- Email: [email protected]
TREK-1 pathway mediates isoflurane-induced memory impairment in middle-aged mice
Neurobiology of Learning and Memory 145 (2017) 199–204
Contents lists available at ScienceDirect
Neurobiology of Learning and Memory journal homepage: www.elsevier.com/locate/ynlme
Short communication
TREK-1 pathway mediates isoflurane-induced memory impairment in middle-aged mice ⁎
Yanhui Caia,1, Zhengwu Pengb,1, Haiyun Guoa, Feng Wanga, , Yi Zenga, a b
MARK
⁎
Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China Department of Psychiatry, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Isoflurane Post-operative cognitive dysfunction Middle-aged mice TREK-1
Post-operative cognitive dysfunction (POCD) has been widely reported, especially in elderly patients. An association between POCD and inhalational anesthetics, such as isoflurane, has been suggested. The TWIK-related K+ channel-1 (TREK-1) controls several major cellular responses involved in memory formation and is believed to participate in the development of depression, cerebral ischemia and blood-brain barrier dysfunction. However, the specific role of TREK-1 in mediating anesthesia-induced POCD remains unknown. In the current study, we determined that exposure to isoflurane affected memory in middle-aged mice and altered TREK-1 expression. In addition, TREK-1 over-expression exacerbated isoflurane-induced memory impairment, while TREK-1 silence attenuated the impairment. Taken together, our data demonstrate that inhibition of TREK-1 protects mice from cognitive impairment induced by anesthesia and TREK-1 is a potential therapeutic target against memory impairment induced by volatile anesthetics.
1. Introduction It is estimated that more than 200 million people worldwide undergo surgery annually (Marie, Dadure, Seguret, & Capdevila, 2015). The majority of these operations are performed under general anesthesia, and nearly 80% of these cases use volatile anesthetics, such as isoflurane, due to their superior features (Marie et al., 2015). Previous studies that conduct neuropsychological testing prior to hospital discharge after cardiac surgery have reported post-operative cognitive dysfunction (POCD) in 14–48% of patients (Sun, Lindsay, Monsein, Hill, & Corso, 2012). This cognitive impairment persists for 6 weeks in at least 30% of patients and for up to 6 months in 25% of patients (Sun et al., 2012). The incidence of POCD is greater in the elderly, in whom it is associated with poor outcome and increased mortality after surgery (Callaway, Jones, Royse, & Royse, 2015; Knipp et al., 2008). POCD remains a significant concern because it affects quality of life and significantly impacts health economics (Newman et al., 2006). With the exception of advanced age, which is a well-established risk factor for POCD, general anesthesia, obesity and gender may all play a role in mediating POCD (Feinkohl, Winterer, & Pischon, 2016; Lee, Chan, Kraeva, Peterson, & Sall, 2014). Although whether general anesthesia induces POCD remains unclear, both in vitro and experimental animal studies have suggested that volatile anesthetics contribute to the
⁎
1
development of POCD (Lin et al., 2012; Lin & Zuo, 2011; Zurek, Bridgwater, & Orser, 2012). So it is imperative to confirm whether or not general anesthesia causes memory damage. Providing that volatile anesthesia could induce memory impairment in middle-aged mice, we investigated several proteins’ changes which were seldom reported before in POCD. Recently, several groups observe that the TWIK-related potassium channel-1 (TREK-1), mature brainderived neurotrophic factor (mBDNF), excitatory amino acid transporter 2 (EAAT2) and microtubule-associated cytoskeleton protein doublecortin (DCX) (Allen, Purves-Tyson, Fung, & Shannon Weickert, 2015; Chawana et al., 2014; Wei et al., 2015) take part in the formation of memory. A previous study has shown that injection of mBDNF into neocortex strengthens a taste aversion memory in adult rats (MartinezMoreno, Rodriguez-Duran, & Escobar, 2016). Another study shows that over-expression of EAAT2 with the ceftriaxone damages long-term depression in rats (Omrani et al., 2009). Among these potential therapeutic targets, we focus on the TREK-1 for two reasons. Firstly, TREK-1 is activated by volatile anesthetics and already implicated as a possible target of the effects of those anesthetics (Franks & Honore, 2004; Patel et al., 1999). Secondly, except for its unique function in anesthesia, several studies have reported that the TREK family might be involved in processes associated with memory impairment (de la Pena et al., 2012; Huang & Yu, 2008). In particular, the mRNA level of TREK-1 and TREK-
Corresponding authors at: Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China. E-mail addresses: [email protected] (F. Wang), [email protected] (Y. Zeng). Yanhui Cai and Zhengwu Peng contributed equally to this research.
http://dx.doi.org/10.1016/j.nlm.2017.10.012 Received 30 November 2016; Received in revised form 14 April 2017; Accepted 13 October 2017 Available online 16 October 2017 1074-7427/ © 2017 Elsevier Inc. All rights reserved.
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
TREK-1 (1:200, Abcam, ab90855, Cambridge, MA); rabbit monoclonal antibody to β-actin (1:1000, Abcam, ab190476); rabbit polyclonal antibody to EAAT2 (1:500, Cell Signaling Technology, 3838, Massachusetts, USA); rabbit monoclonal antibody to mBDNF (1:2500, Abcam, ab108319); or rabbit polyclonal antibody to DCX (1:500, Cell Signaling Technology, 4604) at 4 °C for 12 h. After being washed three times, the membranes were cultured in goat anti-rabbit secondary antibody (1:10000, Abcam, ab6721) for 2 h. The membranes were washed again, and bands were detected by a chemiluminescent horseradish peroxidase substrate (Millipore, Bedford, MA). The signal of band intensity was analyzed with Quantity One software 5.0 (Bio-Rad, La Jolla, CA).
2 increases (de la Pena et al., 2012), and inhibition of TREK-2 decreases the memory impairment in Alzheimer’s disease of rats (de la Pena et al., 2012). Based on these studies, we hypothesized that TREK-1 played a key role in the memory impairment induced by isoflurane anesthesia. Our study confirmed volatile anesthesia caused memory impairment in middle-aged mice. Interestingly, we observed that the level of TREK1 and EAAT2 was increased in memory impairment that was induced by isoflurane anesthesia. And the concentrations of mBDNF and DCX were decreased. Furthermore, we found that TREK-1 channels acted as an important role in the onset of memory impairment caused by isoflurane. 2. Materials and methods
2.4. Quantitative reverse transcription polymerase chain reaction (qRTPCR)
2.1. Animals All experiments in vivo were performed in accordance with the National Guidelines for the Care and Use of Laboratory Animals and were approved by the Experimental Animal Welfare Committee of the Fourth Military Medical University. Male 8-month-old C57BL/6J mice were bought from the Fourth Military Medical University's Experimental Animal Center. Mice were housed in groups of four in standard breeding cages and housed at 20–25 °C with 60% relative humidity under controlled conditions (12 h light/dark cycle, light-dark: 08:00–20:00 h) with ad libitum access to water and food. The core temperature was maintained, and pH and oxygen levels were normal at the end of the anesthetic treatment. Behavioral test was performed by investigators who were blinded with respect to the individual animal groups.
The mice were decapitated and the total RNA in the hippocampus was extracted with RNA extraction kit (TaKaRa, Otsu, Japan) one day after exposure to isoflurane. The same amounts of total RNA of hippocampus were reverse transcribed using PrimeScript RT Master Mix (TaKaRa) under standard conditions. Following reverse transcription, qRT-PCR reactions were performed with SYBR Premix Ex Taq (TaKaRa). The forward and reverse primer sequences included the following: TREK-1 (TCTGGTGGGCTTGTGGTTC/AGGGGAGGGGATAGGTGAGA) and GAPDH (AAATGGTGAAGGTCGGTGTGAAC/CAACAATCTCCACTTTGCCACTG). GAPDH was adopted as an internal control.
2.5. Over-expression and interference with TREK-1 in vivo
2.2. Morris water maze
The adeno-associated viruses (AAV) contained TREK1-Vector, SiRNAs-Vector against TREK1 and the homologous control vector were purchased from Invitrogen. The in vivo experiments of gene over-expression and silencing were performed using a micromanipulation system (Narishige, Tokyo, Japan), and the procedures of microinjection were performed according to described methods (McMurray, Du, Brownlee, & Palmer, 2016). In short, AAV were placed in a 50 μl HEPES-supplemented M2 medium under paraffin oil at a multiplicity of infection of 200. The viruses were injected into the ventricular system using pneumatic pressure with a picoliter injector (Greenvale, NY, USA). The volume was approximate 2 μl for each virus. Three weeks later, the level of TREK-1 was determined by immunofluorescence staining.
A conventional Morris Water Maze (MWM) test was carried out to analyze reference and learning memory (n = 8/group). The MWM apparatus contained a white-colored pool (51 cm in height and 122 cm in diameter) and was placed in an independent room. The pool was filled with 20–22 °C water to a depth of 40 cm and could be divided into four quadrants. Four locations around the tank's edge were defined N, S, E, and W, which provided four available start positions. The locations divided the tank into four quadrants: NE, SE, SW, and NW. In the center of one of the quadrants, which was defined as the target quadrant, a hidden escape platform (10 cm in diameter) was placed. The position of the hidden platform was changed every day according to the following pattern: SE, NW, NE, SW, SE, and NW (repeated twice). The mice failing to locate the hidden platform within 60 s were placed on the platform manually after being released into the water. Individual trials were 60 s in length, and the interval between trials was 15 s. During training, the mice received four trials every day from the four principal start locations and were tested over a 3-day period. A probe test in which the platform was hidden was used to analyze spatial memory. The mice were released from novel start positions at 30 s intervals. At last, the trials were recorded and analyzed using an automated analysis system (Dig-Behav, Jiliang Co., Ltd., Shanghai, China).
2.6. Immunofluorescence staining The hippocampus was fixed with 4% paraformaldehyde and cut into 12 μm sagittal sections. After they were sectioned, the slices were immersed in 0.25% H2O2 in methanol for 20 min and then incubated with 12% goat serum for 15 min. The slices were probed with anti-TREK-1 rabbit polyclonal antibody (1:200, Alomone Labs, APC-047, Jerusalem, Israel) in 1% bovine serum albumin-PBS at 4 °C for 12 h in a humidified box. The slices were then incubated with an Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody (1:500, Thermo Fisher Scientific, A-11008) for 1 h. Fluorescence images were obtained with a confocal laser microscope (Olympus, Japan), and FluoView 1000 (Olympus) were used to capture pictures.
2.3. Western blot analysis One day after isoflurane anesthesia, the animals were decapitated and the hippocampus brain tissues were lysed in extraction buffer (Thermo Fisher Scientific, Shanghai, China) containing a complete protease inhibitor (1%, Thermo Fisher Scientific). The concentration of proteins was detected by BCA protein assay kit (Thermo Fisher Scientific). The same amount of protein got separated on sodium dodecyl sulfate polyacrylamide gels and was transferred to 0.22 μm polyvinylidene fluoride membranes (Millipore, Bedford, MA) for 2 h, and blocked with skimmed milk (5%). The membranes were incubated with the appropriate primary antibodies: rabbit polyclonal antibody to
2.7. Statistical analysis The results were reported as the mean ± SD. One way analysis of variance (ANOVA) followed by Bonferroni's Multiple Comparison Test was used for data’s statistical analysis with Prism 5 (GraphPad Software). The level of statistical significance was p < .05. 200
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
Fig. 1. The occurrence of memory dysfunction at 24 h after isoflurane anesthesia in middle-aged mice. (A) Shows the experimental protocols for behavioral training and evaluation. (B) Shows the typical trajectory of behavior during the morris water maze (MWM) test for the various groups. (C) and (D) show the swimming speed and swimming distance for the various groups. (E) shows the relative dwell time in the target quadrant of the MWM for the various groups. * p < .05.
3. Results
increased (F(3, 16) = 64.55, one way ANOVA, p < .0001) (Fig. 2A). Levels of the glutamate transporter EAAT2 were also increased following exposure to increasing doses of isoflurane (F(3, 16) = 33.11, one way ANOVA, p < .0001) (Fig. 2B). What’s more, the levels of the neurotrophin mBDNF were decreased (F(3, 16) = 8.235, one way ANOVA, p = .0015) (Fig. 2C). And DCX was also decreased following exposure to increasing doses of isoflurane (F(3, 16) = 29.10, one way ANOVA, p < .0001) (Fig. 2D). As mentioned above, we were interested in TREK-1’s role in memory damage induced by isoflurane anesthesia. Next we confirmed, by qRT-PCR, that the mRNA level of TREK-1 was dose- and time-dependent following isoflurane exposure. In accordance with Western blot analysis, Fig. 2E (F(3, 16) = 6.918, one way ANOVA, p = .0034) and Fig. 2F (F(3, 16) = 17.51, one way ANOVA, p < .0001) showed that the mRNA amount was increased with increasing isoflurane doses (0.5, 1.0 and 1.5 Mac) and exposure times (0.5, 1.0 and 1.5 h).
3.1. Isoflurane anesthesia induced memory impairment in middle-aged mice The behavioral testing protocols were shown in Fig. 1A. Briefly, the mice received behavioral training in the MWM for three times (once a day for 3 days). Mice were exposed to isoflurane anesthesia one day later, and were then evaluated for learning and memory on day 1 and 7 post-anesthesia. The core temperature was maintained, and the pH and CO2 were normal after anesthesia. A representative trajectory of behavior in the MWM test, one day after anesthesia, was shown in Fig. 1B. The relative dwell time of animals treated with 1.5 Mac or 1.0 Mac isoflurane significantly differed from the relative dwell time in the sham group (F(3, 27) = 6.547, oneway ANOVA, p = .0018) (Fig. 1E). No significant differences in swimming speed or swimming distance were observed between the four experimental groups, suggesting that the observed differences in dwell time were not caused by any associated motor dysfunctions (Fig. 1C and D). Furthermore, the relative dwell time in the target quadrant was decreased at day 7 with the increasing doses of isoflurane exposure (F(3, 27) = 3.194, one way ANOVA, p = .0387) (Fig. S1). However, the memory impairment at day 7 was not as significant as at 24 h after isoflurane anesthesia in middle-aged mice. Therefore, we investigated the underlying mechanism in isoflurane-induced memory deficits at 24 h.
3.3. TREK-1 significantly influenced the isoflurane-induced memory damage An important role of the potassium channel TREK-1 has been demonstrated in isoflurane-induced anesthesia previously (Franks & Honore, 2004). In the present study, we succeeded in creating in vivo models of TREK-1 suppression and over-expression via ventricular microinjection of appropriate AAV, and Fig. 3A showed the expression of TREK-1 in hippocampus in different groups by immunofluorescence staining. Briefly, the mice received ventricular microinjection three weeks before behavior training, then according to the protocol in Fig. 1A, the test evaluated for learning and memory was performed on day 1 post-anesthesia. Fig. 3B presented the typical trajectory of behavior in the MWM on day 1 postanesthesia for the two different in vivo models. Using a 1.0 Mac concentration of isoflurane, we observed that TREK-1 over-expression exacerbated the memory loss compared with vector infection. When TREK-1 expression was suppressed, the memory deficits were attenuated
3.2. The level of targeted proteins underlying isoflurane-induced memory deficits 24 h after isoflurane anesthesia, the animals were decapitated and the homologous protein levels in hippocampus were analyzed by Western blot. First, compared with the levels of the potassium channel TREK-1 in the sham group, the expression of TREK-1 in the animals that received increasing doses of isoflurane (0.5, 1.0 and 1.5 Mac) was 201
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
Fig. 2. The molecular changes that occurred after isoflurane-induced memory impairment. Western blotting (A, B, C and D) was used to analyze differences among the groups. The relative optical density was calculated by dividing the intensity of the targeted band by that of the homologous β-actin band. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was used to calculate the relative amounts of TREK-1 in hippocampus (E and F). The dose of isoflurane was 1.0 Mac over the different durations of anesthetic exposure. *p < .05, **p < .01.
halothane and isoflurane (Patel et al., 1998). However, other functionally or structurally distinct potassium channels, such as TRAAK channels (Patel et al., 1999), are insensitive to anesthetics. Thus, we speculate that TREK-1 participates in the formation of memory deficits induced by the exposure to isoflurane. We demonstrated the function of TREK-1 in the whole brain by using in vivo TREK-1 silence and overexpression models. Because TREK-1 is a good target for antidepressants (Mazella et al., 2010), it will be interesting to investigate whether isoflurane induces depressive-like behaviors via activation of the TREK1 pathway. To our knowledge, there have not been explicit reports about anesthesia-induced depression, except for ketamine’s antidepressant effects mediated mainly by inhibition of NMDA receptors (Zanos et al., 2016). We cannot conclude that isoflurane induces depressive-like behaviors because mouse depressive behaviors were not detected after isoflurane exposure in our study. It cannot be ignored that the memory impairment at 24 h after
compared to these observed in the vector group (F(3, 32) = 12.52, one way ANOVA, p < .0001) (Fig. 3E). The suppression or over-expression of TREK-1 failed to affect swimming speed and swimming distance in the MWM (Fig. 3C and D). Taken together, these findings imply that TREK-1 plays a key function in the cognitive dysfunction that is induced by exposure to isoflurane. 4. Discussion TREK-1 can be found throughout the central nervous system (Honore, 2007) and this potassium channel subtype plays a key role in brain function; its abnormal changes are associated with affective disorders, such as depression (Mazella et al., 2010). In addition to physical alteration of the cellular membrane, intracellular acidification, and lysophospholipids, TREK-1 channels in transfected mammalian cells are also activated by various volatile anesthetics such as sevoflurane, 202
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
Fig. 3. The effect of TREK-1 on the isoflurane-induced memory impairment. (A) Verification of TREK-1 over-expression and under-expression model by immunofluorescence. (B) Represents the typical trajectory of behavior in the MWM in TREK-1 over-expressing and underexpressing mice. (C) and (D) show the swimming speed and swimming distance in the two models. (E) Shows the relative dwell time in the target quadrant of the MWM in the two models. The dose of isoflurane was 1.0 Mac in all groups. Scale bar = 200 μm, *p < .05.
induced memory impairment via EAAT2 or mBDNF needs further study. In conclusion, our study demonstrates that isoflurane anesthesia induces cognitive impairment in middle-aged mice and suggests that TREK-1 acts as a key role in the cognitive deficits induced by exposure to isoflurane. Further investigation is required to reveal the mechanism of TREK-1’s role in memory impairment induced by isoflurane anesthesia. Given its pivotal role, TREK-1 remains a potential therapeutic target for restoring memory function and improving cognitive deficits associated with exposure to general anesthesia.
isoflurane exposure might simply be the effects of the presence of residual anesthetic, considering that 99.9% elimination of isoflurane in brain is achieved at 71 h after anesthesia in clinical settings (Lockwood, 2010). On the contrary, the residual concentrations of isoflurane in brain are at trace levels in C57BL6/J mice, which are 0.034 ± 0.012% at 1 h and 0.0095 ± 0.0006% at 24 h after anesthesia (Saab et al., 2010). Furthermore, isoflurane concentrations as high as 0.6% are required to impair the freezing response when administered during contextual fear learning (Rau, Oh, Laster, Eger, & Fanselow, 2009), and the threshold concentrations of isoflurane were 0.2% that of impaired memory performance in rats during fear conditioning (Alkire & Gorski, 2004). Isoflurane concentrations measured at 24 h after anesthesia were a magnitude lower than those shown to impair memory directly. We infer the contradictory results of previous studies are mainly due to the pharmacokinetic differences between humans and rodents (Terpstra, 2001). In our study, we observed that inhibition of TREK-1 reduced the memory impairment induced by isoflurane anesthesia. However, due to a paucity of information on this topic, the cellular mechanisms underlying the effects of TREK-1 on isoflurane-induced memory damage warrant further exploration. Previous studies have given us a clue that TREK-1 differentially influences the expression of EAAT2 and mBDNF. Electrogenic astrocytic transporters such as EAAT2 depend on K+ channels and the hyperpolarized membrane potential (Wu et al., 2013). Moreover, TREK-1 has been shown to mediate both fast and slow glutamate release in astrocytes via G protein-coupled receptor activation, which affects the synthesis of EAAT2 (Woo et al., 2012). Other research has pointed out that the over-expression of TREK-1 affects neuroprotective factors, including mBDNF, during pathologic conditions such as ischemia (Heurteaux et al., 2004; Woo et al., 2012). TREK-1 inhibition enhances cytoplasmic synthesis of mBDNF in astrocytes (Lu et al., 2014). Whether TREK-1 takes part in the formation of isoflurane-
Acknowledgments This research was supported by funds from the National Natural Science Foundation in China (Grant No. 81371510). Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed by authors. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.nlm.2017.10.012. References Alkire, M. T., & Gorski, L. A. (2004). Relative amnesic potency of five inhalational anesthetics follows the Meyer-Overton rule. Anesthesiology, 101, 417–429. Allen, K. M., Purves-Tyson, T. D., Fung, S. J., & Shannon Weickert, C. (2015). The effect of adolescent testosterone on hippocampal BDNF and TrkB mRNA expression: Relationship with cell proliferation. BMC Neuroscience, 16, 4. Callaway, J. K., Jones, N. C., Royse, A. G., & Royse, C. F. (2015). Memory impairment in rats after desflurane anesthesia is age and dose dependent. Journal of Alzheimer's Disease: JAD, 44, 995–1005.
203
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
new concept in the antidepressant drug design. PLoS Biology, 8, e1000355. McMurray, K. M., Du, X., Brownlee, M., & Palmer, A. A. (2016). Neuronal overexpression of Glo1 or amygdalar microinjection of methylglyoxal is sufficient to regulate anxiety-like behavior in mice. Behavioural Brain Research, 301, 119–123. Newman, M. F., Mathew, J. P., Grocott, H. P., Mackensen, G. B., Monk, T., Welsh-Bohmer, K. A., ..., & Mark, D. B. (2006). Central nervous system injury associated with cardiac surgery. Lancet (London, England), 368, 694–703. Omrani, A., Melone, M., Bellesi, M., Safiulina, V., Aida, T., Tanaka, K., ... Conti, F. (2009). Up-regulation of GLT-1 severely impairs LTD at mossy fibre–CA3 synapses. The Journal of Physiology, 587, 4575–4588. Patel, A. J., Honore, E., Lesage, F., Fink, M., Romey, G., & Lazdunski, M. (1999). Inhalational anesthetics activate two-pore-domain background K+ channels. Nature Neuroscience, 2, 422–426. Patel, A. J., Honore, E., Maingret, F., Lesage, F., Fink, M., Duprat, F., & Lazdunski, M. (1998). A mammalian two pore domain mechano-gated S-like K+ channel. The EMBO Journal, 17, 4283–4290. Rau, V., Oh, I., Laster, M., Eger, E. I., 2nd, & Fanselow, M. S. (2009). Isoflurane suppresses stress-enhanced fear learning in a rodent model of post-traumatic stress disorder. Anesthesiology, 110, 487–495. Saab, B. J., Maclean, A. J., Kanisek, M., Zurek, A. A., Martin, L. J., Roder, J. C., & Orser, B. A. (2010). Short-term memory impairment after isoflurane in mice is prevented by the alpha5 gamma-aminobutyric acid type A receptor inverse agonist L-655,708. Anesthesiology, 113, 1061–1071. Sun, X., Lindsay, J., Monsein, L. H., Hill, P. C., & Corso, P. J. (2012). Silent brain injury after cardiac surgery: A review: Cognitive dysfunction and magnetic resonance imaging diffusion-weighted imaging findings. Journal of the American College of Cardiology, 60, 791–797. Terpstra, A. H. (2001). Differences between humans and mice in efficacy of the body fat lowering effect of conjugated linoleic acid: Role of metabolic rate. The Journal of Nutrition, 131, 2067–2068. Wei, P., Liu, Q., Li, D., Zheng, Q., Zhou, J., & Li, J. (2015). Acute nicotine treatment attenuates lipopolysaccharide-induced cognitive dysfunction by increasing BDNF expression and inhibiting neuroinflammation in the rat hippocampus. Neuroscience Letters, 604, 161–166. Woo, D. H., Han, K. S., Shim, J. W., Yoon, B. E., Kim, E., Bae, J. Y., ... Lee, C. J. (2012). TREK-1 and Best1 channels mediate fast and slow glutamate release in astrocytes upon GPCR activation. Cell, 151, 25–40. Wu, X., Liu, Y., Chen, X., Sun, Q., Tang, R., Wang, W., ... Xie, M. (2013). Involvement of TREK-1 activity in astrocyte function and neuroprotection under simulated ischemia conditions. Journal of Molecular Neuroscience: MN, 49, 499–506. Zanos, P., Moaddel, R., Morris, P. J., Georgiou, P., Fischell, J., Elmer, G. I., ... Gould, T. D. (2016). NMDAR inhibition-independent antidepressant actions of ketamine metabolites. Nature, 533, 481–486. Zurek, A. A., Bridgwater, E. M., & Orser, B. A. (2012). Inhibition of alpha5 gammaaminobutyric acid type A receptors restores recognition memory after general anesthesia. Anesthesia and Analgesia, 114, 845–855.
Chawana, R., Alagaili, A., Patzke, N., Spocter, M. A., Mohammed, O. B., Kaswera, C., ... Manger, P. R. (2014). Microbats appear to have adult hippocampal neurogenesis, but post-capture stress causes a rapid decline in the number of neurons expressing doublecortin. Neuroscience, 277, 724–733. de la Pena, E., Malkia, A., Vara, H., Caires, R., Ballesta, J. J., Belmonte, C., & Viana, F. (2012). The influence of cold temperature on cellular excitability of hippocampal networks. PLoS ONE, 7, e52475. Feinkohl, I., Winterer, G., & Pischon, T. (2016). Obesity and post-operative cognitive dysfunction: A systematic review and meta-analysis. Diabetes/Metabolism Research and Reviews. Franks, N. P., & Honore, E. (2004). The TREK K2P channels and their role in general anaesthesia and neuroprotection. Trends in Pharmacological Sciences, 25, 601–608. Heurteaux, C., Guy, N., Laigle, C., Blondeau, N., Duprat, F., Mazzuca, M., ... Lazdunski, M. (2004). TREK-1, a K+ channel involved in neuroprotection and general anesthesia. The EMBO Journal, 23, 2684–2695. Honore, E. (2007). The neuronal background K2P channels: Focus on TREK1. Nature Reviews. Neuroscience, 8, 251–261. Huang, D., & Yu, B. (2008). Recent advance and possible future in TREK-2: A two-pore potassium channel may involved in the process of NPP, brain ischemia and memory impairment. Medical Hypotheses, 70, 618–624. Knipp, S. C., Matatko, N., Wilhelm, H., Schlamann, M., Thielmann, M., Losch, C., ... Jakob, H. (2008). Cognitive outcomes three years after coronary artery bypass surgery: Relation to diffusion-weighted magnetic resonance imaging. The Annals of Thoracic Surgery, 85, 872–879. Lee, B. H., Chan, J. T., Kraeva, E., Peterson, K., & Sall, J. W. (2014). Isoflurane exposure in newborn rats induces long-term cognitive dysfunction in males but not females. Neuropharmacology, 83, 9–17. Lin, D., Cao, L., Wang, Z., Li, J., Washington, J. M., & Zuo, Z. (2012). Lidocaine attenuates cognitive impairment after isoflurane anesthesia in old rats. Behavioural Brain Research, 228, 319–327. Lin, D., & Zuo, Z. (2011). Isoflurane induces hippocampal cell injury and cognitive impairments in adult rats. Neuropharmacology, 61, 1354–1359. Lockwood, G. (2010). Theoretical context-sensitive elimination times for inhalation anaesthetics. British Journal of Anaesthesia, 104, 648–655. Lu, L., Wang, W., Peng, Y., Li, J., Wang, L., & Wang, X. (2014). Electrophysiology and pharmacology of tandem domain potassium channel TREK-1 related BDNF synthesis in rat astrocytes. Naunyn-Schmiedeberg's Archives of Pharmacology, 387, 303–312. Marie, A., Dadure, C., Seguret, F., & Capdevila, X. (2015). One year of anaesthesia in France: A comprehensive survey based on the national medical information (PMSI) database. Part 2: Out-hospital patients. Anaesthesia, Critical Care & Pain Medicine, 34, 199–204. Martinez-Moreno, A., Rodriguez-Duran, L. F., & Escobar, M. L. (2016). Brain-derived neurotrophic factor into adult neocortex strengthens a taste aversion memory. Behavioural Brain Research, 297, 1–4. Mazella, J., Petrault, O., Lucas, G., Deval, E., Beraud-Dufour, S., Gandin, C., ... Borsotto, M. (2010). Spadin, a sortilin-derived peptide, targeting rodent TREK-1 channels: A
204
Contents lists available at ScienceDirect
Neurobiology of Learning and Memory journal homepage: www.elsevier.com/locate/ynlme
Short communication
TREK-1 pathway mediates isoflurane-induced memory impairment in middle-aged mice ⁎
Yanhui Caia,1, Zhengwu Pengb,1, Haiyun Guoa, Feng Wanga, , Yi Zenga, a b
MARK
⁎
Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China Department of Psychiatry, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China
A R T I C L E I N F O
A B S T R A C T
Keywords: Isoflurane Post-operative cognitive dysfunction Middle-aged mice TREK-1
Post-operative cognitive dysfunction (POCD) has been widely reported, especially in elderly patients. An association between POCD and inhalational anesthetics, such as isoflurane, has been suggested. The TWIK-related K+ channel-1 (TREK-1) controls several major cellular responses involved in memory formation and is believed to participate in the development of depression, cerebral ischemia and blood-brain barrier dysfunction. However, the specific role of TREK-1 in mediating anesthesia-induced POCD remains unknown. In the current study, we determined that exposure to isoflurane affected memory in middle-aged mice and altered TREK-1 expression. In addition, TREK-1 over-expression exacerbated isoflurane-induced memory impairment, while TREK-1 silence attenuated the impairment. Taken together, our data demonstrate that inhibition of TREK-1 protects mice from cognitive impairment induced by anesthesia and TREK-1 is a potential therapeutic target against memory impairment induced by volatile anesthetics.
1. Introduction It is estimated that more than 200 million people worldwide undergo surgery annually (Marie, Dadure, Seguret, & Capdevila, 2015). The majority of these operations are performed under general anesthesia, and nearly 80% of these cases use volatile anesthetics, such as isoflurane, due to their superior features (Marie et al., 2015). Previous studies that conduct neuropsychological testing prior to hospital discharge after cardiac surgery have reported post-operative cognitive dysfunction (POCD) in 14–48% of patients (Sun, Lindsay, Monsein, Hill, & Corso, 2012). This cognitive impairment persists for 6 weeks in at least 30% of patients and for up to 6 months in 25% of patients (Sun et al., 2012). The incidence of POCD is greater in the elderly, in whom it is associated with poor outcome and increased mortality after surgery (Callaway, Jones, Royse, & Royse, 2015; Knipp et al., 2008). POCD remains a significant concern because it affects quality of life and significantly impacts health economics (Newman et al., 2006). With the exception of advanced age, which is a well-established risk factor for POCD, general anesthesia, obesity and gender may all play a role in mediating POCD (Feinkohl, Winterer, & Pischon, 2016; Lee, Chan, Kraeva, Peterson, & Sall, 2014). Although whether general anesthesia induces POCD remains unclear, both in vitro and experimental animal studies have suggested that volatile anesthetics contribute to the
⁎
1
development of POCD (Lin et al., 2012; Lin & Zuo, 2011; Zurek, Bridgwater, & Orser, 2012). So it is imperative to confirm whether or not general anesthesia causes memory damage. Providing that volatile anesthesia could induce memory impairment in middle-aged mice, we investigated several proteins’ changes which were seldom reported before in POCD. Recently, several groups observe that the TWIK-related potassium channel-1 (TREK-1), mature brainderived neurotrophic factor (mBDNF), excitatory amino acid transporter 2 (EAAT2) and microtubule-associated cytoskeleton protein doublecortin (DCX) (Allen, Purves-Tyson, Fung, & Shannon Weickert, 2015; Chawana et al., 2014; Wei et al., 2015) take part in the formation of memory. A previous study has shown that injection of mBDNF into neocortex strengthens a taste aversion memory in adult rats (MartinezMoreno, Rodriguez-Duran, & Escobar, 2016). Another study shows that over-expression of EAAT2 with the ceftriaxone damages long-term depression in rats (Omrani et al., 2009). Among these potential therapeutic targets, we focus on the TREK-1 for two reasons. Firstly, TREK-1 is activated by volatile anesthetics and already implicated as a possible target of the effects of those anesthetics (Franks & Honore, 2004; Patel et al., 1999). Secondly, except for its unique function in anesthesia, several studies have reported that the TREK family might be involved in processes associated with memory impairment (de la Pena et al., 2012; Huang & Yu, 2008). In particular, the mRNA level of TREK-1 and TREK-
Corresponding authors at: Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, China. E-mail addresses: [email protected] (F. Wang), [email protected] (Y. Zeng). Yanhui Cai and Zhengwu Peng contributed equally to this research.
http://dx.doi.org/10.1016/j.nlm.2017.10.012 Received 30 November 2016; Received in revised form 14 April 2017; Accepted 13 October 2017 Available online 16 October 2017 1074-7427/ © 2017 Elsevier Inc. All rights reserved.
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
TREK-1 (1:200, Abcam, ab90855, Cambridge, MA); rabbit monoclonal antibody to β-actin (1:1000, Abcam, ab190476); rabbit polyclonal antibody to EAAT2 (1:500, Cell Signaling Technology, 3838, Massachusetts, USA); rabbit monoclonal antibody to mBDNF (1:2500, Abcam, ab108319); or rabbit polyclonal antibody to DCX (1:500, Cell Signaling Technology, 4604) at 4 °C for 12 h. After being washed three times, the membranes were cultured in goat anti-rabbit secondary antibody (1:10000, Abcam, ab6721) for 2 h. The membranes were washed again, and bands were detected by a chemiluminescent horseradish peroxidase substrate (Millipore, Bedford, MA). The signal of band intensity was analyzed with Quantity One software 5.0 (Bio-Rad, La Jolla, CA).
2 increases (de la Pena et al., 2012), and inhibition of TREK-2 decreases the memory impairment in Alzheimer’s disease of rats (de la Pena et al., 2012). Based on these studies, we hypothesized that TREK-1 played a key role in the memory impairment induced by isoflurane anesthesia. Our study confirmed volatile anesthesia caused memory impairment in middle-aged mice. Interestingly, we observed that the level of TREK1 and EAAT2 was increased in memory impairment that was induced by isoflurane anesthesia. And the concentrations of mBDNF and DCX were decreased. Furthermore, we found that TREK-1 channels acted as an important role in the onset of memory impairment caused by isoflurane. 2. Materials and methods
2.4. Quantitative reverse transcription polymerase chain reaction (qRTPCR)
2.1. Animals All experiments in vivo were performed in accordance with the National Guidelines for the Care and Use of Laboratory Animals and were approved by the Experimental Animal Welfare Committee of the Fourth Military Medical University. Male 8-month-old C57BL/6J mice were bought from the Fourth Military Medical University's Experimental Animal Center. Mice were housed in groups of four in standard breeding cages and housed at 20–25 °C with 60% relative humidity under controlled conditions (12 h light/dark cycle, light-dark: 08:00–20:00 h) with ad libitum access to water and food. The core temperature was maintained, and pH and oxygen levels were normal at the end of the anesthetic treatment. Behavioral test was performed by investigators who were blinded with respect to the individual animal groups.
The mice were decapitated and the total RNA in the hippocampus was extracted with RNA extraction kit (TaKaRa, Otsu, Japan) one day after exposure to isoflurane. The same amounts of total RNA of hippocampus were reverse transcribed using PrimeScript RT Master Mix (TaKaRa) under standard conditions. Following reverse transcription, qRT-PCR reactions were performed with SYBR Premix Ex Taq (TaKaRa). The forward and reverse primer sequences included the following: TREK-1 (TCTGGTGGGCTTGTGGTTC/AGGGGAGGGGATAGGTGAGA) and GAPDH (AAATGGTGAAGGTCGGTGTGAAC/CAACAATCTCCACTTTGCCACTG). GAPDH was adopted as an internal control.
2.5. Over-expression and interference with TREK-1 in vivo
2.2. Morris water maze
The adeno-associated viruses (AAV) contained TREK1-Vector, SiRNAs-Vector against TREK1 and the homologous control vector were purchased from Invitrogen. The in vivo experiments of gene over-expression and silencing were performed using a micromanipulation system (Narishige, Tokyo, Japan), and the procedures of microinjection were performed according to described methods (McMurray, Du, Brownlee, & Palmer, 2016). In short, AAV were placed in a 50 μl HEPES-supplemented M2 medium under paraffin oil at a multiplicity of infection of 200. The viruses were injected into the ventricular system using pneumatic pressure with a picoliter injector (Greenvale, NY, USA). The volume was approximate 2 μl for each virus. Three weeks later, the level of TREK-1 was determined by immunofluorescence staining.
A conventional Morris Water Maze (MWM) test was carried out to analyze reference and learning memory (n = 8/group). The MWM apparatus contained a white-colored pool (51 cm in height and 122 cm in diameter) and was placed in an independent room. The pool was filled with 20–22 °C water to a depth of 40 cm and could be divided into four quadrants. Four locations around the tank's edge were defined N, S, E, and W, which provided four available start positions. The locations divided the tank into four quadrants: NE, SE, SW, and NW. In the center of one of the quadrants, which was defined as the target quadrant, a hidden escape platform (10 cm in diameter) was placed. The position of the hidden platform was changed every day according to the following pattern: SE, NW, NE, SW, SE, and NW (repeated twice). The mice failing to locate the hidden platform within 60 s were placed on the platform manually after being released into the water. Individual trials were 60 s in length, and the interval between trials was 15 s. During training, the mice received four trials every day from the four principal start locations and were tested over a 3-day period. A probe test in which the platform was hidden was used to analyze spatial memory. The mice were released from novel start positions at 30 s intervals. At last, the trials were recorded and analyzed using an automated analysis system (Dig-Behav, Jiliang Co., Ltd., Shanghai, China).
2.6. Immunofluorescence staining The hippocampus was fixed with 4% paraformaldehyde and cut into 12 μm sagittal sections. After they were sectioned, the slices were immersed in 0.25% H2O2 in methanol for 20 min and then incubated with 12% goat serum for 15 min. The slices were probed with anti-TREK-1 rabbit polyclonal antibody (1:200, Alomone Labs, APC-047, Jerusalem, Israel) in 1% bovine serum albumin-PBS at 4 °C for 12 h in a humidified box. The slices were then incubated with an Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody (1:500, Thermo Fisher Scientific, A-11008) for 1 h. Fluorescence images were obtained with a confocal laser microscope (Olympus, Japan), and FluoView 1000 (Olympus) were used to capture pictures.
2.3. Western blot analysis One day after isoflurane anesthesia, the animals were decapitated and the hippocampus brain tissues were lysed in extraction buffer (Thermo Fisher Scientific, Shanghai, China) containing a complete protease inhibitor (1%, Thermo Fisher Scientific). The concentration of proteins was detected by BCA protein assay kit (Thermo Fisher Scientific). The same amount of protein got separated on sodium dodecyl sulfate polyacrylamide gels and was transferred to 0.22 μm polyvinylidene fluoride membranes (Millipore, Bedford, MA) for 2 h, and blocked with skimmed milk (5%). The membranes were incubated with the appropriate primary antibodies: rabbit polyclonal antibody to
2.7. Statistical analysis The results were reported as the mean ± SD. One way analysis of variance (ANOVA) followed by Bonferroni's Multiple Comparison Test was used for data’s statistical analysis with Prism 5 (GraphPad Software). The level of statistical significance was p < .05. 200
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
Fig. 1. The occurrence of memory dysfunction at 24 h after isoflurane anesthesia in middle-aged mice. (A) Shows the experimental protocols for behavioral training and evaluation. (B) Shows the typical trajectory of behavior during the morris water maze (MWM) test for the various groups. (C) and (D) show the swimming speed and swimming distance for the various groups. (E) shows the relative dwell time in the target quadrant of the MWM for the various groups. * p < .05.
3. Results
increased (F(3, 16) = 64.55, one way ANOVA, p < .0001) (Fig. 2A). Levels of the glutamate transporter EAAT2 were also increased following exposure to increasing doses of isoflurane (F(3, 16) = 33.11, one way ANOVA, p < .0001) (Fig. 2B). What’s more, the levels of the neurotrophin mBDNF were decreased (F(3, 16) = 8.235, one way ANOVA, p = .0015) (Fig. 2C). And DCX was also decreased following exposure to increasing doses of isoflurane (F(3, 16) = 29.10, one way ANOVA, p < .0001) (Fig. 2D). As mentioned above, we were interested in TREK-1’s role in memory damage induced by isoflurane anesthesia. Next we confirmed, by qRT-PCR, that the mRNA level of TREK-1 was dose- and time-dependent following isoflurane exposure. In accordance with Western blot analysis, Fig. 2E (F(3, 16) = 6.918, one way ANOVA, p = .0034) and Fig. 2F (F(3, 16) = 17.51, one way ANOVA, p < .0001) showed that the mRNA amount was increased with increasing isoflurane doses (0.5, 1.0 and 1.5 Mac) and exposure times (0.5, 1.0 and 1.5 h).
3.1. Isoflurane anesthesia induced memory impairment in middle-aged mice The behavioral testing protocols were shown in Fig. 1A. Briefly, the mice received behavioral training in the MWM for three times (once a day for 3 days). Mice were exposed to isoflurane anesthesia one day later, and were then evaluated for learning and memory on day 1 and 7 post-anesthesia. The core temperature was maintained, and the pH and CO2 were normal after anesthesia. A representative trajectory of behavior in the MWM test, one day after anesthesia, was shown in Fig. 1B. The relative dwell time of animals treated with 1.5 Mac or 1.0 Mac isoflurane significantly differed from the relative dwell time in the sham group (F(3, 27) = 6.547, oneway ANOVA, p = .0018) (Fig. 1E). No significant differences in swimming speed or swimming distance were observed between the four experimental groups, suggesting that the observed differences in dwell time were not caused by any associated motor dysfunctions (Fig. 1C and D). Furthermore, the relative dwell time in the target quadrant was decreased at day 7 with the increasing doses of isoflurane exposure (F(3, 27) = 3.194, one way ANOVA, p = .0387) (Fig. S1). However, the memory impairment at day 7 was not as significant as at 24 h after isoflurane anesthesia in middle-aged mice. Therefore, we investigated the underlying mechanism in isoflurane-induced memory deficits at 24 h.
3.3. TREK-1 significantly influenced the isoflurane-induced memory damage An important role of the potassium channel TREK-1 has been demonstrated in isoflurane-induced anesthesia previously (Franks & Honore, 2004). In the present study, we succeeded in creating in vivo models of TREK-1 suppression and over-expression via ventricular microinjection of appropriate AAV, and Fig. 3A showed the expression of TREK-1 in hippocampus in different groups by immunofluorescence staining. Briefly, the mice received ventricular microinjection three weeks before behavior training, then according to the protocol in Fig. 1A, the test evaluated for learning and memory was performed on day 1 post-anesthesia. Fig. 3B presented the typical trajectory of behavior in the MWM on day 1 postanesthesia for the two different in vivo models. Using a 1.0 Mac concentration of isoflurane, we observed that TREK-1 over-expression exacerbated the memory loss compared with vector infection. When TREK-1 expression was suppressed, the memory deficits were attenuated
3.2. The level of targeted proteins underlying isoflurane-induced memory deficits 24 h after isoflurane anesthesia, the animals were decapitated and the homologous protein levels in hippocampus were analyzed by Western blot. First, compared with the levels of the potassium channel TREK-1 in the sham group, the expression of TREK-1 in the animals that received increasing doses of isoflurane (0.5, 1.0 and 1.5 Mac) was 201
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
Fig. 2. The molecular changes that occurred after isoflurane-induced memory impairment. Western blotting (A, B, C and D) was used to analyze differences among the groups. The relative optical density was calculated by dividing the intensity of the targeted band by that of the homologous β-actin band. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was used to calculate the relative amounts of TREK-1 in hippocampus (E and F). The dose of isoflurane was 1.0 Mac over the different durations of anesthetic exposure. *p < .05, **p < .01.
halothane and isoflurane (Patel et al., 1998). However, other functionally or structurally distinct potassium channels, such as TRAAK channels (Patel et al., 1999), are insensitive to anesthetics. Thus, we speculate that TREK-1 participates in the formation of memory deficits induced by the exposure to isoflurane. We demonstrated the function of TREK-1 in the whole brain by using in vivo TREK-1 silence and overexpression models. Because TREK-1 is a good target for antidepressants (Mazella et al., 2010), it will be interesting to investigate whether isoflurane induces depressive-like behaviors via activation of the TREK1 pathway. To our knowledge, there have not been explicit reports about anesthesia-induced depression, except for ketamine’s antidepressant effects mediated mainly by inhibition of NMDA receptors (Zanos et al., 2016). We cannot conclude that isoflurane induces depressive-like behaviors because mouse depressive behaviors were not detected after isoflurane exposure in our study. It cannot be ignored that the memory impairment at 24 h after
compared to these observed in the vector group (F(3, 32) = 12.52, one way ANOVA, p < .0001) (Fig. 3E). The suppression or over-expression of TREK-1 failed to affect swimming speed and swimming distance in the MWM (Fig. 3C and D). Taken together, these findings imply that TREK-1 plays a key function in the cognitive dysfunction that is induced by exposure to isoflurane. 4. Discussion TREK-1 can be found throughout the central nervous system (Honore, 2007) and this potassium channel subtype plays a key role in brain function; its abnormal changes are associated with affective disorders, such as depression (Mazella et al., 2010). In addition to physical alteration of the cellular membrane, intracellular acidification, and lysophospholipids, TREK-1 channels in transfected mammalian cells are also activated by various volatile anesthetics such as sevoflurane, 202
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
Fig. 3. The effect of TREK-1 on the isoflurane-induced memory impairment. (A) Verification of TREK-1 over-expression and under-expression model by immunofluorescence. (B) Represents the typical trajectory of behavior in the MWM in TREK-1 over-expressing and underexpressing mice. (C) and (D) show the swimming speed and swimming distance in the two models. (E) Shows the relative dwell time in the target quadrant of the MWM in the two models. The dose of isoflurane was 1.0 Mac in all groups. Scale bar = 200 μm, *p < .05.
induced memory impairment via EAAT2 or mBDNF needs further study. In conclusion, our study demonstrates that isoflurane anesthesia induces cognitive impairment in middle-aged mice and suggests that TREK-1 acts as a key role in the cognitive deficits induced by exposure to isoflurane. Further investigation is required to reveal the mechanism of TREK-1’s role in memory impairment induced by isoflurane anesthesia. Given its pivotal role, TREK-1 remains a potential therapeutic target for restoring memory function and improving cognitive deficits associated with exposure to general anesthesia.
isoflurane exposure might simply be the effects of the presence of residual anesthetic, considering that 99.9% elimination of isoflurane in brain is achieved at 71 h after anesthesia in clinical settings (Lockwood, 2010). On the contrary, the residual concentrations of isoflurane in brain are at trace levels in C57BL6/J mice, which are 0.034 ± 0.012% at 1 h and 0.0095 ± 0.0006% at 24 h after anesthesia (Saab et al., 2010). Furthermore, isoflurane concentrations as high as 0.6% are required to impair the freezing response when administered during contextual fear learning (Rau, Oh, Laster, Eger, & Fanselow, 2009), and the threshold concentrations of isoflurane were 0.2% that of impaired memory performance in rats during fear conditioning (Alkire & Gorski, 2004). Isoflurane concentrations measured at 24 h after anesthesia were a magnitude lower than those shown to impair memory directly. We infer the contradictory results of previous studies are mainly due to the pharmacokinetic differences between humans and rodents (Terpstra, 2001). In our study, we observed that inhibition of TREK-1 reduced the memory impairment induced by isoflurane anesthesia. However, due to a paucity of information on this topic, the cellular mechanisms underlying the effects of TREK-1 on isoflurane-induced memory damage warrant further exploration. Previous studies have given us a clue that TREK-1 differentially influences the expression of EAAT2 and mBDNF. Electrogenic astrocytic transporters such as EAAT2 depend on K+ channels and the hyperpolarized membrane potential (Wu et al., 2013). Moreover, TREK-1 has been shown to mediate both fast and slow glutamate release in astrocytes via G protein-coupled receptor activation, which affects the synthesis of EAAT2 (Woo et al., 2012). Other research has pointed out that the over-expression of TREK-1 affects neuroprotective factors, including mBDNF, during pathologic conditions such as ischemia (Heurteaux et al., 2004; Woo et al., 2012). TREK-1 inhibition enhances cytoplasmic synthesis of mBDNF in astrocytes (Lu et al., 2014). Whether TREK-1 takes part in the formation of isoflurane-
Acknowledgments This research was supported by funds from the National Natural Science Foundation in China (Grant No. 81371510). Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed by authors. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.nlm.2017.10.012. References Alkire, M. T., & Gorski, L. A. (2004). Relative amnesic potency of five inhalational anesthetics follows the Meyer-Overton rule. Anesthesiology, 101, 417–429. Allen, K. M., Purves-Tyson, T. D., Fung, S. J., & Shannon Weickert, C. (2015). The effect of adolescent testosterone on hippocampal BDNF and TrkB mRNA expression: Relationship with cell proliferation. BMC Neuroscience, 16, 4. Callaway, J. K., Jones, N. C., Royse, A. G., & Royse, C. F. (2015). Memory impairment in rats after desflurane anesthesia is age and dose dependent. Journal of Alzheimer's Disease: JAD, 44, 995–1005.
203
Neurobiology of Learning and Memory 145 (2017) 199–204
Y. Cai et al.
new concept in the antidepressant drug design. PLoS Biology, 8, e1000355. McMurray, K. M., Du, X., Brownlee, M., & Palmer, A. A. (2016). Neuronal overexpression of Glo1 or amygdalar microinjection of methylglyoxal is sufficient to regulate anxiety-like behavior in mice. Behavioural Brain Research, 301, 119–123. Newman, M. F., Mathew, J. P., Grocott, H. P., Mackensen, G. B., Monk, T., Welsh-Bohmer, K. A., ..., & Mark, D. B. (2006). Central nervous system injury associated with cardiac surgery. Lancet (London, England), 368, 694–703. Omrani, A., Melone, M., Bellesi, M., Safiulina, V., Aida, T., Tanaka, K., ... Conti, F. (2009). Up-regulation of GLT-1 severely impairs LTD at mossy fibre–CA3 synapses. The Journal of Physiology, 587, 4575–4588. Patel, A. J., Honore, E., Lesage, F., Fink, M., Romey, G., & Lazdunski, M. (1999). Inhalational anesthetics activate two-pore-domain background K+ channels. Nature Neuroscience, 2, 422–426. Patel, A. J., Honore, E., Maingret, F., Lesage, F., Fink, M., Duprat, F., & Lazdunski, M. (1998). A mammalian two pore domain mechano-gated S-like K+ channel. The EMBO Journal, 17, 4283–4290. Rau, V., Oh, I., Laster, M., Eger, E. I., 2nd, & Fanselow, M. S. (2009). Isoflurane suppresses stress-enhanced fear learning in a rodent model of post-traumatic stress disorder. Anesthesiology, 110, 487–495. Saab, B. J., Maclean, A. J., Kanisek, M., Zurek, A. A., Martin, L. J., Roder, J. C., & Orser, B. A. (2010). Short-term memory impairment after isoflurane in mice is prevented by the alpha5 gamma-aminobutyric acid type A receptor inverse agonist L-655,708. Anesthesiology, 113, 1061–1071. Sun, X., Lindsay, J., Monsein, L. H., Hill, P. C., & Corso, P. J. (2012). Silent brain injury after cardiac surgery: A review: Cognitive dysfunction and magnetic resonance imaging diffusion-weighted imaging findings. Journal of the American College of Cardiology, 60, 791–797. Terpstra, A. H. (2001). Differences between humans and mice in efficacy of the body fat lowering effect of conjugated linoleic acid: Role of metabolic rate. The Journal of Nutrition, 131, 2067–2068. Wei, P., Liu, Q., Li, D., Zheng, Q., Zhou, J., & Li, J. (2015). Acute nicotine treatment attenuates lipopolysaccharide-induced cognitive dysfunction by increasing BDNF expression and inhibiting neuroinflammation in the rat hippocampus. Neuroscience Letters, 604, 161–166. Woo, D. H., Han, K. S., Shim, J. W., Yoon, B. E., Kim, E., Bae, J. Y., ... Lee, C. J. (2012). TREK-1 and Best1 channels mediate fast and slow glutamate release in astrocytes upon GPCR activation. Cell, 151, 25–40. Wu, X., Liu, Y., Chen, X., Sun, Q., Tang, R., Wang, W., ... Xie, M. (2013). Involvement of TREK-1 activity in astrocyte function and neuroprotection under simulated ischemia conditions. Journal of Molecular Neuroscience: MN, 49, 499–506. Zanos, P., Moaddel, R., Morris, P. J., Georgiou, P., Fischell, J., Elmer, G. I., ... Gould, T. D. (2016). NMDAR inhibition-independent antidepressant actions of ketamine metabolites. Nature, 533, 481–486. Zurek, A. A., Bridgwater, E. M., & Orser, B. A. (2012). Inhibition of alpha5 gammaaminobutyric acid type A receptors restores recognition memory after general anesthesia. Anesthesia and Analgesia, 114, 845–855.
Chawana, R., Alagaili, A., Patzke, N., Spocter, M. A., Mohammed, O. B., Kaswera, C., ... Manger, P. R. (2014). Microbats appear to have adult hippocampal neurogenesis, but post-capture stress causes a rapid decline in the number of neurons expressing doublecortin. Neuroscience, 277, 724–733. de la Pena, E., Malkia, A., Vara, H., Caires, R., Ballesta, J. J., Belmonte, C., & Viana, F. (2012). The influence of cold temperature on cellular excitability of hippocampal networks. PLoS ONE, 7, e52475. Feinkohl, I., Winterer, G., & Pischon, T. (2016). Obesity and post-operative cognitive dysfunction: A systematic review and meta-analysis. Diabetes/Metabolism Research and Reviews. Franks, N. P., & Honore, E. (2004). The TREK K2P channels and their role in general anaesthesia and neuroprotection. Trends in Pharmacological Sciences, 25, 601–608. Heurteaux, C., Guy, N., Laigle, C., Blondeau, N., Duprat, F., Mazzuca, M., ... Lazdunski, M. (2004). TREK-1, a K+ channel involved in neuroprotection and general anesthesia. The EMBO Journal, 23, 2684–2695. Honore, E. (2007). The neuronal background K2P channels: Focus on TREK1. Nature Reviews. Neuroscience, 8, 251–261. Huang, D., & Yu, B. (2008). Recent advance and possible future in TREK-2: A two-pore potassium channel may involved in the process of NPP, brain ischemia and memory impairment. Medical Hypotheses, 70, 618–624. Knipp, S. C., Matatko, N., Wilhelm, H., Schlamann, M., Thielmann, M., Losch, C., ... Jakob, H. (2008). Cognitive outcomes three years after coronary artery bypass surgery: Relation to diffusion-weighted magnetic resonance imaging. The Annals of Thoracic Surgery, 85, 872–879. Lee, B. H., Chan, J. T., Kraeva, E., Peterson, K., & Sall, J. W. (2014). Isoflurane exposure in newborn rats induces long-term cognitive dysfunction in males but not females. Neuropharmacology, 83, 9–17. Lin, D., Cao, L., Wang, Z., Li, J., Washington, J. M., & Zuo, Z. (2012). Lidocaine attenuates cognitive impairment after isoflurane anesthesia in old rats. Behavioural Brain Research, 228, 319–327. Lin, D., & Zuo, Z. (2011). Isoflurane induces hippocampal cell injury and cognitive impairments in adult rats. Neuropharmacology, 61, 1354–1359. Lockwood, G. (2010). Theoretical context-sensitive elimination times for inhalation anaesthetics. British Journal of Anaesthesia, 104, 648–655. Lu, L., Wang, W., Peng, Y., Li, J., Wang, L., & Wang, X. (2014). Electrophysiology and pharmacology of tandem domain potassium channel TREK-1 related BDNF synthesis in rat astrocytes. Naunyn-Schmiedeberg's Archives of Pharmacology, 387, 303–312. Marie, A., Dadure, C., Seguret, F., & Capdevila, X. (2015). One year of anaesthesia in France: A comprehensive survey based on the national medical information (PMSI) database. Part 2: Out-hospital patients. Anaesthesia, Critical Care & Pain Medicine, 34, 199–204. Martinez-Moreno, A., Rodriguez-Duran, L. F., & Escobar, M. L. (2016). Brain-derived neurotrophic factor into adult neocortex strengthens a taste aversion memory. Behavioural Brain Research, 297, 1–4. Mazella, J., Petrault, O., Lucas, G., Deval, E., Beraud-Dufour, S., Gandin, C., ... Borsotto, M. (2010). Spadin, a sortilin-derived peptide, targeting rodent TREK-1 channels: A
204