- Email: [email protected]
Treatment donor cells with UNC0638 modify the abnormal histone H3K9 dimethylation and gene expression in cloned goat embryos
Small Ruminant Research xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Research Paper
Treatment donor cells with UNC0638 modify the abnormal histone H3K9 dimethylation and gene expression in cloned goat embryos ⁎
Yongsheng Wang, Yijun Zhang, Tingchao Mao, Beifeng Yan, Ruizhi Deng, Biao Wei, Yong Zhang , ⁎ Jun Liu College of Veterinary Medicine, Northwest A & F University, Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Yangling, Shaanxi Province, China
A R T I C L E I N F O
A B S T R A C T
Keywords: SCNT H3K9me2 UNC0638 Key developmental genes Embryonic development Goat
Epigenetic modifications are considered crucial to the reprogramming of somatic cell nuclear transfer (SCNT) embryos and subsequent in vitro development. The abnormal histone H3K9 dimethylation (H3K9me2) status has recently been reported in SCNT embryos. The present study was designed to evaluate the effect of treatment donor cells with UNC0638, a specific inhibitor of H3K9 methyltransferase G9A, on in vitro development, H3K9me2 levels and gene expression in goat SCNT embryos. Different concentration of UNC0638 was applied to treat goat fetal fibroblasts (GFFs), and the treated GFFs were used as donor cells for SCNT. The results showed that 0.2 μM UNC0638 decreased significantly the level of H3K9me2 in treated GFFs (P < 0.05), and did not influence the cell viability (P > 0.05). Compared with intracytoplasmic sperm injection (ICSI) embryos, SCNT embryos derived from untreated GFFs (C-SCNT) presented higher level of H3K9me2 (P < 0.05). Although the in vitro developmental rate was not improved, the abnormal H3K9me2 level was corrected in SCNT embryos from UNC0638-treated GFFs (T-SCNT) compared with C-SCNT embryos. Furthermore, UNC0638 treatment could promote the mRNA expression of key developmental genes Nanog and Oct4 (P < 0.05), but did not affect the imprinted genes H19 and IGF2R expression in goat SCNT embryos (P > 0.05). In conclusion, these results indicated that treatment donor cells with UNC0638 may have beneficial effects in terms of modifying the abnormal H3K9me2 status and gene expression in cloned goat embryos.
1. Introduction Many small molecular inhibitors have been applied to improve development of SCNT embryos by specifically modifying the DNA methylation, histone methylation or histone acetylation status. For example, 5-aza-2′-deoxycytidine and trichostatin A could inhibit DNA methylation and histone deacetylation, respectively (Ding et al., 2008; Tsuji et al., 2009). Inhibiting histone deacetylation could improve development efficiency and blastocyst quality of cloned embryos (Dai et al., 2010; Miyoshi et al., 2010; Su et al., 2011). Correcting the abnormal epigenetic modifications can improve the development of SCNT embryos. The abnormal H3K9me2 status has been observed in cloned embryos of mouse (Wang et al., 2007), cattle (Santos et al., 2003), sheep (Fu et al., 2012) and pig (Huang et al., 2016a). These studies reported that cloned embryos showed higher level of H3K9me2 than IVF embryos at the same development stage. The aberrant reprogramming of histone methylation might be a barrier of the somatic nucleus
reprogramming in cloned embryos (Matoba et al., 2014). In addition, H3K9me2 is associated with gene silencing, including inactivation of Oct4 during differentiation of embryonic stem cells or embryogenesis (Kimura et al., 2004). The Oct4 expression was incompletely activated in blastocyst of SCNT embryos (Bortvin et al., 2003). However, the characteristics of H3K9me2 pattern in cloned goat embryos have not been studied. BIX01294 has been identified as an inhibitor of histone-lysine methyltransferase G9A, and it can selectively reduces H3K9me2 levels (Kubicek et al., 2007). BIX01294 has been successfully used to enhance the generation of induced Pluripotent Stem cells (Shi et al., 2008). It has been reported that treatment with BIX-01294 enhanced the developmental competence of porcine cloned embryos through improving epigenetic reprogramming and gene expression (Huang et al., 2016a). Although treatment with BIX-01294 can not improve the in vitro developmental rate of cloned embryos in sheep and mouse, BIX-01294 could correct abnormal H3K9me2 modification (Fu et al., 2012; Huang et al., 2016b). Recently, UNC0638 was identified as another G9A
⁎
Corresponding author at: College of Veterinary Medicine, Northwest A & F University, Yangling, Shaanxi 712100, China. E-mail addresses: [email protected] (Y. Wang), [email protected] (Y. Zhang), [email protected] (T. Mao), [email protected] (B. Yan), [email protected] (R. Deng), [email protected] (B. Wei), [email protected] (Y. Zhang), [email protected], [email protected] (J. Liu). http://dx.doi.org/10.1016/j.smallrumres.2017.08.011 Received 9 September 2016; Received in revised form 27 July 2017; Accepted 7 August 2017 0921-4488/ © 2017 Published by Elsevier B.V.
Please cite this article as: Wang, Y., Small Ruminant Research (2017), http://dx.doi.org/10.1016/j.smallrumres.2017.08.011
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
previously (Su et al., 2012). The fluorescence intensity is expressed relative to that of 2-cell ICSI embryos or 0 μM UNC0638 treated cells (set as 100%). The experiment was repeated three times and samples without primary antibody were used as a negative control.
inhibitor to reduce H3K9me2 level, and it has been shown to be less toxic than BIX01294 (Vedadi et al., 2011; Fu et al., 2014). In the present study, the effects of treatment donor cells with UNC0638 on in vitro development, H3K9me2 levels and gene expression in cloned goat embryos were investigated.
2.5. Cell cycle analysis 2. Materials and methods Cell cycle analysis was performed by flow cytometry as described in a previous study (Hayes et al., 2005). GFFs treated with 0, 0.2 or 0.5 μM UNC0638, respectively, were incubated for 48 h and then washed with PBS 3 times, then trypsinized, centrifugalized and fixed in 70% precooling ethanol at 4 °C overnight. GFFs were collected and suspended in PBS supplemented with 0.1 mg/mL RNase. The samples were centrifugalized, dyed with 50 μg/mL propidium iodide (PI) containing RNase-free (Beyotime, C1052, Jiangsu, China) for 30 min at 37 °C in dark. The cell cycle were analyzed by a flow cytometer (Beckman Coulter).
2.1. Ethics statements The entire experimental procedure was designed under the consideration of animal welfares and approved by the Animal Care and Use Committee of the College of Veterinary Medicine, Northwest A & F University. 2.2. Nuclear donor cells preparation and UNC0638 treatment Nuclear donor cells were derived from a female Saanen Dairy goat fetus which was 40 days old of pregnancy. The small skin piece was cut and washed three times by phosphate-buffered saline (PBS), and then was minced into 1 mm3 pieces and spread into 60 mm dishes. Then the tissues were cultured in DMEM (Gibco, Grand Island, USA) medium composed of 10% fetal bovine serum (FBS, Gibco), 100 mg/mL streptomycin and 100 IU/mL penicillin. After 1–2 weeks, goat fetal fibroblasts (GFFs) were amplified up to 90% confluence and then were passaged. Based on previous report (Vedadi et al., 2011), UNC0638 was dissolved into various concentrations (0.1, 0.2, 0.5, 1 μM) with dimethyl sulphoxide (DMSO) and then GFFs were treated 48 h for cell viability assays, immunostaining and cell cycle analysis.
2.6. Oocyte collection and in vitro maturation (IVM) The collection and in vitro maturation (IVM) of oocytes was performed as described in our previous study (Liu et al., 2011). Briefly, ovaries were collected separated from the surrounding tissue, and Cumulus-oocyte complexes (COCs) were achieved from ovaries. COCs were washed and cultured for 22–24 h at 38.5 °C in medium TCM199 supplemented with 10% (v/v) FBS, 1 μg/mL 17-estradiol, and 0.075 IU/mL Human Menopausal Gonadotropin (HMG). After 20 h IVM, COCs were transferred into PBS supplemented with 0.1% hyaluronidase to disperse the cumulus cells. Oocytes with a first polar body and evenly granulated ooplasm were selected for ICSI or SCNT.
2.3. Cell viability assay 2.7. Intracytoplasmic sperm injection (ICSI) Cell viability was tested using Cell Counting Kit (CCK-8) (Beyotime, Jiangsu, China) as described in a previous study (Wu et al., 2013). Briefly, GFFs were subcultured into 96-well plates at the same concentrations and treatment with different concentrations of UNC0638. After treatment for 48 h in incubator, 10 μL CCK-8 solutions were added into each well. The plate was kept in incubator for 2 h and then was read using a spectrophotometer (Epoch Biotek, America). The absorbance value (Optical density, OD) was tested at 450 nm wave length. The experiment was repeated 3 times. The percentage of cells viability (%) = (OD treatment group/OD control group) × 100.
Fresh semen was collected by artificial vagina from bucks. The sperm motility was evaluated, and then 200 μL semen were transferred into the bottom of 10 mL sterile tube containing 3 mL Blacket & Oliphant (BO) solution. After 30 min, floated-up sperms were collected and added into a droplet of 10% polyvinilpirrolidone solution for ICSI. The procedure of ICSI was performed according to a previous study (Jiménez-Macedo et al., 2005). Briefly, the sperm tail was broken by the injection pipette, and then a sperm were aspired and injected into the ooplasm. The first body was placed at the 6 or 12 o’clock position while the preferred position of injection was at the 3 o’clock point and sperm was released at 9 o’clock position. Then the ICSI embryos were activated in 5 umol/L ionomycin for 5 min, and then cultures in 200 μL mSOF medium.
2.4. Immunostaining and quantification of fluorescence intensity Immunofluorescence staining was performed as described in our previous study (Su et al., 2011). Both cells and embryos were fixed for 30 min in 4% paraformaldehyde, and then permeabilized for 30 min in 0.1% Triton X-100 in PBS. All following steps were performed at room temperature unless mentioned. Immune Staining Wash Buffer was used for washing the cells and embryos after every step. The samples were blocked in the Immune Staining Blocking Solution (Beyotime, P0102) for 12 h at 4 °C. The samples were stained with H3K9me2 antibodies (Beyotime, AH438) overnight at 4 °C, which was diluted 1:500 in Immune Staining Primary Antibody Dilution Buffer (Beyotime, P0103). After extensive washing, the samples were incubated in Alexa Fluor 488-labeled Goat Anti-Rabbit IgG (Beyotime, A0423; Diluted 1:500). Finally, the samples were stained briefly with 4, 6-diamidino-2-phenylindole (DAPI) (Beyotime, C1005) for 3 min. Embryos were putted in a drop of Antifade Mounting Medium (Beyotime, P0126) on glass slides and covered with glasses. Both cells and embryos were observed under Nikon eclipse Ti-S microscope equipped with a Nikon DS-Ri1 digital camera (Nikon, Tokyo, Japan). All images were captured using the same settings and without any adjustment of constant or brightness. The mean fluorescence intensity of H3K9me2 levels was measured using Image-Pro Plus (Version 6.0; Media Cybernetics) as reported
2.8. Nuclear transfer The nuclear transfer was carried out in accordance with previous study (Liu et al., 2011). Briefly, both the first polar body and metaphase plate were removed and then a round donor cell was injected into the perivitelline space of oocytes. The couplets were fused by electrofusion and incubated for 2–3 h in TCM-199 supplemented with 10% FBS and 7.5 μg/mL cytochalasin B. The reconstructed embryos were activated in 5 μM ionomycin for 5 min and then 2 mM 6-dimethylaminopurine for 4 h. Following activation process, the presumptive embryos were washed extensively and cultured in 200 μL mSOF covered with mineral oil. 2.9. Quantitative real-time PCR (qPCR) The qPCR was performed on StepOne Plus reaction system (ABI, USA) according to a previous study (Su et al., 2012). The embryos RNA isolation and RT reaction was conducted using SuperScript™ III Cells Direct™ cDNA Synthesis System (Life technologies, USA). The cDNA was used for qPCR to quantify the mRNA levels using SYBR Premix 2
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
Table 1 The primers for qPCR. Gene
Primer sequences (5′-3′)
Annealing temperature (°C)
PCR product (bp)
Sequence accession
H2A.Z
F: CTGGCGGTAAGGCTGGGAAG R: GTTGCAAGTGACGAGGGGTAATAC F: GAAGGGCAAACGATCAAGCA R: CAGGGAATGGGACCGAAGA F: TTCCTACCATCAGGGGTGTTT R: GCATTGATTGTTCCAAGGCT F: CGGTGTGATGGAGAGAGCAG R: GAGGGAAGAGCGTGAGTCC F: GGAAACAGCGCTTTGACCTG R: TTCTAAGTCACCCACGGCAC
60
261
XM_013964495.1
60
173
NM_001285569.1
60
184
NM_001285576.1
60
171
EU293410.1
60
194
XM_013966662.1
Oct4 Nanog H19 IGF2R
F: Forward Primer; R: Reverse Primer.
ExTaqTM II (Takara, DaLian, China). Briefly, the primers were synthesized based on goat genome database in NCBI database (Table 1). House keeping gene Histone 2a (H2A) mRNA was set as internal reference gene. The reaction system (20 μL) contains a mixture containing 10 μL SYBR Premix Ex TaqMIX (2×), 0.4 μL ROX Reference Dye (50×), 0.8 μL Forward primer (10 μM), 0.8 μL Reverse primer (10 μM), 2 μL cDNA templates and 6 μL sterile water. The cycling condition was listed as follows: 95 °C, 30 s for 1 cycle; 95 °C, 5 s and 60 °C, 30 s for 40 cycles; melting step for 1 cycle. Transcripts of target genes were quantified in three replicates and calculated relative to the transcription in every sample of H2a. The average expression level of each gene in ICSI embryos was set as 1. 2.10. Statistical analysis All experiments were repeated more than three times. The data were presented as mean ± SEM. Data were analyzed by one-way ANOVA and compared by Tukey-Kramer test using SPSS version 13.0 software (SPSS, Inc., Chicago, IL). Differences were considered significant at P < 0.05. 3. Results 3.1. Effects of UNC0638 treatment on cell viability and global H3K9me2 level of GFFs Considering possible cellular toxicity of UNC0638 on fibroblasts (Vedadi et al., 2011), we tested the cell viability of UNC0638-treated GFFs. Treating GFFs with increasing concentrations of UNC0638, the cell viability decreased gradually in a dose-dependent manner (Fig. 1). The cell viability declined significantly when concentration of UNC0638 increased up to 0.5 μM, but the concentration of 0.2 μM had no obvious influence on cell viability.
Fig. 2. The global H3K9me2 level of GFFs treated with different concentrations of UNC0638. (A) Staining of H3K9me2 (green) in GFFs at passage 4. DNA was counterstained as blue. (B) Relative fluorescence intensity compared to the control group (0 μM) was calculated and showed in different bars. Different superscripts mean significant difference between treated group and control group. Scale bar = 50 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
The global H3K9me2 level was measured by immunofluorescence staining (Fig. 2A). The global H3K9me2 levels in the treated cells were lower than those of control cells (P < 0.05) (Fig. 2B). These results indicated 0.2 μM UNC0638 reduced significantly the global H3K9me2
Fig. 1. The cell viability of GFFs treated with UNC0638. Cell viability was plotted as the absorbance of UNC0638 treated groups relative to untreated ones. The absorbance in untreated cells was assumed 100%. The bar with different superscripts indicates statistically significant difference.
3
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
treatment, the expression levels of Oct4 and Nanog were significantly increased in T-SCNT blastocysts compared to C-SCNT blastocysts (p < 0.05), and had no difference with ICSI blastocysts. There were no significant differences in H19 and IGF2R expression between C-SCNT and T-SCNT blastocysts, but the expression levels of IGF2R was higher in C-SCNT and T-SCNT blastocysts than that in ICSI blastocysts. These results indicated that UNC0638 treatment can promote the expression of key developmental genes Oct4 and Nanog without affecting the imprinted genes H19 and IGF2R in goat SCNT embryos.
Table 2 The cell cycle analysis of UNC0638-treated GFFs. Treatment
G0/G1 (%)
0 μΜ 0.2 μΜ 0.5 μΜ
71.87 ± 0.79 75.04 ± 0.49 82.72 ± 0.10
a b c
G2/M (%)
S (%)
10.66 ± 0.23 a 9.14 ± 0.92 ab 7.47 ± 1.44 b
17.475 ± 1.02 a 15.82 ± 0.40 a 9.82 ± 1.34 b
a,b, c
Values with different superscript within columns are significantly different from each other (P < 0.05).
level without affecting the cell viability of GFFs.
4. Discussion
3.2. UNC0638-induced G0/G1 cell cycle arrest
The present study indicated that the H3K9me2 status of goat SCNT embryos is aberrant reprogrammed. Treatment donor cells with 0.2 μM UNC0638 can correct the abnormal H3K9me2 status and gene expression of cloned goat embryos. However, the in vitro development of SCNT embryos could not be improved. Due to the low cellular toxicity, UNC0638 was used to reduce H3K9me2 level of genome (Yuan et al., 2012). The present study indicated that 0.2 μM UNC0638 significantly decreased the H3K9me2 level of GFFs and had no influence on cell viability. This result is similar to a previous study in sheep (Fu et al., 2014). Furthermore, we found that the proportion of G0/G1 phase cells was significantly increased in treated cells, which was considered beneficial to the development of SCNT embryos (Campbell et al., 1996). These results demonstrated that UNC0638 may be a potential chemical that could be used to modify H3K9me2 status of donor cells for SCNT. The present study indicated that the level of H3K9me2 remained very low from 2-cell to 8-cell stage embryos in goats, coincident with previous study in bovine embryos (Wu et al., 2011). After the whole genome being activated, intensity rose significantly. The regulated H3K9me2 pattern influences the gene regulation, cell cycle, translation and metabolism (Xue et al., 2013) and is correlated with the developmental potential of early embryos (Santos et al., 2003). In this study, we demonstrated that treatment donor cells with UNC0638 could modify the abnormal H3K9me2 status of SCNT embryos compatible to the ICSI embryos in goats. Similarly, previous studies have indicated that UNC0638 and BIX01294 can reduced global H3K9me2 levels in cultured somatic cells or SCNT embryos in sheep, mouse or pig (Fu et al., 2012; Fu et al., 2014; Huang et al., 2016a; Huang et al., 2016b). The H3K9me2 modification is associated with the transcription silencing of genes (Nishioka et al., 2002; Feldman et al., 2006), regulating Oct4 expression in differentiation of embryonic cells (EpsztejnLitman et al., 2008). BIX-01294 combined with Klf4, Sox2 and c-Myc could generate iPS cells (Shi et al., 2008). Down-regulating H3K9me2 level could facilitate the transcription of Oct4 by depressing G9a and promote nuclear reprogramming (Feldman et al., 2006). In addition, it is reported that PGC7 binds to chromatin containing H3K9me2 to protect some imprinted genes loci in zygotes. (Nakamura et al., 2012). The present study indicated that treatment donor cells with UNC0638 could increase the mRNA expression levels of Oct4 and Nanog, but did not affect the imprinted genes in goat SCNT embryos. Despite of in vitro development rate was not improved, UNC0638 could benefit the quality of SCNT embryos based on the H3K9me2 modification and the Oct4 and Nanog expression in goat SCNT embryos.
Flow cytometric analysis was conducted to analyze the cell cycle of UNC0638-treated cells (Table 2). Cells in the G0/G1 cell cycle stage in UNC0638-treated groups were significant higher than that in untreated group (P < 0.05), and the cells in G2/M and S phase decreased in UNC0638-treated groups. This result indicated down-regulating the level of H3K9me2 by UNC0638 induced G0/G1 cell cycle arrest and suppression of cell proliferation. 3.3. Development of goat SCNT embryos To evaluate the effect of down-regulating H3K9me2 levels of donor cells on in vitro development of goat SCNT embryos, we treated GFFs with 0.2 μM UNC0638 for 48 h as treated group (T-SCNT), and 0 μM as control group (C-SCNT). In addition, ICSI embryos were set as the standard group (ICSI). As shown in Table 3, the in vitro developmental rate of SCNT embryos was lower than that of ICSI embryos (P < 0.05). There was no significant difference in developmental rate between CSCNT and T-SCNT embryos. 3.4. Global H3K9me2 level of embryos To examine the effect of UNC0638 treatment on H3K9me2 level of SCNT embryo, we analyzed the dynamic changes of H3K9me2 levels in ICSI, C-SCNT and T-SCNT embryos. As shown in Fig. 3A and 3B, the three groups showed obvious enhancement of H3K9me2 level from 8cell embryos to blastocyst, but maintained low level before 8-cell stage. The H3K9me2 level in C-SCNT embryos exhibits significantly higher than ICSI embryos at the same stage. Treating SCNT embryos (T-SCNT embryos) with UNC0638 decreased H3K9me2 levels compared to control embryos (C-SCNT embryos) (Fig. 3B, P < 0.05). Furthermore, there was no obvious difference in H3K9me2 level between T-SCNT and ICSI embryos. These results showed that the aberrant H3K9me2 status in goat SCNT embryoscan be corrected by treating GFFs donor cells with UNC0638. 3.5. The gene expression levels in blastocysts Relative expression levels of Oct4, Nanog, H19 and IGF2R were analyzed in blastocysts from ICSI, C-SCNT and T-SCNT groups using qPCR (Fig. 4). The expression levels of Oct4 and Nanog in C-SCNT blastocysts were lower than those in ICSI blastocysts. After UNC0638 Table 3 Effect of UNC0638 treatment on the in vitro development of goat SCNT embryos. Treatment ICSI C-SCNT T-SCNT
No. of cultured embryos 83 93 116
No. of cleavages (%) a
72 (87 ± 2.23) 65 (70.53 ± 6.29) b 86 (73.03 ± 6.9) b
No. of ≥4 cell embryos (%) 67 (80.24 ± 4.38) 57 (62.65 ± 9.98) 78 (64.72 ± 10.42)
a, b Values with different superscript within columns are significantly different from each other (P < 0.05). Different stages of in vitro development from cleavage to blastocysts were detected at 48, 72, 120 and 144 h.
4
No. of morulas (%) 32 (39.14 ± 5.26) 23 (25.17 ± 4.75) 32 (26.92 ± 3.23)
No. of blastocysts (%) a b b
19 (23.27 ± 3.45) a 11 (12.03 ± 1.59) b 13(10.93 ± 2.22) b
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
Fig. 3. The H3K9me2 levels in different stages of ICSI, C-SCNT, T-SCNT embryos. (A) H3K9me2 staining of three groups of embryos from 2-cell stage to blastocyst (green). Each group was stained with DAPI to exhibit DNA (Blue). (B) The fluorescence intensity of H3K9me2 was calculated relative to DNA intensity in each group. Labeling intensity of all embryos was presented relative to that of 2-cell stage of ICSI embryos (assumed as 100%). Different superscripts mean significant difference (P < 0.05). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
In this study, treating donor cells with UNC0638 had no effect on in vitro development of goat SCNT embryos, similarly to the report in sheep (Fu et al., 2014). In previous study, BIX01294 was used to treat reconstructed embryos directly, and the in vitro development rate was not improved (Fu et al., 2012; Terashita et al., 2013). However, the beneficial effect of BIX-01294 treatment on cloned embryos has been observed in terms of correcting abnormal H3K9me2 modification and the gene expression (Huang et al., 2016a; Huang et al., 2016b). The developmental competence of porcine SCNT embryos was significantly enhanced both in vitro and in vivo after 50 μM BIX-01294 treatments (Huang et al., 2016a). Consequently, the effect of BIX-01294 treatment on in vivo development of cloned embryos need be further investigated. Additionally, it is required to undergo delicate epigenetic modifications for successful development of embryos (Cantone and Fisher, 2013). Previous studies show SCNT embryos endure low acetylation on H3k9, high DNA methylation and low H3K4 dimethylation (Yang et al., 2007; Ding et al., 2008; Shao et al., 2008). Combination of UNC0638 treatment and other regulators of epigenetic modifications may facilitate the
Fig. 4. The relative mRNA expression of pluripotency genes Oct4 and Nanog, imprinted gene H19 and IGF2R in ICSI, C-SCNT and T-SCNT blastocysts. The data of ICSI group was set as 1 and different superscripts mean significant difference (P < 0.05).
5
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
Jiménez-Macedo, A.-R., Izquierdo, D., Anguita, B., Paramio, M.-T., 2005. Comparison between intracytoplasmic sperm injection and in vitro fertilisation employing oocytes derived from prepubertal goats. Theriogenology 64, 1249–1262. Kimura, H., Tada, M., Nakatsuji, N., Tada, T., 2004. Histone code modifications on pluripotential nuclei of reprogrammed somatic cells. Mol. Cell. Biol. 24, 5710–5720. Kubicek, S., O'Sullivan, R.J., August, E.M., Hickey, E.R., Zhan, Q., Teodoro, M.L., Rea, S., Mechtler, K., Kowalski, J.A., Homon, C.A., Kelly, T.A., Jenuwein, T., 2007. Reversal of H3K9me2 by a small-molecule inhibitor for the G9a histone methyltransferase. Mol. cell 25, 473–481. Liu, J., Li, L., Du, S., Bai, X., Zhang, H., Tang, S., Zhao, M., Ma, B., Quan, F., Zhao, X., Zhang, Y., 2011. Effects of interval between fusion and activation, cytochalasin B treatment, and number of transferred embryos, on cloning efficiency in goats. Theriogenology 76, 1076–1083. Matoba, S., Liu, Y., Lu, F., Iwabuchi, K.A., Shen, L., Inoue, A., Zhang, Y., 2014. Embryonic development following somatic cell nuclear transfer impeded by persisting histone methylation. Cell 159, 884–895. Miyoshi, K., Mori, H., Mizobe, Y., Akasaka, E., Ozawa, A., Yoshida, M., Sato, M., 2010. Valproic acid enhances in vitro development and Oct-3/4 expression of miniature pig somatic cell nuclear transfer embryos. Cell. Reprog. (Formerly Cloning Stem Cells) 12, 67–74. Nakamura, T., Liu, Y.J., Nakashima, H., Umehara, H., Inoue, K., Matoba, S., Tachibana, M., Ogura, A., Shinkai, Y., Nakano, T., 2012. PGC7 binds histone H3K9me2 to protect against conversion of 5mC to 5hmC in early embryos. Nature 486, 415–419. Nishioka, K., Chuikov, S., Sarma, K., Erdjument-Bromage, H., Allis, C.D., Tempst, P., Reinberg, D., 2002. Set9, a novel histone H3 methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation. Gene Dev. 16, 479–489. Santos, F., Zakhartchenko, V., Stojkovic, M., Peters, A., Jenuwein, T., Wolf, E., Reik, W., Dean, W., 2003. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr. Biol. 13, 1116–1121. Shao, G.B., Ding, H.M., Gong, A.H., Xiao, D.S., 2008. Inheritance of histone H3 methylation in reprogramming of somatic nuclei following nuclear transfer. J. Reprod. Devel. 54, 233–238. Shi, Y., Tae Do, J., Desponts, C., Hahm, H.S., Schöler, H.R., Ding, S., 2008. A combined chemical and genetic approach for the generation of induced pluripotent stem cells. Cell Stem Cell 2, 525–528. Su, J., Wang, Y., Li, Y., Li, R., Li, Q., Wu, Y., Quan, F., Liu, J., Guo, Z., Zhang, Y., 2011. Oxamflatin significantly improves nuclear reprogramming, blastocyst quality, and in vitro development of bovine SCNT embryos. PLoS One 6, e23805. Su, J., Wang, Y., Li, R., Peng, H., Hua, S., Li, Q., Quan, F., Guo, Z., Zhang, Y., 2012. Oocytes selected using BCB staining enhance nuclear reprogramming and the in vivo development of SCNT embryos in cattle. PLoS One 7, e36181. Terashita, Y., Yamagata, K., Tokoro, M., Itoi, F., Wakayama, S., Li, C., Sato, E., Tanemura, K., Wakayama, T., 2013. Latrunculin A treatment prevents abnormal chromosome segregation for successful development of cloned embryos. PLoS One 8, e78380. Tsuji, Y., Kato, Y., Tsunoda, Y., 2009. The developmental potential of mouse somatic cell nuclear-transferred oocytes treated with trichostatin A and 5-aza-2′-deoxycytidine. Zygote 17, 109–115. Vedadi, M., Barsyte-Lovejoy, D., Liu, F., Rival-Gervier, S., Allali-Hassani, A., Labrie, V., Wigle, T.J., DiMaggio, P.A., Wasney, G.A., Siarheyeva, A., 2011. A chemical probe selectively inhibits G9a and GLP methyltransferase activity in cells. Nat. Chem. Biol. 7, 566–574. Wang, F., Kou, Z., Zhang, Y., Gao, S., 2007. Dynamic reprogramming of histone acetylation and methylation in the first cell cycle of cloned mouse embryos. Biol. Reprod. 77, 1007–1016. Wu, X., Li, Y., Xue, L., Wang, L., Yue, Y., Li, K., Bou, S., Li, G.-P., Yu, H., 2011. Multiple histone site epigenetic modifications in nuclear transfer and in vitro fertilized bovine embryos. Zygote 19, 31–45. Wu, S., Ju, G.Q., Du, T., Zhu, Y.J., Liu, G.H., 2013. Microvesicles derived from human umbilical cord Wharton's jelly mesenchymal stem cells attenuate bladder tumor cell growth in vitro and in vivo. PLoS One 8, e61366. Xue, Z., Huang, K., Cai, C., Cai, L., Jiang, C.Y., Feng, Y., Liu, Z., Zeng, Q., Cheng, L., Sun, Y.E., 2013. Genetic programs in human and mouse early embryos revealed by singlecell RNA sequencing. Nature 500, 593–597. Yang, J., Yang, S., Beaujean, N., Niu, Y., He, X., Xie, Y., Tang, X., Wang, L., Zhou, Q., Ji, W., 2007. Epigenetic marks in cloned rhesus monkey embryos: comparison with counterparts produced in vitro. Biol. Reprod. 76, 36–42. Yuan, Y., Wang, Q., Paulk, J., Kubicek, S., Kemp, M.M., Adams, D.J., Shamji, A.F., Wagner, B.K., Schreiber, S.L., 2012. A small-molecule probe of the histone methyltransferase G9a induces cellular senescence in pancreatic adenocarcinoma. ACS Chem. Biol. 7, 1152–1157.
nucleus reprogramming and promote the development of SCNT embryos. 5. Conclusion The present study shows that UNC0638 treatment corrected abnormal H3K9me2 status and increased Oct4 and Nanog expression in goat SCNT embryos. Although the in vitro developmental rate of SCNT embryos was not improved, UNC0638 treatment may has beneficial effects on in vivo development by correcting epigenetic modifications and gene expression. This possibility need to been further investigated. Conflict of interest None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper. Acknowledgements This work was supported by National Natural Science Foundation of China (Grant No. 31302045) and Innovation Project of Science and Technology in Shaanxi Province (NO. 2015KTCQ02-18). References Bortvin, A., Eggan, K., Skaletsky, H., Akutsu, H., Berry, D.L., Yanagimachi, R., Page, D.C., Jaenisch, R., 2003. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 130, 1673–1680. Campbell, K.H., McWhir, J., Ritchie, W., Wilmut, I., 1996. Sheep cloned by nuclear transfer from a cultured cell line. Nature 380, 64–66. Cantone, I., Fisher, A.G., 2013. Epigenetic programming and reprogramming during development. Nat. Struct. Mol. Biol. 20, 282–289. Dai, X., Hao, J., Hou, X.J., Hai, T., Fan, Y., Yu, Y., Jouneau, A., Wang, L., Zhou, Q., 2010. Somatic nucleus reprogramming is significantly improved by m-carboxycinnamic acid bishydroxamide, a histone deacetylase inhibitor. J. Biol. Chem. 285, 31002–31010. Ding, X., Wang, Y., Zhang, D., Wang, Y., Guo, Z., Zhang, Y., 2008. Increased pre-implantation development of cloned bovine embryos treated with 5-aza-2′-deoxycytidine and trichostatin A. Theriogenology 70, 622–630. Epsztejn-Litman, S., Feldman, N., Abu-Remaileh, M., Shufaro, Y., Gerson, A., Ueda, J., Deplus, R., Fuks, F., Shinkai, Y., Cedar, H., 2008. De novo DNA methylation promoted by G9a prevents reprogramming of embryonically silenced genes. Nat. Struct. Mol. Biol. 15, 1176–1183. Feldman, N., Gerson, A., Fang, J., Li, E., Zhang, Y., Shinkai, Y., Cedar, H., Bergman, Y., 2006. G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early embryogenesis. Nat. Cell Biol. 8, 188–194. Fu, L., Zhang, J., Yan, F.X., Guan, H., An, X.R., Hou, J., 2012. Abnormal histone H3K9 dimethylation but normal dimethyltransferase EHMT2 expression in cloned sheep embryos. Theriogenology 78, 1929–1938. Fu, L., Yan, F.X., An, X.R., Hou, J., 2014. Effects of the histone methyltransferase inhibitor UNC0638 on histone H3K9 dimethylation of cultured ovine somatic cells and development of resulting early cloned embryos. Reprod. Domest. Anim. 49, e21–e25. Hayes, O., Ramos, B., Rodriguez, L.L., Aguilar, A., Badia, T., Castro, F.O., 2005. Cell confluency is as efficient as serum starvation for inducing arrest in the G0/G1 phase of the cell cycle in granulosa and fibroblast cells of cattle. Anim. Reprod. Sci. 87, 181–192. Huang, J.J., Zhang, H.Y., Yao, J., Qin, G.S., Wang, F., Wang, X.L., Luo, A.L., Zheng, Q.T., Cao, C.W., Zhao, J.G., 2016a. BIX-01294 increases pig cloning efficiency by improving epigenetic reprogramming of somatic cell nuclei. Reproduction 151, 39–49. Huang, Y., Jiang, X., Yu, M., Huang, R., Yao, J., Li, M., Zheng, F., Yang, X., 2016b. Beneficial effects of diazepin-quinazolin-amine derivative (BIX-01294) on preimplantation development and molecular characteristics of cloned mouse embryos. Reprod. Fertil. Dev. http://dx.doi.org/10.1071/rd15463.
6
Contents lists available at ScienceDirect
Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres
Research Paper
Treatment donor cells with UNC0638 modify the abnormal histone H3K9 dimethylation and gene expression in cloned goat embryos ⁎
Yongsheng Wang, Yijun Zhang, Tingchao Mao, Beifeng Yan, Ruizhi Deng, Biao Wei, Yong Zhang , ⁎ Jun Liu College of Veterinary Medicine, Northwest A & F University, Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Yangling, Shaanxi Province, China
A R T I C L E I N F O
A B S T R A C T
Keywords: SCNT H3K9me2 UNC0638 Key developmental genes Embryonic development Goat
Epigenetic modifications are considered crucial to the reprogramming of somatic cell nuclear transfer (SCNT) embryos and subsequent in vitro development. The abnormal histone H3K9 dimethylation (H3K9me2) status has recently been reported in SCNT embryos. The present study was designed to evaluate the effect of treatment donor cells with UNC0638, a specific inhibitor of H3K9 methyltransferase G9A, on in vitro development, H3K9me2 levels and gene expression in goat SCNT embryos. Different concentration of UNC0638 was applied to treat goat fetal fibroblasts (GFFs), and the treated GFFs were used as donor cells for SCNT. The results showed that 0.2 μM UNC0638 decreased significantly the level of H3K9me2 in treated GFFs (P < 0.05), and did not influence the cell viability (P > 0.05). Compared with intracytoplasmic sperm injection (ICSI) embryos, SCNT embryos derived from untreated GFFs (C-SCNT) presented higher level of H3K9me2 (P < 0.05). Although the in vitro developmental rate was not improved, the abnormal H3K9me2 level was corrected in SCNT embryos from UNC0638-treated GFFs (T-SCNT) compared with C-SCNT embryos. Furthermore, UNC0638 treatment could promote the mRNA expression of key developmental genes Nanog and Oct4 (P < 0.05), but did not affect the imprinted genes H19 and IGF2R expression in goat SCNT embryos (P > 0.05). In conclusion, these results indicated that treatment donor cells with UNC0638 may have beneficial effects in terms of modifying the abnormal H3K9me2 status and gene expression in cloned goat embryos.
1. Introduction Many small molecular inhibitors have been applied to improve development of SCNT embryos by specifically modifying the DNA methylation, histone methylation or histone acetylation status. For example, 5-aza-2′-deoxycytidine and trichostatin A could inhibit DNA methylation and histone deacetylation, respectively (Ding et al., 2008; Tsuji et al., 2009). Inhibiting histone deacetylation could improve development efficiency and blastocyst quality of cloned embryos (Dai et al., 2010; Miyoshi et al., 2010; Su et al., 2011). Correcting the abnormal epigenetic modifications can improve the development of SCNT embryos. The abnormal H3K9me2 status has been observed in cloned embryos of mouse (Wang et al., 2007), cattle (Santos et al., 2003), sheep (Fu et al., 2012) and pig (Huang et al., 2016a). These studies reported that cloned embryos showed higher level of H3K9me2 than IVF embryos at the same development stage. The aberrant reprogramming of histone methylation might be a barrier of the somatic nucleus
reprogramming in cloned embryos (Matoba et al., 2014). In addition, H3K9me2 is associated with gene silencing, including inactivation of Oct4 during differentiation of embryonic stem cells or embryogenesis (Kimura et al., 2004). The Oct4 expression was incompletely activated in blastocyst of SCNT embryos (Bortvin et al., 2003). However, the characteristics of H3K9me2 pattern in cloned goat embryos have not been studied. BIX01294 has been identified as an inhibitor of histone-lysine methyltransferase G9A, and it can selectively reduces H3K9me2 levels (Kubicek et al., 2007). BIX01294 has been successfully used to enhance the generation of induced Pluripotent Stem cells (Shi et al., 2008). It has been reported that treatment with BIX-01294 enhanced the developmental competence of porcine cloned embryos through improving epigenetic reprogramming and gene expression (Huang et al., 2016a). Although treatment with BIX-01294 can not improve the in vitro developmental rate of cloned embryos in sheep and mouse, BIX-01294 could correct abnormal H3K9me2 modification (Fu et al., 2012; Huang et al., 2016b). Recently, UNC0638 was identified as another G9A
⁎
Corresponding author at: College of Veterinary Medicine, Northwest A & F University, Yangling, Shaanxi 712100, China. E-mail addresses: [email protected] (Y. Wang), [email protected] (Y. Zhang), [email protected] (T. Mao), [email protected] (B. Yan), [email protected] (R. Deng), [email protected] (B. Wei), [email protected] (Y. Zhang), [email protected], [email protected] (J. Liu). http://dx.doi.org/10.1016/j.smallrumres.2017.08.011 Received 9 September 2016; Received in revised form 27 July 2017; Accepted 7 August 2017 0921-4488/ © 2017 Published by Elsevier B.V.
Please cite this article as: Wang, Y., Small Ruminant Research (2017), http://dx.doi.org/10.1016/j.smallrumres.2017.08.011
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
previously (Su et al., 2012). The fluorescence intensity is expressed relative to that of 2-cell ICSI embryos or 0 μM UNC0638 treated cells (set as 100%). The experiment was repeated three times and samples without primary antibody were used as a negative control.
inhibitor to reduce H3K9me2 level, and it has been shown to be less toxic than BIX01294 (Vedadi et al., 2011; Fu et al., 2014). In the present study, the effects of treatment donor cells with UNC0638 on in vitro development, H3K9me2 levels and gene expression in cloned goat embryos were investigated.
2.5. Cell cycle analysis 2. Materials and methods Cell cycle analysis was performed by flow cytometry as described in a previous study (Hayes et al., 2005). GFFs treated with 0, 0.2 or 0.5 μM UNC0638, respectively, were incubated for 48 h and then washed with PBS 3 times, then trypsinized, centrifugalized and fixed in 70% precooling ethanol at 4 °C overnight. GFFs were collected and suspended in PBS supplemented with 0.1 mg/mL RNase. The samples were centrifugalized, dyed with 50 μg/mL propidium iodide (PI) containing RNase-free (Beyotime, C1052, Jiangsu, China) for 30 min at 37 °C in dark. The cell cycle were analyzed by a flow cytometer (Beckman Coulter).
2.1. Ethics statements The entire experimental procedure was designed under the consideration of animal welfares and approved by the Animal Care and Use Committee of the College of Veterinary Medicine, Northwest A & F University. 2.2. Nuclear donor cells preparation and UNC0638 treatment Nuclear donor cells were derived from a female Saanen Dairy goat fetus which was 40 days old of pregnancy. The small skin piece was cut and washed three times by phosphate-buffered saline (PBS), and then was minced into 1 mm3 pieces and spread into 60 mm dishes. Then the tissues were cultured in DMEM (Gibco, Grand Island, USA) medium composed of 10% fetal bovine serum (FBS, Gibco), 100 mg/mL streptomycin and 100 IU/mL penicillin. After 1–2 weeks, goat fetal fibroblasts (GFFs) were amplified up to 90% confluence and then were passaged. Based on previous report (Vedadi et al., 2011), UNC0638 was dissolved into various concentrations (0.1, 0.2, 0.5, 1 μM) with dimethyl sulphoxide (DMSO) and then GFFs were treated 48 h for cell viability assays, immunostaining and cell cycle analysis.
2.6. Oocyte collection and in vitro maturation (IVM) The collection and in vitro maturation (IVM) of oocytes was performed as described in our previous study (Liu et al., 2011). Briefly, ovaries were collected separated from the surrounding tissue, and Cumulus-oocyte complexes (COCs) were achieved from ovaries. COCs were washed and cultured for 22–24 h at 38.5 °C in medium TCM199 supplemented with 10% (v/v) FBS, 1 μg/mL 17-estradiol, and 0.075 IU/mL Human Menopausal Gonadotropin (HMG). After 20 h IVM, COCs were transferred into PBS supplemented with 0.1% hyaluronidase to disperse the cumulus cells. Oocytes with a first polar body and evenly granulated ooplasm were selected for ICSI or SCNT.
2.3. Cell viability assay 2.7. Intracytoplasmic sperm injection (ICSI) Cell viability was tested using Cell Counting Kit (CCK-8) (Beyotime, Jiangsu, China) as described in a previous study (Wu et al., 2013). Briefly, GFFs were subcultured into 96-well plates at the same concentrations and treatment with different concentrations of UNC0638. After treatment for 48 h in incubator, 10 μL CCK-8 solutions were added into each well. The plate was kept in incubator for 2 h and then was read using a spectrophotometer (Epoch Biotek, America). The absorbance value (Optical density, OD) was tested at 450 nm wave length. The experiment was repeated 3 times. The percentage of cells viability (%) = (OD treatment group/OD control group) × 100.
Fresh semen was collected by artificial vagina from bucks. The sperm motility was evaluated, and then 200 μL semen were transferred into the bottom of 10 mL sterile tube containing 3 mL Blacket & Oliphant (BO) solution. After 30 min, floated-up sperms were collected and added into a droplet of 10% polyvinilpirrolidone solution for ICSI. The procedure of ICSI was performed according to a previous study (Jiménez-Macedo et al., 2005). Briefly, the sperm tail was broken by the injection pipette, and then a sperm were aspired and injected into the ooplasm. The first body was placed at the 6 or 12 o’clock position while the preferred position of injection was at the 3 o’clock point and sperm was released at 9 o’clock position. Then the ICSI embryos were activated in 5 umol/L ionomycin for 5 min, and then cultures in 200 μL mSOF medium.
2.4. Immunostaining and quantification of fluorescence intensity Immunofluorescence staining was performed as described in our previous study (Su et al., 2011). Both cells and embryos were fixed for 30 min in 4% paraformaldehyde, and then permeabilized for 30 min in 0.1% Triton X-100 in PBS. All following steps were performed at room temperature unless mentioned. Immune Staining Wash Buffer was used for washing the cells and embryos after every step. The samples were blocked in the Immune Staining Blocking Solution (Beyotime, P0102) for 12 h at 4 °C. The samples were stained with H3K9me2 antibodies (Beyotime, AH438) overnight at 4 °C, which was diluted 1:500 in Immune Staining Primary Antibody Dilution Buffer (Beyotime, P0103). After extensive washing, the samples were incubated in Alexa Fluor 488-labeled Goat Anti-Rabbit IgG (Beyotime, A0423; Diluted 1:500). Finally, the samples were stained briefly with 4, 6-diamidino-2-phenylindole (DAPI) (Beyotime, C1005) for 3 min. Embryos were putted in a drop of Antifade Mounting Medium (Beyotime, P0126) on glass slides and covered with glasses. Both cells and embryos were observed under Nikon eclipse Ti-S microscope equipped with a Nikon DS-Ri1 digital camera (Nikon, Tokyo, Japan). All images were captured using the same settings and without any adjustment of constant or brightness. The mean fluorescence intensity of H3K9me2 levels was measured using Image-Pro Plus (Version 6.0; Media Cybernetics) as reported
2.8. Nuclear transfer The nuclear transfer was carried out in accordance with previous study (Liu et al., 2011). Briefly, both the first polar body and metaphase plate were removed and then a round donor cell was injected into the perivitelline space of oocytes. The couplets were fused by electrofusion and incubated for 2–3 h in TCM-199 supplemented with 10% FBS and 7.5 μg/mL cytochalasin B. The reconstructed embryos were activated in 5 μM ionomycin for 5 min and then 2 mM 6-dimethylaminopurine for 4 h. Following activation process, the presumptive embryos were washed extensively and cultured in 200 μL mSOF covered with mineral oil. 2.9. Quantitative real-time PCR (qPCR) The qPCR was performed on StepOne Plus reaction system (ABI, USA) according to a previous study (Su et al., 2012). The embryos RNA isolation and RT reaction was conducted using SuperScript™ III Cells Direct™ cDNA Synthesis System (Life technologies, USA). The cDNA was used for qPCR to quantify the mRNA levels using SYBR Premix 2
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
Table 1 The primers for qPCR. Gene
Primer sequences (5′-3′)
Annealing temperature (°C)
PCR product (bp)
Sequence accession
H2A.Z
F: CTGGCGGTAAGGCTGGGAAG R: GTTGCAAGTGACGAGGGGTAATAC F: GAAGGGCAAACGATCAAGCA R: CAGGGAATGGGACCGAAGA F: TTCCTACCATCAGGGGTGTTT R: GCATTGATTGTTCCAAGGCT F: CGGTGTGATGGAGAGAGCAG R: GAGGGAAGAGCGTGAGTCC F: GGAAACAGCGCTTTGACCTG R: TTCTAAGTCACCCACGGCAC
60
261
XM_013964495.1
60
173
NM_001285569.1
60
184
NM_001285576.1
60
171
EU293410.1
60
194
XM_013966662.1
Oct4 Nanog H19 IGF2R
F: Forward Primer; R: Reverse Primer.
ExTaqTM II (Takara, DaLian, China). Briefly, the primers were synthesized based on goat genome database in NCBI database (Table 1). House keeping gene Histone 2a (H2A) mRNA was set as internal reference gene. The reaction system (20 μL) contains a mixture containing 10 μL SYBR Premix Ex TaqMIX (2×), 0.4 μL ROX Reference Dye (50×), 0.8 μL Forward primer (10 μM), 0.8 μL Reverse primer (10 μM), 2 μL cDNA templates and 6 μL sterile water. The cycling condition was listed as follows: 95 °C, 30 s for 1 cycle; 95 °C, 5 s and 60 °C, 30 s for 40 cycles; melting step for 1 cycle. Transcripts of target genes were quantified in three replicates and calculated relative to the transcription in every sample of H2a. The average expression level of each gene in ICSI embryos was set as 1. 2.10. Statistical analysis All experiments were repeated more than three times. The data were presented as mean ± SEM. Data were analyzed by one-way ANOVA and compared by Tukey-Kramer test using SPSS version 13.0 software (SPSS, Inc., Chicago, IL). Differences were considered significant at P < 0.05. 3. Results 3.1. Effects of UNC0638 treatment on cell viability and global H3K9me2 level of GFFs Considering possible cellular toxicity of UNC0638 on fibroblasts (Vedadi et al., 2011), we tested the cell viability of UNC0638-treated GFFs. Treating GFFs with increasing concentrations of UNC0638, the cell viability decreased gradually in a dose-dependent manner (Fig. 1). The cell viability declined significantly when concentration of UNC0638 increased up to 0.5 μM, but the concentration of 0.2 μM had no obvious influence on cell viability.
Fig. 2. The global H3K9me2 level of GFFs treated with different concentrations of UNC0638. (A) Staining of H3K9me2 (green) in GFFs at passage 4. DNA was counterstained as blue. (B) Relative fluorescence intensity compared to the control group (0 μM) was calculated and showed in different bars. Different superscripts mean significant difference between treated group and control group. Scale bar = 50 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
The global H3K9me2 level was measured by immunofluorescence staining (Fig. 2A). The global H3K9me2 levels in the treated cells were lower than those of control cells (P < 0.05) (Fig. 2B). These results indicated 0.2 μM UNC0638 reduced significantly the global H3K9me2
Fig. 1. The cell viability of GFFs treated with UNC0638. Cell viability was plotted as the absorbance of UNC0638 treated groups relative to untreated ones. The absorbance in untreated cells was assumed 100%. The bar with different superscripts indicates statistically significant difference.
3
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
treatment, the expression levels of Oct4 and Nanog were significantly increased in T-SCNT blastocysts compared to C-SCNT blastocysts (p < 0.05), and had no difference with ICSI blastocysts. There were no significant differences in H19 and IGF2R expression between C-SCNT and T-SCNT blastocysts, but the expression levels of IGF2R was higher in C-SCNT and T-SCNT blastocysts than that in ICSI blastocysts. These results indicated that UNC0638 treatment can promote the expression of key developmental genes Oct4 and Nanog without affecting the imprinted genes H19 and IGF2R in goat SCNT embryos.
Table 2 The cell cycle analysis of UNC0638-treated GFFs. Treatment
G0/G1 (%)
0 μΜ 0.2 μΜ 0.5 μΜ
71.87 ± 0.79 75.04 ± 0.49 82.72 ± 0.10
a b c
G2/M (%)
S (%)
10.66 ± 0.23 a 9.14 ± 0.92 ab 7.47 ± 1.44 b
17.475 ± 1.02 a 15.82 ± 0.40 a 9.82 ± 1.34 b
a,b, c
Values with different superscript within columns are significantly different from each other (P < 0.05).
level without affecting the cell viability of GFFs.
4. Discussion
3.2. UNC0638-induced G0/G1 cell cycle arrest
The present study indicated that the H3K9me2 status of goat SCNT embryos is aberrant reprogrammed. Treatment donor cells with 0.2 μM UNC0638 can correct the abnormal H3K9me2 status and gene expression of cloned goat embryos. However, the in vitro development of SCNT embryos could not be improved. Due to the low cellular toxicity, UNC0638 was used to reduce H3K9me2 level of genome (Yuan et al., 2012). The present study indicated that 0.2 μM UNC0638 significantly decreased the H3K9me2 level of GFFs and had no influence on cell viability. This result is similar to a previous study in sheep (Fu et al., 2014). Furthermore, we found that the proportion of G0/G1 phase cells was significantly increased in treated cells, which was considered beneficial to the development of SCNT embryos (Campbell et al., 1996). These results demonstrated that UNC0638 may be a potential chemical that could be used to modify H3K9me2 status of donor cells for SCNT. The present study indicated that the level of H3K9me2 remained very low from 2-cell to 8-cell stage embryos in goats, coincident with previous study in bovine embryos (Wu et al., 2011). After the whole genome being activated, intensity rose significantly. The regulated H3K9me2 pattern influences the gene regulation, cell cycle, translation and metabolism (Xue et al., 2013) and is correlated with the developmental potential of early embryos (Santos et al., 2003). In this study, we demonstrated that treatment donor cells with UNC0638 could modify the abnormal H3K9me2 status of SCNT embryos compatible to the ICSI embryos in goats. Similarly, previous studies have indicated that UNC0638 and BIX01294 can reduced global H3K9me2 levels in cultured somatic cells or SCNT embryos in sheep, mouse or pig (Fu et al., 2012; Fu et al., 2014; Huang et al., 2016a; Huang et al., 2016b). The H3K9me2 modification is associated with the transcription silencing of genes (Nishioka et al., 2002; Feldman et al., 2006), regulating Oct4 expression in differentiation of embryonic cells (EpsztejnLitman et al., 2008). BIX-01294 combined with Klf4, Sox2 and c-Myc could generate iPS cells (Shi et al., 2008). Down-regulating H3K9me2 level could facilitate the transcription of Oct4 by depressing G9a and promote nuclear reprogramming (Feldman et al., 2006). In addition, it is reported that PGC7 binds to chromatin containing H3K9me2 to protect some imprinted genes loci in zygotes. (Nakamura et al., 2012). The present study indicated that treatment donor cells with UNC0638 could increase the mRNA expression levels of Oct4 and Nanog, but did not affect the imprinted genes in goat SCNT embryos. Despite of in vitro development rate was not improved, UNC0638 could benefit the quality of SCNT embryos based on the H3K9me2 modification and the Oct4 and Nanog expression in goat SCNT embryos.
Flow cytometric analysis was conducted to analyze the cell cycle of UNC0638-treated cells (Table 2). Cells in the G0/G1 cell cycle stage in UNC0638-treated groups were significant higher than that in untreated group (P < 0.05), and the cells in G2/M and S phase decreased in UNC0638-treated groups. This result indicated down-regulating the level of H3K9me2 by UNC0638 induced G0/G1 cell cycle arrest and suppression of cell proliferation. 3.3. Development of goat SCNT embryos To evaluate the effect of down-regulating H3K9me2 levels of donor cells on in vitro development of goat SCNT embryos, we treated GFFs with 0.2 μM UNC0638 for 48 h as treated group (T-SCNT), and 0 μM as control group (C-SCNT). In addition, ICSI embryos were set as the standard group (ICSI). As shown in Table 3, the in vitro developmental rate of SCNT embryos was lower than that of ICSI embryos (P < 0.05). There was no significant difference in developmental rate between CSCNT and T-SCNT embryos. 3.4. Global H3K9me2 level of embryos To examine the effect of UNC0638 treatment on H3K9me2 level of SCNT embryo, we analyzed the dynamic changes of H3K9me2 levels in ICSI, C-SCNT and T-SCNT embryos. As shown in Fig. 3A and 3B, the three groups showed obvious enhancement of H3K9me2 level from 8cell embryos to blastocyst, but maintained low level before 8-cell stage. The H3K9me2 level in C-SCNT embryos exhibits significantly higher than ICSI embryos at the same stage. Treating SCNT embryos (T-SCNT embryos) with UNC0638 decreased H3K9me2 levels compared to control embryos (C-SCNT embryos) (Fig. 3B, P < 0.05). Furthermore, there was no obvious difference in H3K9me2 level between T-SCNT and ICSI embryos. These results showed that the aberrant H3K9me2 status in goat SCNT embryoscan be corrected by treating GFFs donor cells with UNC0638. 3.5. The gene expression levels in blastocysts Relative expression levels of Oct4, Nanog, H19 and IGF2R were analyzed in blastocysts from ICSI, C-SCNT and T-SCNT groups using qPCR (Fig. 4). The expression levels of Oct4 and Nanog in C-SCNT blastocysts were lower than those in ICSI blastocysts. After UNC0638 Table 3 Effect of UNC0638 treatment on the in vitro development of goat SCNT embryos. Treatment ICSI C-SCNT T-SCNT
No. of cultured embryos 83 93 116
No. of cleavages (%) a
72 (87 ± 2.23) 65 (70.53 ± 6.29) b 86 (73.03 ± 6.9) b
No. of ≥4 cell embryos (%) 67 (80.24 ± 4.38) 57 (62.65 ± 9.98) 78 (64.72 ± 10.42)
a, b Values with different superscript within columns are significantly different from each other (P < 0.05). Different stages of in vitro development from cleavage to blastocysts were detected at 48, 72, 120 and 144 h.
4
No. of morulas (%) 32 (39.14 ± 5.26) 23 (25.17 ± 4.75) 32 (26.92 ± 3.23)
No. of blastocysts (%) a b b
19 (23.27 ± 3.45) a 11 (12.03 ± 1.59) b 13(10.93 ± 2.22) b
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
Fig. 3. The H3K9me2 levels in different stages of ICSI, C-SCNT, T-SCNT embryos. (A) H3K9me2 staining of three groups of embryos from 2-cell stage to blastocyst (green). Each group was stained with DAPI to exhibit DNA (Blue). (B) The fluorescence intensity of H3K9me2 was calculated relative to DNA intensity in each group. Labeling intensity of all embryos was presented relative to that of 2-cell stage of ICSI embryos (assumed as 100%). Different superscripts mean significant difference (P < 0.05). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
In this study, treating donor cells with UNC0638 had no effect on in vitro development of goat SCNT embryos, similarly to the report in sheep (Fu et al., 2014). In previous study, BIX01294 was used to treat reconstructed embryos directly, and the in vitro development rate was not improved (Fu et al., 2012; Terashita et al., 2013). However, the beneficial effect of BIX-01294 treatment on cloned embryos has been observed in terms of correcting abnormal H3K9me2 modification and the gene expression (Huang et al., 2016a; Huang et al., 2016b). The developmental competence of porcine SCNT embryos was significantly enhanced both in vitro and in vivo after 50 μM BIX-01294 treatments (Huang et al., 2016a). Consequently, the effect of BIX-01294 treatment on in vivo development of cloned embryos need be further investigated. Additionally, it is required to undergo delicate epigenetic modifications for successful development of embryos (Cantone and Fisher, 2013). Previous studies show SCNT embryos endure low acetylation on H3k9, high DNA methylation and low H3K4 dimethylation (Yang et al., 2007; Ding et al., 2008; Shao et al., 2008). Combination of UNC0638 treatment and other regulators of epigenetic modifications may facilitate the
Fig. 4. The relative mRNA expression of pluripotency genes Oct4 and Nanog, imprinted gene H19 and IGF2R in ICSI, C-SCNT and T-SCNT blastocysts. The data of ICSI group was set as 1 and different superscripts mean significant difference (P < 0.05).
5
Small Ruminant Research xxx (xxxx) xxx–xxx
Y. Wang et al.
Jiménez-Macedo, A.-R., Izquierdo, D., Anguita, B., Paramio, M.-T., 2005. Comparison between intracytoplasmic sperm injection and in vitro fertilisation employing oocytes derived from prepubertal goats. Theriogenology 64, 1249–1262. Kimura, H., Tada, M., Nakatsuji, N., Tada, T., 2004. Histone code modifications on pluripotential nuclei of reprogrammed somatic cells. Mol. Cell. Biol. 24, 5710–5720. Kubicek, S., O'Sullivan, R.J., August, E.M., Hickey, E.R., Zhan, Q., Teodoro, M.L., Rea, S., Mechtler, K., Kowalski, J.A., Homon, C.A., Kelly, T.A., Jenuwein, T., 2007. Reversal of H3K9me2 by a small-molecule inhibitor for the G9a histone methyltransferase. Mol. cell 25, 473–481. Liu, J., Li, L., Du, S., Bai, X., Zhang, H., Tang, S., Zhao, M., Ma, B., Quan, F., Zhao, X., Zhang, Y., 2011. Effects of interval between fusion and activation, cytochalasin B treatment, and number of transferred embryos, on cloning efficiency in goats. Theriogenology 76, 1076–1083. Matoba, S., Liu, Y., Lu, F., Iwabuchi, K.A., Shen, L., Inoue, A., Zhang, Y., 2014. Embryonic development following somatic cell nuclear transfer impeded by persisting histone methylation. Cell 159, 884–895. Miyoshi, K., Mori, H., Mizobe, Y., Akasaka, E., Ozawa, A., Yoshida, M., Sato, M., 2010. Valproic acid enhances in vitro development and Oct-3/4 expression of miniature pig somatic cell nuclear transfer embryos. Cell. Reprog. (Formerly Cloning Stem Cells) 12, 67–74. Nakamura, T., Liu, Y.J., Nakashima, H., Umehara, H., Inoue, K., Matoba, S., Tachibana, M., Ogura, A., Shinkai, Y., Nakano, T., 2012. PGC7 binds histone H3K9me2 to protect against conversion of 5mC to 5hmC in early embryos. Nature 486, 415–419. Nishioka, K., Chuikov, S., Sarma, K., Erdjument-Bromage, H., Allis, C.D., Tempst, P., Reinberg, D., 2002. Set9, a novel histone H3 methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation. Gene Dev. 16, 479–489. Santos, F., Zakhartchenko, V., Stojkovic, M., Peters, A., Jenuwein, T., Wolf, E., Reik, W., Dean, W., 2003. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr. Biol. 13, 1116–1121. Shao, G.B., Ding, H.M., Gong, A.H., Xiao, D.S., 2008. Inheritance of histone H3 methylation in reprogramming of somatic nuclei following nuclear transfer. J. Reprod. Devel. 54, 233–238. Shi, Y., Tae Do, J., Desponts, C., Hahm, H.S., Schöler, H.R., Ding, S., 2008. A combined chemical and genetic approach for the generation of induced pluripotent stem cells. Cell Stem Cell 2, 525–528. Su, J., Wang, Y., Li, Y., Li, R., Li, Q., Wu, Y., Quan, F., Liu, J., Guo, Z., Zhang, Y., 2011. Oxamflatin significantly improves nuclear reprogramming, blastocyst quality, and in vitro development of bovine SCNT embryos. PLoS One 6, e23805. Su, J., Wang, Y., Li, R., Peng, H., Hua, S., Li, Q., Quan, F., Guo, Z., Zhang, Y., 2012. Oocytes selected using BCB staining enhance nuclear reprogramming and the in vivo development of SCNT embryos in cattle. PLoS One 7, e36181. Terashita, Y., Yamagata, K., Tokoro, M., Itoi, F., Wakayama, S., Li, C., Sato, E., Tanemura, K., Wakayama, T., 2013. Latrunculin A treatment prevents abnormal chromosome segregation for successful development of cloned embryos. PLoS One 8, e78380. Tsuji, Y., Kato, Y., Tsunoda, Y., 2009. The developmental potential of mouse somatic cell nuclear-transferred oocytes treated with trichostatin A and 5-aza-2′-deoxycytidine. Zygote 17, 109–115. Vedadi, M., Barsyte-Lovejoy, D., Liu, F., Rival-Gervier, S., Allali-Hassani, A., Labrie, V., Wigle, T.J., DiMaggio, P.A., Wasney, G.A., Siarheyeva, A., 2011. A chemical probe selectively inhibits G9a and GLP methyltransferase activity in cells. Nat. Chem. Biol. 7, 566–574. Wang, F., Kou, Z., Zhang, Y., Gao, S., 2007. Dynamic reprogramming of histone acetylation and methylation in the first cell cycle of cloned mouse embryos. Biol. Reprod. 77, 1007–1016. Wu, X., Li, Y., Xue, L., Wang, L., Yue, Y., Li, K., Bou, S., Li, G.-P., Yu, H., 2011. Multiple histone site epigenetic modifications in nuclear transfer and in vitro fertilized bovine embryos. Zygote 19, 31–45. Wu, S., Ju, G.Q., Du, T., Zhu, Y.J., Liu, G.H., 2013. Microvesicles derived from human umbilical cord Wharton's jelly mesenchymal stem cells attenuate bladder tumor cell growth in vitro and in vivo. PLoS One 8, e61366. Xue, Z., Huang, K., Cai, C., Cai, L., Jiang, C.Y., Feng, Y., Liu, Z., Zeng, Q., Cheng, L., Sun, Y.E., 2013. Genetic programs in human and mouse early embryos revealed by singlecell RNA sequencing. Nature 500, 593–597. Yang, J., Yang, S., Beaujean, N., Niu, Y., He, X., Xie, Y., Tang, X., Wang, L., Zhou, Q., Ji, W., 2007. Epigenetic marks in cloned rhesus monkey embryos: comparison with counterparts produced in vitro. Biol. Reprod. 76, 36–42. Yuan, Y., Wang, Q., Paulk, J., Kubicek, S., Kemp, M.M., Adams, D.J., Shamji, A.F., Wagner, B.K., Schreiber, S.L., 2012. A small-molecule probe of the histone methyltransferase G9a induces cellular senescence in pancreatic adenocarcinoma. ACS Chem. Biol. 7, 1152–1157.
nucleus reprogramming and promote the development of SCNT embryos. 5. Conclusion The present study shows that UNC0638 treatment corrected abnormal H3K9me2 status and increased Oct4 and Nanog expression in goat SCNT embryos. Although the in vitro developmental rate of SCNT embryos was not improved, UNC0638 treatment may has beneficial effects on in vivo development by correcting epigenetic modifications and gene expression. This possibility need to been further investigated. Conflict of interest None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper. Acknowledgements This work was supported by National Natural Science Foundation of China (Grant No. 31302045) and Innovation Project of Science and Technology in Shaanxi Province (NO. 2015KTCQ02-18). References Bortvin, A., Eggan, K., Skaletsky, H., Akutsu, H., Berry, D.L., Yanagimachi, R., Page, D.C., Jaenisch, R., 2003. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 130, 1673–1680. Campbell, K.H., McWhir, J., Ritchie, W., Wilmut, I., 1996. Sheep cloned by nuclear transfer from a cultured cell line. Nature 380, 64–66. Cantone, I., Fisher, A.G., 2013. Epigenetic programming and reprogramming during development. Nat. Struct. Mol. Biol. 20, 282–289. Dai, X., Hao, J., Hou, X.J., Hai, T., Fan, Y., Yu, Y., Jouneau, A., Wang, L., Zhou, Q., 2010. Somatic nucleus reprogramming is significantly improved by m-carboxycinnamic acid bishydroxamide, a histone deacetylase inhibitor. J. Biol. Chem. 285, 31002–31010. Ding, X., Wang, Y., Zhang, D., Wang, Y., Guo, Z., Zhang, Y., 2008. Increased pre-implantation development of cloned bovine embryos treated with 5-aza-2′-deoxycytidine and trichostatin A. Theriogenology 70, 622–630. Epsztejn-Litman, S., Feldman, N., Abu-Remaileh, M., Shufaro, Y., Gerson, A., Ueda, J., Deplus, R., Fuks, F., Shinkai, Y., Cedar, H., 2008. De novo DNA methylation promoted by G9a prevents reprogramming of embryonically silenced genes. Nat. Struct. Mol. Biol. 15, 1176–1183. Feldman, N., Gerson, A., Fang, J., Li, E., Zhang, Y., Shinkai, Y., Cedar, H., Bergman, Y., 2006. G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early embryogenesis. Nat. Cell Biol. 8, 188–194. Fu, L., Zhang, J., Yan, F.X., Guan, H., An, X.R., Hou, J., 2012. Abnormal histone H3K9 dimethylation but normal dimethyltransferase EHMT2 expression in cloned sheep embryos. Theriogenology 78, 1929–1938. Fu, L., Yan, F.X., An, X.R., Hou, J., 2014. Effects of the histone methyltransferase inhibitor UNC0638 on histone H3K9 dimethylation of cultured ovine somatic cells and development of resulting early cloned embryos. Reprod. Domest. Anim. 49, e21–e25. Hayes, O., Ramos, B., Rodriguez, L.L., Aguilar, A., Badia, T., Castro, F.O., 2005. Cell confluency is as efficient as serum starvation for inducing arrest in the G0/G1 phase of the cell cycle in granulosa and fibroblast cells of cattle. Anim. Reprod. Sci. 87, 181–192. Huang, J.J., Zhang, H.Y., Yao, J., Qin, G.S., Wang, F., Wang, X.L., Luo, A.L., Zheng, Q.T., Cao, C.W., Zhao, J.G., 2016a. BIX-01294 increases pig cloning efficiency by improving epigenetic reprogramming of somatic cell nuclei. Reproduction 151, 39–49. Huang, Y., Jiang, X., Yu, M., Huang, R., Yao, J., Li, M., Zheng, F., Yang, X., 2016b. Beneficial effects of diazepin-quinazolin-amine derivative (BIX-01294) on preimplantation development and molecular characteristics of cloned mouse embryos. Reprod. Fertil. Dev. http://dx.doi.org/10.1071/rd15463.
6