60 42 14 77 15 60
1010
[(Fig._1)TD$IG]
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
Fig. 1. The effect of tested drugs on mRNAs level of UGTs in human hepatocellular carcinoma HepG2 cells. HepG2 cells were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM) and DMSO (0.1% v/v) as a vehicle of control. Bar graphs show RT-PCR analyses of UGT1A1 (A), UGT1A4 (B), UGT1A6 (C), UGT1A9 (D), UGT2B7 (E), UGT2B10 (F) mRNAs. The data are the mean from triplicate measurements which are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels. *[27_TD$IF]Value is significantly different from untreated cells (UT; p < 0.05).
[(Fig._2)TD$IG]
Fig. 2. The effect of tested drugs on mRNAs level of GSTs in human hepatocellular carcinoma HepG2 cells. HepG2 cells were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM) and DMSO (0.1% v/v) as a vehicle of control. Bar graphs show RT-PCR analyses of GSTA1 (A), GSTO1 (B), GSTT1 (C), GSTZ1 (D) mRNAs. The data are the mean from triplicate measurements which are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels. *[27_TD$IF]Value is significantly different from untreated cells (UT; p < 0.05).
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
[(Fig._3)TD$IG]
1011
Fig. 3. The effect of tested drugs on mRNAs level of antioxidant enzymes in human hepatocellular carcinoma HepG2 cells. HepG2 cells were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs show RT-PCR analyses of GPX1 (A), GSR (B), and HMOX1 (C) mRNAs. The data are the mean from triplicate measurements which are also expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels. *[27_TD$IF]Value is significantly different from untreated cells (UT; p < 0.05).
(Fig. 3A). Everolimus decreased all mRNAs of tested GSTs’ forms (Fig. 2A–D). Rapamycin substantially decreased GSTA1 mRNA, although it induced GSTZ1 mRNA (Fig. 2A and D). Human hepatocytes under the influence of transplant drugs Thereafter, we evaluated the expression of phase II and antioxidant enzymes in three primary cultures of human hepatocytes. Unlike in HepG2, where signaling via PXR is slightly impaired based on weak CYP3A4 induction by rifampicin (RIF) [11], we employed PXR activator rifampicin as a positive control alongside TCDD as a result of the reported involvement of PXR in phase II expression as well [3]. In hepatocyte cultures, both RIF and TCDD induced mRNAs of UGT1A1, UGT1A4, UGT1A6 and UGT1A9 (Fig. 4A–D). And their effect on UGT2B7 and UGT2B10 mRNA was modulatory which probably reflected inter-individual variability between the donors (Fig. 4E and F). The same can be claimed for tested drugs as no trend can be observed among cultures. The effect of tested drugs on mRNAs level of GSTs’ isoforms was negligible with random and irreproducible inductions among
[(Fig._4)TD$IG]
cultures with the exception of positive control, RIF at GSTA1 mRNA level (Fig. 5A–D). A similar profile in the case of GSTs was observed for antioxidant enzymes, i.e. in most cases, modulatory effect of tested drugs (Fig. 6A–C) but a repeated induction of HMOX1 mRNA by RIF (Fig. 6C). Comparative analysis of mRNA levels for phase II and antioxidant enzymes genes When comparing the inducibility in different cell systems, it is important to have the knowledge of the basal expression levels of monitored genes. To this objective, we decided to compare the expression levels between HepG2 cells with each hepatocyte culture. Since the HepG2 cells represent genotypically and phenotypically uniform system which is contrary to heterogeneous hepatocytes with polymorphisms in each donor, the expression levels were represented as fold induction to untreated control of HepG2 cells (Fig. 7). As it can be seen, the major difference between HepG2 cells and hepatocytes lies especially in the expression of UGT1A subfamily members, as we detected
Fig. 4. The effect of tested drugs on mRNAs level of UGTs in primary cultures of human hepatocytes. Primary human hepatocytes, cultures LH50/51/52, were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM), RIF (10 mM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs show RT-PCR analyses of UGT1A1 (A), UGT1A4 (B), UGT1A6 (C), UGT1A9 (D), UGT2B7 (E), UGT2B10 (F) mRNAs. The data are the mean from triplicate measurements which are also expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels.
1012
[(Fig._5)TD$IG]
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
Fig. 5. The effect of tested drugs on mRNAs level of GSTs in primary cultures of human hepatocytes. Primary human hepatocytes, cultures LH50/51/52, were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM), RIF (10 mM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs shows RT-PCR analyses of:GSTA1 (A), GSTO1 (B), GSTT1 (C), GSTZ1 (D) mRNAs. The data are the mean from triplicate measurements and are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels.
[(Fig._6)TD$IG]
Fig. 6. The effect of tested drugs on mRNAs level of antioxidant enzymes in primary cultures of human hepatocytes. Primary human hepatocytes, cultures LH50/51/52, were incubated for 24 h with CPA (500 ng/ml), TAC (25 ng/ml), RAP (20 ng/ml), EVE (20 ng/ml), MYC (10 mg/ml), TCDD (5 nM), RIF (10 mM) and DMSO (0.1% v/v) as a vehicle for control. Bar graphs show RT-PCR analyses of:GPX1 (A), GSR (B), HMOX1 (C) [28_TD$IF]mRNAs. The data are the mean of triplicate measurements and are expressed as a fold-induction compared to DMSO-treated cells. The data were normalized per GAPDH mRNA levels.
approximately 40-, 1000-, 80- and 500-times higher expression of UGT1A1, 1A4, 1A6 and 1A9 in hepatocytes than in HepG2 cells, respectively (Fig. 7A–D). Next to 1A subfamily, the expressions of 2B family members were equal to HepG2 cells (UGT2B7, Fig. 7E) or strongly suppressed (UGT2B10, Fig. 7F). The isoforms of GSTs had the expression either suppressed (GSTA1/O1; Figs. 7G and H) or was comparable to HepG2 cells (GSTT1/Z1; Figs. 7I and J). The expression levels of antioxidant genes were increased (GPX1, Fig. 7K), suppressed (GSR, Fig. 7L) or equal (HMOX1, Fig. 7M) to HepG2 cells. The culture LH52 among these genes most likely reflects the individuality of the donor or the culture of less quality. Discussion In the current paper, we described the effect of selected transplant drugs on the expression of selected phase II, and the antioxidant enzymes in primary cultures of human hepatocytes
and human hepatocarcinoma HepG2 cells, the models of metabolically competent and incompetent cells, respectively. Our aim was to investigate if the concentrations described as toxic may have any impact on the expression of selected genes. We assumed that therapeutic concentrations will be without any effect in regard to our recent study with CYPs [7] such that higher concentrations, usually described as toxic in plasma, can be anticipated in the portal vein and may be the real ones, the hepatocytes are exposed to. We may expect that our data from human hepatocytes indicates none of the tested compounds affect expression of phase II and antioxidant genes owing to the fact that, these drugs are usually taken orally. Moreover, data obtained from this study are remarkable from the mechanistic point of view such that, as long as HepG2 cells lack significant metabolizing activity in comparison with human hepatocytes. We may also speculate that the effect of MYC on the expression of selected genes probably involves changes
[(Fig._7)TD$IG]
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
1013
Fig. 7. The comparison of expression levels of monitored genes between HepG2 cells and primary cultures of human hepatocytes. The equal amounts of cDNAs of untreated controls of HepG2 cells from three independent passages were mixed simultaneously, such that, the expression levels of monitored genes were determined. In contrast, due to the genotypical and the phenotypical individuality of each donor of human hepatocytes, the expression levels were determined in each culture and compared to uniform HepG2 cells. The data are the mean of triplicate measurements and are expressed as a fold-induction compared to DMSO-treated HepG2 cells. The data were normalized per GAPDH mRNA levels. Bar graphs show RT-PCR analyses of UGT1A1 (A), UGT1A4 (B), UGT1A6 (C), UGT1A9 (D), UGT2B7 (E), UGT2B10 (F), GSTA1 (G), GSTO1 (H), GSTT1 (I), GSTZ1 (J), GPX1 (K), GSR (L), HMOX1 (M) mRNAs.
1014
R. Vrzal et al. / Pharmacological Reports 68 (2016) 1008–1014
in stability or inducibility of a given mRNAs. A good example of these are UGT1As in HepG2 cells, where slight, but insignificant, induction was observed for both UGT1A1 and UGT1A6 mRNAs, though UGT1A4 and UGT1A9 mRNAs were drastically decreased upon MYC treatment (Fig. 1A–D). In our recent paper we found that MYC is capable of AhR activation as well as weak CYP1A1 induction [7]. Thus, its inducing effect might reflect AhR involvement in the process. This would be logical as some UGTs were reported to be regulated by AhR via dioxin responsive element (DRE) [1]. On the other hand, MYC is primarily known based on ability to inhibit IMPDH. Therefore, one of the explanations of MYC-mediated down-regulation in the case of UGT1A4/1A9 mRNAs could be the decreased availability of nucleosides due to the limited synthesis de novo. The reason why there is no effect in human hepatocytes could be the rapid metabolism of MYC by liver esterases [12] and consequently by UGT1A9 and UGT2B7 [13]. This hypothesis is likely due to the approx. 500-times higher expression of UGT1A9 in hepatocytes alongside HepG2 cells (Fig. 7D). Of course, considering we observed a strong antagonistic effect of MYC on glucocorticoid receptor [7] in which GR is least present in HepG2 cells [14], an involvement of GR in the decrease of mRNAs for certain UGTs, all GSTs, GSR and HMOX1, can be expected. Hence, there are few studies, which suggest such scenario [15,16]. Another important effect is the opposite action of RAP and EVE on mRNA of GSTZ1 (Fig. 2D). Meanwhile these two compounds have a similar structures, they both decreases mRNA in GSTA1 (Fig. 2A) although only EVE decreases GSTO1 and GSTT1 mRNAs (Figs. 2B and C). They displayed almost completely opposite effect on GSTZ1 mRNA. This is quite intriguing in that we expect a similar mode of action due to their mTORC1 inhibiting activities. However, apparently a little addition to the structure of molecule (hydroxyethyl in the case of EVE) may lead to different effect which in this view may not be related to mTORC1 inhibition. In conclusion, tested transplant drugs have no impact on the expression of phase II and antioxidant enzymes genes in human hepatocytes. It is probably positive finding since it excludes possible drug-drug interactions based on the induction of enzymes involved in pharmacokinetic of the drugs. The effect of MYC in metabolically less competent tissues is unlikely especially after oral administration. Moreover, it shades the doubts on toxicological together with pharmacological studies which were performed solely in metabolically incompetent cells (like HepG2 in our case), hence, the conclusions made for the impact of tested compounds on in vivo systems, may be excessively overestimated. Conflict of interest None.
Acknowledgements This work was supported by the grant from the Czech Ministry of Health IGA NT/13591, by the project POST-UP, reg. No. CZ.1.07/ 2.3.00/30.0004 and by the grant from Gran Agency of Czech Republic GACR P303/12/G163. References [1] Hu DG, Meech R, McKinnon RA, Mackenzie PI. Transcriptional regulation of human UDP-glucuronosyltransferase genes. Drug Metab Rev 2014;46:421–58. [2] Riches Z, Stanley EL, Bloomer JC, Coughtrie MW. Quantitative evaluation of the expression and activity of five major sulfotransferases (SULTs) in human tissues: the SULT pie. Drug Metab Dispos 2009;37:2255–61. [3] Buckley DB, Klaassen CD. Induction of mouse UDP-glucuronosyltransferase mRNA expression in liver and intestine by activators of aryl-hydrocarbon receptor, constitutive androstane receptor, pregnane X receptor, peroxisome proliferator-activated receptor alpha, and nuclear factor erythroid 2-related factor 2. Drug Metab Dispos 2009;37:847–56. [4] Chen C, Staudinger JL, Klaassen CD. Nuclear receptor, pregname X receptor, is required for induction of UDP-glucuronosyltranferases in mouse liver by pregnenolone-16 alpha-carbonitrile. Drug Metab Dispos 2003;31:908–15. [5] Li Y, Buckley D, Wang S, Klaassen CD, Zhong XB. Genetic polymorphisms in the TATA box and upstream phenobarbital-responsive enhancer module of the UGT1A1 promoter have combined effects on UDP-glucuronosyltransferase 1A1 transcription mediated by constitutive androstane receptor, pregnane X receptor, or glucocorticoid receptor in human liver. Drug Metab Dispos 2009;37:1978–86. [6] Ritter JK. Roles of glucuronidation and UDP-glucuronosyltransferases in xenobiotic bioactivation reactions. Chem Biol Interact 2000;129:171–93. [7] Vrzal R, Zenata O, Bachleda P, Dvorak Z. The effects of drugs with immunosuppressive or immunomodulatory activities on xenobioticsmetabolizing enzymes expression in primary human hepatocytes. Toxicol In Vitro 2015;29:1088–99. [8] Dalmarco EM, Budni P, Parisotto EB, Wilhelm Filho D, Frode TS. Antioxidant effects of mycophenolate mofetil in a murine pleurisy model. Transpl Immunol 2009;22:12–7. [9] Ozdemir G, Kilinc M, Ergun Y, Sahin E. Rapamycin inhibits oxidative and angiogenic mediators in diabetic retinopathy. Can J Ophthalmol 2014;49: 443–9. [10] Schulz M, Schmoldt A. Therapeutic and toxic blood concentrations of more than 800 drugs and other xenobiotics. Pharmazie 2003;58:447–74. [11] Doricakova A, Novotna A, Vrzal R, Pavek P, Dvorak Z. The role of residues T248: Y249 and T422 in the function of human pregnane X receptor. Arch Toxicol 2013;87:291–301. [12] Bullingham RE, Nicholls AJ, Kamm BR. Clinical pharmacokinetics of mycophenolate mofetil. Clin Pharmacokinet 1998;34:429–55. [13] Picard N, Ratanasavanh D, Premaud A, Le Meur Y, Marquet P. Identification of the UDP-glucuronosyltransferase isoforms involved in mycophenolic acid phase II metabolism. Drug Metab Dispos 2005;33:139–46. [14] Dvorak Z, Vrzal R, Pavek P, Ulrichova J. An evidence for regulatory cross-talk between aryl hydrocarbon receptor and glucocorticoid receptor in HepG2 cells. Physiol Res 2008;57:427–35. [15] Kratschmar DV, Calabrese D, Walsh J, Lister A, Birk J, Appenzeller-Herzog C, et al. Suppression of the Nrf2-dependent antioxidant response by glucocorticoids and 11beta-HSD1-mediated glucocorticoid activation in hepatic cells. PLoS One 2012;7:e36774. [16] Assaf N, Shalby AB, Khalil WK, Ahmed HH. Biochemical and genetic alterations of oxidant/antioxidant status of the brain in rats treated with dexamethasone: protective roles of melatonin and acetyl-L-carnitine. J Physiol Biochem 2012;68:77–90.