- Email: [email protected]
Tributyltin disrupts feeding and energy metabolism in the goldfish (Carassius auratus)
Chemosphere 152 (2016) 221e228
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
Tributyltin disrupts feeding and energy metabolism in the goldfish (Carassius auratus) Jiliang Zhang*, Ping Sun, Fan Yang, Tao Kong, Ruichen Zhang Henan Open Laboratory of Key Subjects of Environmental and Animal Products Safety, College of Animal Science and Technology, Henan University of Science and Technology, Henan, China
h i g h l i g h t s Tributyltin increased the weight gain and food intake in fish. The neuropeptides expression showed orexigenic effects after tributyltin exposure. Tributyltin disturbed the energy metabolism in fish. Tributyltin might inappropriately alter feeding and energy metabolism to induce obesity.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 August 2015 Received in revised form 28 February 2016 Accepted 29 February 2016 Available online 10 March 2016
Tributyltin (TBT) can induce obesogen response. However, little is known about the adverse effects of TBT on food intake and energy metabolism. The present study was designed to investigate the effects of TBT, at environmental concentrations of 2.44 and 24.4 ng/L (1 and 10 ng/L as Sn), on feeding and energy metabolism in goldfish (Carassius auratus). After exposure for 54 d, TBT increased the weight gain and food intake in fish. The patterns of brain neuropeptide genes expression were in line with potential orexigenic effects, with increased expression of neuropeptide Y and apelin, and decreased expression of pro-opiomelanocortin, ghrelin, cocaine and amphetamine-regulated transcript, and corticotropinreleasing factor. Interestingly, the energy metabolism indicators (oxygen consumption, ammonia exertion and swimming activity) and the serum thyroid hormones were all significantly increased at the 2.44 ng/L TBT group in fish. However, no changes of energy metabolism indicators or a decrease of thyroid hormones was found at the 24.4 ng/L TBT group, which indicated a complex disrupting effect on metabolism of TBT. In short, TBT can alter feeding and energy metabolism in fish, which might promote the obesogenic responses. © 2016 Elsevier Ltd. All rights reserved.
Handling Editor: Jim Lazorchak Keywords: Tributyltin Goldfish Food intake Neuropeptide Thyroid hormone
1. Introduction Tributyltin (TBT), an organotin derivative, possesses broadspectrum biocidal properties. It has been extensively used as antifouling agents in paints applied to vessels and aquaculture nets. Aquatic pollution resulting from its usage has been of great concern due to its bioaccumulation potential, persistence in sediment up to several years, and highly toxic effects on nontarget aquatic life. Although TBT has been banned from paints in the European Union since 2003, it is still found at high levels in water ecosystems and
* Corresponding author. College of Animal Science and Technology, Henan University of Science and Technology, 70 Tianjin Road, Luoyang, Henan, 471003, China. E-mail address: [email protected] (J. Zhang). http://dx.doi.org/10.1016/j.chemosphere.2016.02.127 0045-6535/© 2016 Elsevier Ltd. All rights reserved.
causes negative effects in organisms (Antizar-Ladislao, 2008). It is reported that some aquatic environments of China had been seriously polluted by TBT and its concentrations from water samples range from below the detection limit to hundreds of ng/L as Sn (Cao et al., 2009; Zhang et al., 2013). In fishes, the concentrations of TBT range from 11 to 182 mg/kg wet weight in the muscle tissues of 11 species from Japan (Harino et al., 2000), and from 0.161 to 0.847 mg/ g dry weight in the livers of eels (Anguilla anguilla) from the Thames Estuary (Harino et al., 2002), from 26.35 to 194.22 ng/g wet weight in the muscle tissues from Kaohsiung Harbor and Kaoping River estuary of Taiwan (Shue et al., 2014). Many researches on the effects of TBT are focused on reproductive toxicity. It has been a longstanding issue that TBT causes imposex in mollusks (Matthiessen, 2008). In fish, TBT is reported to alter the sex ratio in favor of males (McAllister and Kime, 2003;
222
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Shimasaki et al., 2003), affect sexual behavior (Nakayama et al., 2004), and inhibit the gonad development (Zhang et al., 2007, 2009). Recently, TBT is also shown to be a potent inducer of adipogenesis, which is a novel aspect of endocrine disruption. It is reported that TBT promotes adipogenesis and induces the differentiation of murine preadipocyte cells to adipocytes (Inadera and Shimomura, 2005; Kanayama et al., 2005). Furthermore, in-utero exposure to TBT increases lipid accumulation and maturation of adipocytes in mice and induces ectopic adipocyte formation in exposed Xenopus laevis (Grün et al., 2006). Chronic and repeat exposure to low doses of TBT results in obesity and hepatic steatosis in mice (Zuo et al., 2011). Despite the reported evidences in mammals, little is known on the ability of TBT in aquatic organisms, which are often exposed to significant concentrations of TBT. Interestingly, an increase in whole-body lipid content along with an increase of lipid related plasma parameters is observed in juvenile chinook salmon (Oncorhynchus tshawytscha) exposed to TBT (Meador et al., 2011). In our previous study, TBT induced hepatic steatosis by increasing the gene expression associated with lipid transport, lipid storage, lipiogenic enzymes and lipiogenic factors in the livers of zebrafish (Danio rerio) (Zhang et al., 2016). These findings suggest that TBT can also act on the regulation of lipogenesis and induce obesogenic responses in fish. Obesity is associated with overeating or inactivity, however, little is known about the effects of TBT exposure on feeding and energy metabolism. We hypothesized that TBT exposure might alter feeding and energy metabolism and thus promote obesogenic responses. To address the issue, we evaluated the effects of TBT at concentrations of 1 and 10 ng/L (as Sn) on food intake and energy metabolism indicators (oxygen consumption, ammonia excretion rate and swimming activity) in goldfish (Carassius auratus). To illustrate the mechanism involved, thyroid hormones and neuropeptide genes expression, such as neuropeptide Y (NPY), ghrelin, proopiomelanocortin (POMC), corticotropin-releasing fractor (CRF), cocaine and amphetamine-regulated transcript (CART), which are implicated in the regulation of feeding behavior and energy homeostasis (Matsuda, 2009), were detected. The goldfish has been widely used as an animal model in the fields of regulation of food intake (Kang et al., 2011) and the regulatory mechanisms mediated by neuropeptides have been extensively identified (Matsuda, 2009). 2. Materials and methods 2.1. Chemicals TBT chloride was obtained from Fluka A.G., Switzerland, with a purity of greater than 97%. It was dissolved in absolute ethanol to reach stock concentrations of 2.44 and 24.4 mg/mL (1 and 10 mg/mL as Sn) corresponding to molar concentrations of 8.4 and 84 nmol/ mL. All other chemicals were of analytical grade and were obtained from commercial sources. 2.2. Experimental fish Common goldfish (40.71 ± 0.31 g) were purchased from a local market (Luoyang, Henan Province, China) and were allowed to acclimate in groups of 12 in 60 L glass tanks for at least one month before onset of experiments. The tanks were kept at constant temperature (12 C), oxygenation, and light cycle (12 h light/12 h dark photoperiod), the same as conditions of waterborne exposures. This experiment was conducted in September through to October when goldfish generally experience a slow but linear somatic growth rate and little difference between male and female growth patterns (Marchant and Peter, 1986). All experiments and
handling of the animals were conducted according to the research protocols approved by the Institutional Animal Care and Use Committee, Henan University of Science and Technology. 2.3. Experimental design The groups of 12 fish in 60 L water were exposed to TBT at concentrations of 0, 2.44 or 24.4 ng/L (0, 1 or 10 ng/L as Sn) corresponding to molar concentrations of 0, 8.4 or 84 pmol/L. The control group received an equal volume of ethanol solvent (1 ml/L). The water containing the different TBT concentrations in each group was changed by half every day. To ensure agreement between nominal and actual concentrations of TBT, water samples collected after 12 h of changing the water and were analyzed using a gas chromatograph equipped with a flame photometric detector (GC-FPD) based on the method of Jiang et al. (2001). The actual concentrations of TBT in the control, 2.44 and 24.4 ng/L of TBT group were below the detection limit (0.1 ng/L), 2.15 ± 0.15 and 22.3 ± 0.59 ng/L, respectively. In order to keep track of fish throughout the experiment, each fish of a tank was marked by differential cutting of the dorsal, pelvic and caudal fins. No significant changes were found in energy metabolism and swimming activity among fish with non-cutting or differential cutting of fins (Data not given). Fish were fed on commercial feed (Jinyanhong Aquarium Products Co., Hangzhou, China). The control group and TBT exposure groups were fed ad libitum daily with pellets. According to Mennigen et al. (2010), food intake was calculated by feeding the tank 30 pellets at a time; once the fish ate all pellets, they were given more with this continuing for 30 min or until the fish no longer ate. There were also 2 pair-fed groups and a fasted group. The pair-fed groups were fed the same amount as the respective TBT-exposed groups and not exposed to TBT. The fasted group received no food or TBT for the duration of the 54-d experiment. The pair-fed group was included to confirm whether the observed changes of bodyweight are solely due to differences in food intake induced by TBT. The feeding process was repeated every day until 3 d before sampling. All fish survived the exposure period, with no signs of negative health effects. After exposure for 54 d, oxygen consumption, ammonia excretion rate and swimming activity of each individual fish were determined, after which fish were sampled. Weight gain of each individual fish was calculated by subtracting the initial weight from the final weight. The exposure and measurements including weight gain, oxygen consumption, ammonia excretion rate and swimming activity were replicated twice, and similar results were obtained. Brains and livers were flash-frozen in liquid nitrogen and stored at 80 Cfor further analysis. Blood was collected from the caudal vessels and centrifuged at 4 C for 15 min to separate the serum, which was stored at 80 C until it was assayed for triiodothyronine (T3) and thyroxine (T4). 2.4. Butyltins analysis The quantification of TBT and its metabolites dibutyltin (DBT) and monobutyltin (MBT) in liver and brain samples was carried out as described by Jiang et al. (2001) and Zhou et al. (2001). The quantification of butyltins involved extraction, derivatization, clean-up steps, and analysis by GC-FPD. The recoveries of TBT, DBT, and TBT were 108.3, 97.9, and 89.2%, respectively. The minimum detectable concentrations were 7.2 ng/g for TBT, 6.8 ng/g for DBT, and 7.8 ng/g for MBT, respectively. 2.5. Reverse-transcriptional real-time PCR (RT-PCR) The genes (NPY, POMC, ghrelin, CART-1, CART-2, CRH, apelin)
J. Zhang et al. / Chemosphere 152 (2016) 221e228
expression of 6 fish from each group was determined by quantitative real-time PCR using SYBR Green chemistry on a Rotor-Gene 3000 (Applied Biosystems, USA) using EFa as internal control according to the methods of our laboratory (Zhang et al., 2011). The GenBank accession numbers for the selected genes and primer sequences indicated in Table 1. 2.6. The oxygen consumption, ammonia excretion rate, and swimming activity Every acclimated goldfish was placed in a 5-L glass respiration chamber at 15 C. At the initial and final time, the oxygen concentrations were recorded with an oxygen electrode (WTW Oxi325 Oximeter, Weilheim, Germany) and the ammonia concentrations were determined using the salicylateehypochlorite assay at 650 nm (Verdouw et al., 1978). The oxygen consumption (QO, mg/ g$h) and ammonia excretion rate (QT, mg/g h) were calculated following the expression: QO ¼ V (A1eA2)/(W T) and QT ¼ V (NTeNO)/(W T). Where W is body weight (g), V is the volume of water (L), T is test time (h). A1 and A2 are the initial and final oxygen concentration (mg/L), respectively. NT and NO are the final and initial concentration of NH3eN (mg/L), respectively. Swimming activity was determined as described by Reyhanian et al. (2011). It was recorded as number of middle lines of a grid crossed, both horizontally and vertically, during 1 min, starting 30 s after start of the recording. 2.7. Thyroid hormone assay Plasma thyroid hormone levels of 6 fish from each group were measured by using a commercial radio-immunoassay kit (Furui Biological Engineering Co., Beijing, China). The intra- and interassay coefficients of variation were less than 10% and 15% for both T4 and T3 antibodies. Cross reactivity between T3 and T4 antibodies was less than 0.5%. 2.8. Statistical analysis All statistical analysis was done in R statistical platform, version 3.0 (2013). Data were analyzed using linear mixed-effects models through the nlme package (Pinheiro et al., 2013). The nlme integrated the exposures as fixed factors and the containers as random effect. Significant differences between exposures were checked by ANOVA followed by the Tukey post hoc multiple comparison test and a pre-specified significance level of 5% was used. 3. Results 3.1. Butyltins in the livers and brains No TBT and its metabolites (DBT and MBT) were found in both
223
livers and brains from the control, pair-fed, and fasted groups (Table 2). In the 2.44 ng/L of TBT group, the average of TBT, DBT and MBT was 7.30, 11.4 and 1.6 mg/g w.w, respectively, in the livers, and 3.12, 5.34 and 0.7 mg/g w.w, respectively, in the brains (Table 2). In the 24.4 ng/L of TBT group, the average of TBT, DBT and MBT was 31.54, 74.24 and 13.97 mg/g w.w, respectively, in the livers, and 10.76, 36.44 and 5.73 mg/g w.w, respectively, in the brains (Table 2). 3.2. Body weight and food intake The body weight was significantly increased in the 2.44 and 24.4 ng/L of TBT exposure groups and their pair-fed groups over the 54-d exposure (Fig. 1A). The groups exposed to 2.44 and 24.4 ng/L of TBT gained 9.25% and 8.73% body weight, respectively, while over the same period, control fish only gained 5.51% body weight. The fasted group showed a 6.97% weight loss which was significantly different from all other groups. No change between the 24.4 ng/L of TBT groups and its respective pair-fed group was observed. However, a lower increase in body weight was observed in fish exposed to 2.44 ng/L of TBT when compared to its pair-fed group (Fig. 1A). In addition to weight changes, daily food intake was measured over the 54-d experiment; pair-fed groups received the same food mass as their respective TBT-exposed groups (Fig. 1B). After 16d exposure, the food intake in both TBT exposure groups was increased compared with the control group. The average of daily food intake was 0.36 g/g body weight in the control group while it was 0.43 and 0.41 g/g body weight in the 2.44 and 24.4 ng/L of TBT exposure groups, respectively. 3.3. Neuropeptides expression After a 54-d exposure, the brain expression of NPY mRNA was significantly increased in a dose-dependent manner compared to the control (Fig. 2A), while the expression of POMC, ghrelin, CART1, CART2, CRF mRNAs was significantly reduced in a dose-dependent manner compared to the control (Fig. 2BeE). Tributyltin exposure also increased the expression of apelin in the brain in a dose dependent manner compared to the control. Exposure to 24.4 ng/L of TBT resulted in a significant increase in the expression of apelin compared to the control (Fig. 2F). 3.4. Energy metabolism indicators TBT exposure significantly increased the oxygen consumption in the 2.44 ng/L TBT group by 1.34-fold compared to the control. However, no significant change of oxygen consumption was observed in the 24.4 ng/L of TBT group compared to the control (Fig. 3A). The similar pattern was observed for ammonia excretion rate and swimming activity, where the significant increases were only found in the 2.44 ng/L of TBT group compared to the control (Fig. 3BeC).
Table 1 Sequences of forward and reverse primers used for real-time RT-PCR. Gene
Accession #
Forward primer
Reverse primer
Size (bp)
NPY POMC Ghrelin CART-1 CART-2 CRF apelin EFa
M87297 AJ431209 AF454390 AY033816 AY033817 AF098629 FJ755698 AB056104
AGATGCCGTTGAACAGATTG CCTTCTCACGCTCTTCAA CAGCCATTCAGAGTGTT ATTCAGGGTGCCGAGATG AAAGCGAACGAGTCAGA CTGCTCGTTGCCTTTCCAC GCCTGAAGAGTGATGTCC ATGCCCTCCTGGCTTTCAC
TGGAAGTGATAGAGTTGCCT CCTATCCACTTCTCCCATTA TGAGCAGGACTGAGGAAGC GATTCGGGTCCTTTGGGT CACTTGTCAGGTTTGGGTC TCCAAGCGACCGATGTTCC GATGAGTGGCTTGTCCTG GCAGGGTTGTAGCCGATT
291 86 157 85 91 275 86 151
224
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Table 2 Butyltins in the livers and brains of goldfish (Carassius auratus) from control, TBT (2.44 and 24.4 ng/L), pair-fed and fasted groups over the 54-d experiment. TBT (mg/g w.w)
Control 2.44 ng/L TBT Pair-fed with 2.44 ng/L TBT 24.4 ng/L TBT Pair-fed with 24.4 ng/L TBT Fasted group
DBT (mg/g w.w)
MBT (mg/g w.w)
Livers
Brains
Livers
Brains
Livers
Brains
N.D. 7.30 ± 1.27 N.D. 31.54 ± 5.28 N.D. N.D.
N.D. 3.12 ± 0.58 N.D. 10.76 ± 2.29 N.D. N.D.
N.D. 11.4 ± 1.64 N.D. 74.24 ± 9.80 N.D. N.D.
N.D. 5.34 ± 1.21 N.D. 36.44 ± 8.52 N.D. N.D.
N.D. 1.6 ± 0.24 N.D. 13.97 ± 2.05 N.D. N.D.
N.D. 0.7 ± 0.11 N.D. 5.73 ± 0.93 N.D. N.D.
The Data are presented as mean ± S.E. (n ¼ 6). N.D. indicates that the concentration was below the detection limits.
Fig. 1. (A) Percent weight gain or loss of goldfish (Carassius auratus) following a 54-d exposure to TBT (2.44 and 24.4 ng/L) compared with control (ad libitum feeding) and fasted groups. Data are presented as mean ± S.E. (n ¼ 12). Means of exposures not sharing a common letter are significantly different at p < 0.05. (B) Daily measurements of food intake of control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment.
3.5. T3 and T4 in the serum
4. Discussion
TBT exposure resulted in a significant increase of T3 level by 1.24-fold in the 2.44 ng/L of TBT group compared to the control, while the T3 level was significantly decreased by 0.67-fold in the 24.4 ng/L of TBT group compared to the control (Fig. 4A). In addition, exposure to 2.44 ng/L of TBT resulted in a significant increase (by 1.59-fold) of T4 level, whereas 24.4 ng/L of TBT did not significantly affect T4 level compared to the control (Fig. 4B).
In the present study, waterborne TBT at the concentrations used increased the weight gain of goldfish, which is consistent with the previous work (Meador et al., 2011) that TBT elicits obesogen responses in juvenile Chinook salmon. TBT is considered as a kind of obesogen, chiefly for its action on fat tissue inducing the differentiation of preadipocytes from adipocytes (Inadera and Shimomura, 2005; Kanayama et al., 2005). Our study demonstrated that TBT also act on feeding and energy metabolism in fish, which might promote obesogenic responses.
J. Zhang et al. / Chemosphere 152 (2016) 221e228
225
Fig. 2. The brain mRNA expression of NPY (A), POMC (B), ghrelin (C), CART (D), CRF (E) and apelin (F) in the goldfish (Carassius auratus) exposed to control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment. The Figures show the mRNA levels normalized to the levels of EFa (mean ± S.E., n ¼ 6). Means of exposures not sharing a common letter are significantly different at p < 0.05.
It is reported that TBT can be transported to the brains of fish by axonal transport (Rouleau et al., 2003). In the present study, TBT and its metabolites were detected from the brains exposed to TBT, while TBT and its metabolites were below the detection limit in the control, pair-fed, and fasted groups. Thus, the butyltin in the brains of the exposure groups should mostly relate to the amount of TBT administrated, not the water and food used. The enhanced accumulation of the butyltin in the brains might negatively impact the nervous system, such as neuropeptide. NPY has been implicated in the regulation of food intake as a powerful orexigenic neuropeptide in goldfish (Volkoff and Peter, 2001a). The observed increases of NPY mRNA in the brains of fish exposed to TBT are associated with the observed increases of food intake and weight gains. In the melanocortin system, POMC-derived peptides such as the family of melanocyte-stimulating hormones peptides, bind to melanocortin receptor, resulting in an anorexigenic effect (Bertile and Raclot, 2006). In addition, POMC expression can be inhibited by NPY, which would result in orexigenic effects (Garcia de Yebenes et al., 1995). In the present study, we observed that TBT exposure led to a significant decrease of POMC expression, which could also explain
the observed increases of food intake and weight gains in the fish exposed to TBT. In most fish species, ghrelin treatment appears to €nsson, promote food intake and a more positive energy balance (Jo 2013). However, it is reported that ghrelin may be a long-term indicator of energy status rather than a meal-related signal in fish (Fox et al., 2009). Thus, the decrease of ghrelin expression might be associated with the increase of weight gain after TBT exposure. Two forms of CART peptide precursors, CART1 and CART2 have been identified in goldfish (Volkoff and Peter, 2001b). CART appears to have a number of physiological functions including the inhibition of food intake, the stimulation of energy expenditure and the regulation of hypothalamicepituitary axes (Rogge et al., 2008). CRH is also implicated in the regulation of energy homeostasis. Studies of the effect of CRH on feeding behavior in goldfish have shown that it acts as a powerful anorexigenic peptide (Matsuda et al., 2008). The decrease of CART1, CART2, and CRH can contribute to the increases of food intake and weight gains of fish exposed to TBT. Apelin is upregulated in obese humans and mice (Dray et al., 2008) and dysregulation of apelin might be involved in the development of obesity (Rayalam et al., 2008). In goldfish, it is reported that apelin
226
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Fig. 4. The levels of T3 (A) and T4 (B) in the serum of goldfish (Carassius auratus) exposed to control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment. Data are presented as mean ± S.E. (n ¼ 6). Means of exposures not sharing a common letter are significantly different at p < 0.05.
Fig. 3. The oxygen consumption (A), ammonia excretion rate (B), and swimming activity (C) of goldfish (Carassius auratus) exposed to control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment. Data are presented as mean ± S.E. (n ¼ 12). Means of exposures not sharing a common letter are significantly different at p < 0.05.
acts as an orexigenic factor (Volkoff and Wyatt, 2009). Thus, like NPY, the increases of apelin expression in the brains of fish exposed to TBT are associated with the observed increases of food intake and weight gains. It is possible to evaluate the energy spent during a certain period of time to maintain its vital processes based on the amount of oxygen consumed and ammonium excreted by an animal for the same period (Barbieri and Paes, 2011). It is reported that oxygen consumption in combination with measurements of ammonia
excretion can be used to assess the effects of environmental perturbations on the energy metabolism of fish (De Boeck et al., 1995). In the present study, at the 2.44 ng/L of TBT group, we observed an increasing oxygen uptake rate and ammonia excretion rate reflecting an increased metabolic rate. The locomotor performance is often attributed to changes in metabolic capacity. In the present study, the swimming activity was also increased at the 2.44 ng/L of TBT group. However, no changes of oxygen uptake rate, ammonia excretion rate, and swimming activity was found at the 24.4 ng/L of TBT group, which indicated a complex disrupting effect on energy metabolism of TBT. It is reported that the non-linear responses are remarkably common in studies of endocrine disruptors and many different mechanisms might be involved (Vandenberg et al., 2012). In the present study, the extra energy expenditure induced by 2.44 ng/L of TBT might be a stress response. In fish, mobilization of energy sources is an adaptive strategy adopted to avoid stress (Wendelaar Bonga, 1997). Energy is required to neutralize the effects of toxicants and maintain the animal homeostasis (Giesy and Graney, 1989). Exposure of wild organisms to pollutants has generally been reported to increase metabolic rate (McGeer et al., 2000; Campbell et al., 2002). No changes of these energy metabolism indicators at the 24.4 ng/L of TBT group might be due to the cytological damage of TBT. Interestingly, a lower increase in body weight was observed in fish exposed to 2.44 ng/L of TBT when compared to its pair-fed group, which might be associated with the increase of metabolic rate and swimming activity induced by TBT.
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Thyroid hormone, including T3 and T4, is predominately recognized as a regulator of growth and development in fish (Tata, 2011), but there is growing evidence that thyroid hormone also stimulates metabolism in adult fish (Johnson and Lema, 2011; Little and Seebacher, 2013). In the present study, the serum T3 and T4 both increased at 2.44 ng/L of TBT group compared to the control, which is in accordance with the increases of energy metabolism indicators at 2.44 ng/L of TBT group. At the 24.4 ng/L of TBT group, no change of T4 and a decrease of T3 were found when compared to the control, which indicated that TBT at a higher level might have probably disrupted the synthesis or secretion of the circulating thyroid hormone and the conversion of T4 to T3. Environmental contaminants are thought to affect the synthesis, transport and metabolism of thyroid hormone by disrupting the thyroid system in fish (Coimbra et al., 2005; Morgado et al., 2009). In our previous study, a mild to severe damage of the thyroid gland were observed in fish exposed to 24.4 and 244 ng/L (10 and 100 ng/L as Sn) of TBT, but not in fish exposed to 2.44 ng/L (1 ng/L as Sn) of TBT (Zhang et al., 2009). Thus, no change of T4 and a decrease of T3 observed in the present study might due to the thyroid dysfunction induced by TBT exposure. In conclusion, waterborne TBT at environmentally relevant concentrations increased the weight gains of goldfish. TBT exposure also increased the food intake, which might be associated with the changes of brain neuropeptides expression. Moreover, TBT also disturbed the energy metabolism indicators, which might related to the disruption of thyroid hormone. These results suggest that the TBT might inappropriately alter feeding and energy metabolism to promote obesity in fish. Acknowledgments This work was supported by the National Natural Science Foundation (41301562 and U1304329) of China. References Antizar-Ladislao, B., 2008. Environmental levels, toxicity and human exposure to tributyltin (TBT)-contaminated marine environment. A review. Environ. Int. 34, 292e308. Barbieri, E., Paes, E.T., 2011. The use of oxygen consumption and ammonium excretion to evaluate the toxicity of cadmium on Farfantepenaeus paulensis with respect to salinity. Chemosphere 84, 9e16. Bertile, F., Raclot, T., 2006. The melanocortin system during fasting. Peptides 27, 291e300. Campbell, H.A., Handy, R.D., Sims, D.W., 2002. Increased metabolic cost of swimming and consequent alterations to circadian activity in rainbow trout (Oncorhynchus mykiss) exposed to dietary copper. Can. J. Fish. Aquat. Sci. 59, 768e777. Cao, D., Jiang, G., Zhou, Q., Yang, R., 2009. Organotin pollution in China: an overview of the current state and potential health risk. J. Environ. Manag. 90, S16eS24. Coimbra, A.M., Reis-Henriques, M.A., Darras, V.M., 2005. Circulating thyroid hormone levels and iodothyronine deiodinase activities in Nile tilapia (Oreochromis niloticus) following dietary exposure to Endosulfan and Aroclor 1254. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 141, 8e14. De Boeck, G., De Smet, H., Blust, R., 1995. The effect of sublethal levels of copper on oxygen consumption and ammonia excretion in the common carp, Cyprinus carpio. Aquat. Toxicol. 32, 127e141. on, M., Cani, P.D., Dray, C., Knauf, C., Daviaud, D., Waget, A., Boucher, J., Bule , C., Guigne , C., Carpe ne , C., Burcelin, R., Castan-Laurell, I., Valet, P., 2008. Attane Apelin stimulates glucose utilization in normal and obese insulin-resistant mice. Cell Metab. 8, 437e445. Fox, B.K., Breves, J.P., Hirano, T., Grau, E.G., 2009. Effects of short- and long-term fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Domest. Anim. Endocrinol. 37, 1e11. Garcia de Yebenes, E., Li, S., Fournier, A., St-Pierre, S., Pelletier, G., 1995. Regulation of proopiomelanocortin gene expression by neuropeptide Y in the rat arcuate nucleus. Brain Res. 674, 112e116. Giesy, J.P., Graney, R.L., 1989. Recent developments in the intercomparisons of acute and chronic bioassays and bioindicators. Hydrobiologia 188, 21e60. Grün, F., Watanabe, H., Zamanian, Z., Maeda, L., Arima, K., Chubacha, R., Gardiner, D.M., Iguchi, T., Kanno, J., Blumberg, B., 2006. Endocrine disrupting organotin compounds are potent inducers of adipogenesis in vertebrates. Mol.
227
Endocrinol. 20, 2141e2155. Harino, H., Fukushima, M., Kawai, S., 2000. Accumulation of butyltin and phenyltin compounds in various fish species. Arch. Environ. Contam. Toxicol. 39, 13e19. Harino, H., O'Hara, S.C.M., Burt, G.R., Pope, N.D., Chesman, B.S., Langston, W.J., 2002. Butyltin and phenyltin compounds in eels (Anguilla anguilla). J. Mar. Biol. Assoc. U. K. 82, 893e901. Inadera, H., Shimomura, A., 2005. Environmental chemical tributyltin augments adipocyte differentiation. Toxicol. Lett. 159, 226e234. Jiang, G.B., Zhou, Q.F., Liu, J.Y., Wu, D.J., 2001. Occurrence of butyltin compounds in the waters of selected lakes, rivers and coastal environments from China. Environ. Pollut. 115, 81e87. Johnson, K.M., Lema, S.C., 2011. Tissue-specific thyroid hormone regulation of gene transcripts encoding iodothyronine deiodinases and thyroid hormone receptors in striped parrotfish (Scarus iseri). Gen. Comp. Endocrinol. 172, 505e517. €nsson, E., 2013. The role of ghrelin in energy balance regulation in fish. Gen. Jo Comp. Endocrinol. 187, 79e85. Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., Nishikawa, J., 2005. Organotin compounds promote adipocyte differentiation as agonists of the peroxisome proliferator-activated receptor gamma/retinoid X receptor pathway. Mol. Pharmacol. 67, 766e774. Kang, K.S., Yahashi, S., Matsuda, K., 2011. The effects of ghrelin on energy balance and psychomotor activity in a goldfish model: an overview. Int. J. Pept. 2011, 171034. Little, A.G., Seebacher, F., 2013. Thyroid hormone regulates muscle function during cold acclimation in zebrafish (Danio rerio). J. Exp. Biol. 216, 3514e3521. Marchant, T.A., Peter, R.E., 1986. Seasonal variation in body growth rates and circulating levels of growth hormone in goldfish, Carassius auratus. J. Exp. Zool. 237, 231e239. Matsuda, K., 2009. Recent advances in the regulation of feeding behavior by neuropeptides in fish. Ann. N. Y. Acad. Sci. 1163, 241e250. Matsuda, K., Kojima, K., Shimakura, S., Wada, K., Maruyama, K., Uchiyama, M., Kikuyama, S., Shioda, S., 2008. Corticotropin-releasing hormone mediates alpha-melanocyte-stimulating hormone-induced anorexigenic action in goldfish. Peptides 29, 1930e1936. Matthiessen, P., 2008. An assessment of endocrine disruption in mollusks and the potential for developing internationally standardized mollusk life cycle test guidelines. Integr. Environ. Assess. Manag. 4, 274e284. McAllister, B.G., Kime, D.E., 2003. Early life exposure to environmental levels of the aromatase inhibitor tributyltin causes masculinisation and irreversible sperm damage in zebrafish (Danio rerio). Aquat. Toxicol. 65, 309e316. McGeer, J.C., Szebedinszky, C., McDonald, D.G., Wood, C.M., 2000. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout. 1: ionoregulatory disturbance and metabolic costs. Aquat. Toxicol. 50, 231e243. Meador, J.P., Sommers, F.C., Cooper, K.A., Yanagida, G., 2011. Tributyltin and the obesogen metabolic syndrome in a salmonid. Environ. Res. 111, 50e56. Mennigen, J.A., Sassine, J., Trudeau, V.L., Moon, T.W., 2010. Waterborne fluoxetine disrupts feeding and energy metabolism in the goldfish Carassius auratus. Aquat. Toxicol. 100, 128e137. Morgado, M.A., Campinho, R., Costa, R., Jacinto, D.M., 2009. Power disruption of the thyroid system by diethylstilbestrol and ioxynil in the sea bream (Sparus aurata). Aquat. Toxicol. 92, 271e280. Nakayama, K., Oshima, Y., Yamaguchi, T., Tsuruda, Y., Kang, I.J., Kobayashi, M., Mada, N., Honjo, T., 2004. Fertilization success and sexual behavior in male medaka, Oryzias latipes, exposed to tributyltin. Chemosphere 55, 1331e1337. Pinheiro, J., Bates, D., DebRoy, S., Sarkar, D., R Core Development Team, 2013. nlme: Linear and Nonlinear Mixed Effects Models. R Core Development Team. R Package Version 3.1, p. 109. Rayalam, S., Della-Fera, M.A., Krieg, P.A., Cox, C.M., Robins, A., Baile, C.A., 2008. A putative role for apelin in the etiology of obesity. Biochem. Biophys. Res. Commun. 368, 815e819. n, H., Reyhanian, N., Volkova, K., Hallgren, S., Bollner, T., Olsson, P.E., Olse €llstro €m, I.P., 2011. 17a-Ethinyl estradiol affects anxiety and shoaling behavior Ha in adult male zebra fish (Danio rerio). Aquat. Toxicol. 105, 41e48. Rogge, G., Jones, D., Hubert, G.W., Lin, Y., Kuhar, M.J., 2008. CART peptides: regulators of body weight, reward and other functions. Nat. Rev. Neurosci. 9, 747e758. Rouleau, C., Xiong, Z.H., Pacepavicius, G., Huang, G.L., 2003. Uptake of waterborne tributyltin in the brain of fish: axonal transport as a proposed mechanism. Environ. Sci. Technol. 37, 3298e3302. Shimasaki, Y., Kitano, T., Oshima, Y., Inoue, S., Imada, N., Honjo, T., 2003. Tributyltin causes masculinization in fish. Environ. Toxicol. Chem. 22, 141e144. Shue, M.F., Chen, T.C., Bellotindos, L.M., Lu, M.C., 2014. Tributyltin distribution and producing androgenic activity in water, sediment, and fish muscle. J. Environ. Sci. Health B 49, 432e438. Tata, J.R., 2011. Looking for the mechanism of action of thyroid hormone. J. Thyroid. Res. 2011, 730630. Vandenberg, L.N., Colborn, T., Hayes, T.B., Heindel, J.J., Jacobs Jr., D.R., Lee, D.H., Shioda, T., Soto, A.M., vom Saal, F.S., Welshons, W.V., Zoeller, R.T., Myers, J.P., 2012. Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr. Rev. 33, 378e455. Verdouw, H., van Echteld, C.J.A., Dekkers, E.M.J., 1978. Ammonia determination based on indophenol formation with sodium salicylate. Water Res. 12, 399e402. Volkoff, H., Peter, R.E., 2001a. Interactions between orexin A, NPY and galanin in the control of food intake of the goldfish, Carassius auratus. Regul. Pept. 101, 59e72. Volkoff, H., Peter, R.E., 2001b. Characterization of two forms of cocaine- and
228
J. Zhang et al. / Chemosphere 152 (2016) 221e228
amphetamine-regulated transcript (CART) peptide precursors in goldfish: molecular cloning and distribution, modulation of expression by nutritional status, and interactions with leptin. Endocrinology 142, 5076e5088. Volkoff, H., Wyatt, J.L., 2009. Apelin in goldfish (Carassius auratus): cloning, distribution and role in appetite regulation. Peptides 30, 1434e1440. Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591e625. Zhang, J., Sun, P., Kong, T., Yang, F., Guan, W., 2016. Tributyltin promoted hepatic steatosis in zebrafish (Danio rerio) and the molecular pathogenesis involved. Aquat. Toxicol. 170, 208e215. Zhang, J., Zuo, Z., Chen, Y., Zhao, Y., Hu, S., Wang, C., 2007. Effect of tributyltin on the development of ovary in female cuvier (Sebastiscus marmoratus). Aquat. Toxicol. 83, 174e179. Zhang, J., Zuo, Z., He, C., Wu, D., Chen, Y., Wang, C., 2009. Inhibition of thyroidal
status related to depression of testicular development in Sebastiscus marmoratus exposed to tributyltin. Aquat. Toxicol. 94, 62e67. Zhang, J., Zuo, Z., Wang, Y., Yu, A., Chen, Y., Wang, C., 2011. Tributyltin chloride results in dorsal curvature in embryo development of Sebastiscus marmoratus via apoptosis pathway. Chemosphere 82, 437e442. Zhang, K.G., Shi, J.B., He, B., Xu, W.H., Li, X.D., Jiang, G.B., 2013. Organotin compounds in surface sediments from selected fishing ports along he Chinese coast. China Sci. Bull. 58, 231e237. Zhou, Q.F., Jiang, G.B., Liu, J.Y., 2001. Small-scale survey on the contamination status of butyltin compounds in seafoods collected from seven Chinese cities. J. Agric. Food Chem. 49, 4287e4291. Zuo, Z., Chen, S., Wu, T., Zhang, J., Su, Y., Chen, Y., Wang, C., 2011. Tributyltin causes obesity and hepatic steatosis in male mice. Environ. Toxicol. 26, 79e85.
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
Tributyltin disrupts feeding and energy metabolism in the goldfish (Carassius auratus) Jiliang Zhang*, Ping Sun, Fan Yang, Tao Kong, Ruichen Zhang Henan Open Laboratory of Key Subjects of Environmental and Animal Products Safety, College of Animal Science and Technology, Henan University of Science and Technology, Henan, China
h i g h l i g h t s Tributyltin increased the weight gain and food intake in fish. The neuropeptides expression showed orexigenic effects after tributyltin exposure. Tributyltin disturbed the energy metabolism in fish. Tributyltin might inappropriately alter feeding and energy metabolism to induce obesity.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 August 2015 Received in revised form 28 February 2016 Accepted 29 February 2016 Available online 10 March 2016
Tributyltin (TBT) can induce obesogen response. However, little is known about the adverse effects of TBT on food intake and energy metabolism. The present study was designed to investigate the effects of TBT, at environmental concentrations of 2.44 and 24.4 ng/L (1 and 10 ng/L as Sn), on feeding and energy metabolism in goldfish (Carassius auratus). After exposure for 54 d, TBT increased the weight gain and food intake in fish. The patterns of brain neuropeptide genes expression were in line with potential orexigenic effects, with increased expression of neuropeptide Y and apelin, and decreased expression of pro-opiomelanocortin, ghrelin, cocaine and amphetamine-regulated transcript, and corticotropinreleasing factor. Interestingly, the energy metabolism indicators (oxygen consumption, ammonia exertion and swimming activity) and the serum thyroid hormones were all significantly increased at the 2.44 ng/L TBT group in fish. However, no changes of energy metabolism indicators or a decrease of thyroid hormones was found at the 24.4 ng/L TBT group, which indicated a complex disrupting effect on metabolism of TBT. In short, TBT can alter feeding and energy metabolism in fish, which might promote the obesogenic responses. © 2016 Elsevier Ltd. All rights reserved.
Handling Editor: Jim Lazorchak Keywords: Tributyltin Goldfish Food intake Neuropeptide Thyroid hormone
1. Introduction Tributyltin (TBT), an organotin derivative, possesses broadspectrum biocidal properties. It has been extensively used as antifouling agents in paints applied to vessels and aquaculture nets. Aquatic pollution resulting from its usage has been of great concern due to its bioaccumulation potential, persistence in sediment up to several years, and highly toxic effects on nontarget aquatic life. Although TBT has been banned from paints in the European Union since 2003, it is still found at high levels in water ecosystems and
* Corresponding author. College of Animal Science and Technology, Henan University of Science and Technology, 70 Tianjin Road, Luoyang, Henan, 471003, China. E-mail address: [email protected] (J. Zhang). http://dx.doi.org/10.1016/j.chemosphere.2016.02.127 0045-6535/© 2016 Elsevier Ltd. All rights reserved.
causes negative effects in organisms (Antizar-Ladislao, 2008). It is reported that some aquatic environments of China had been seriously polluted by TBT and its concentrations from water samples range from below the detection limit to hundreds of ng/L as Sn (Cao et al., 2009; Zhang et al., 2013). In fishes, the concentrations of TBT range from 11 to 182 mg/kg wet weight in the muscle tissues of 11 species from Japan (Harino et al., 2000), and from 0.161 to 0.847 mg/ g dry weight in the livers of eels (Anguilla anguilla) from the Thames Estuary (Harino et al., 2002), from 26.35 to 194.22 ng/g wet weight in the muscle tissues from Kaohsiung Harbor and Kaoping River estuary of Taiwan (Shue et al., 2014). Many researches on the effects of TBT are focused on reproductive toxicity. It has been a longstanding issue that TBT causes imposex in mollusks (Matthiessen, 2008). In fish, TBT is reported to alter the sex ratio in favor of males (McAllister and Kime, 2003;
222
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Shimasaki et al., 2003), affect sexual behavior (Nakayama et al., 2004), and inhibit the gonad development (Zhang et al., 2007, 2009). Recently, TBT is also shown to be a potent inducer of adipogenesis, which is a novel aspect of endocrine disruption. It is reported that TBT promotes adipogenesis and induces the differentiation of murine preadipocyte cells to adipocytes (Inadera and Shimomura, 2005; Kanayama et al., 2005). Furthermore, in-utero exposure to TBT increases lipid accumulation and maturation of adipocytes in mice and induces ectopic adipocyte formation in exposed Xenopus laevis (Grün et al., 2006). Chronic and repeat exposure to low doses of TBT results in obesity and hepatic steatosis in mice (Zuo et al., 2011). Despite the reported evidences in mammals, little is known on the ability of TBT in aquatic organisms, which are often exposed to significant concentrations of TBT. Interestingly, an increase in whole-body lipid content along with an increase of lipid related plasma parameters is observed in juvenile chinook salmon (Oncorhynchus tshawytscha) exposed to TBT (Meador et al., 2011). In our previous study, TBT induced hepatic steatosis by increasing the gene expression associated with lipid transport, lipid storage, lipiogenic enzymes and lipiogenic factors in the livers of zebrafish (Danio rerio) (Zhang et al., 2016). These findings suggest that TBT can also act on the regulation of lipogenesis and induce obesogenic responses in fish. Obesity is associated with overeating or inactivity, however, little is known about the effects of TBT exposure on feeding and energy metabolism. We hypothesized that TBT exposure might alter feeding and energy metabolism and thus promote obesogenic responses. To address the issue, we evaluated the effects of TBT at concentrations of 1 and 10 ng/L (as Sn) on food intake and energy metabolism indicators (oxygen consumption, ammonia excretion rate and swimming activity) in goldfish (Carassius auratus). To illustrate the mechanism involved, thyroid hormones and neuropeptide genes expression, such as neuropeptide Y (NPY), ghrelin, proopiomelanocortin (POMC), corticotropin-releasing fractor (CRF), cocaine and amphetamine-regulated transcript (CART), which are implicated in the regulation of feeding behavior and energy homeostasis (Matsuda, 2009), were detected. The goldfish has been widely used as an animal model in the fields of regulation of food intake (Kang et al., 2011) and the regulatory mechanisms mediated by neuropeptides have been extensively identified (Matsuda, 2009). 2. Materials and methods 2.1. Chemicals TBT chloride was obtained from Fluka A.G., Switzerland, with a purity of greater than 97%. It was dissolved in absolute ethanol to reach stock concentrations of 2.44 and 24.4 mg/mL (1 and 10 mg/mL as Sn) corresponding to molar concentrations of 8.4 and 84 nmol/ mL. All other chemicals were of analytical grade and were obtained from commercial sources. 2.2. Experimental fish Common goldfish (40.71 ± 0.31 g) were purchased from a local market (Luoyang, Henan Province, China) and were allowed to acclimate in groups of 12 in 60 L glass tanks for at least one month before onset of experiments. The tanks were kept at constant temperature (12 C), oxygenation, and light cycle (12 h light/12 h dark photoperiod), the same as conditions of waterborne exposures. This experiment was conducted in September through to October when goldfish generally experience a slow but linear somatic growth rate and little difference between male and female growth patterns (Marchant and Peter, 1986). All experiments and
handling of the animals were conducted according to the research protocols approved by the Institutional Animal Care and Use Committee, Henan University of Science and Technology. 2.3. Experimental design The groups of 12 fish in 60 L water were exposed to TBT at concentrations of 0, 2.44 or 24.4 ng/L (0, 1 or 10 ng/L as Sn) corresponding to molar concentrations of 0, 8.4 or 84 pmol/L. The control group received an equal volume of ethanol solvent (1 ml/L). The water containing the different TBT concentrations in each group was changed by half every day. To ensure agreement between nominal and actual concentrations of TBT, water samples collected after 12 h of changing the water and were analyzed using a gas chromatograph equipped with a flame photometric detector (GC-FPD) based on the method of Jiang et al. (2001). The actual concentrations of TBT in the control, 2.44 and 24.4 ng/L of TBT group were below the detection limit (0.1 ng/L), 2.15 ± 0.15 and 22.3 ± 0.59 ng/L, respectively. In order to keep track of fish throughout the experiment, each fish of a tank was marked by differential cutting of the dorsal, pelvic and caudal fins. No significant changes were found in energy metabolism and swimming activity among fish with non-cutting or differential cutting of fins (Data not given). Fish were fed on commercial feed (Jinyanhong Aquarium Products Co., Hangzhou, China). The control group and TBT exposure groups were fed ad libitum daily with pellets. According to Mennigen et al. (2010), food intake was calculated by feeding the tank 30 pellets at a time; once the fish ate all pellets, they were given more with this continuing for 30 min or until the fish no longer ate. There were also 2 pair-fed groups and a fasted group. The pair-fed groups were fed the same amount as the respective TBT-exposed groups and not exposed to TBT. The fasted group received no food or TBT for the duration of the 54-d experiment. The pair-fed group was included to confirm whether the observed changes of bodyweight are solely due to differences in food intake induced by TBT. The feeding process was repeated every day until 3 d before sampling. All fish survived the exposure period, with no signs of negative health effects. After exposure for 54 d, oxygen consumption, ammonia excretion rate and swimming activity of each individual fish were determined, after which fish were sampled. Weight gain of each individual fish was calculated by subtracting the initial weight from the final weight. The exposure and measurements including weight gain, oxygen consumption, ammonia excretion rate and swimming activity were replicated twice, and similar results were obtained. Brains and livers were flash-frozen in liquid nitrogen and stored at 80 Cfor further analysis. Blood was collected from the caudal vessels and centrifuged at 4 C for 15 min to separate the serum, which was stored at 80 C until it was assayed for triiodothyronine (T3) and thyroxine (T4). 2.4. Butyltins analysis The quantification of TBT and its metabolites dibutyltin (DBT) and monobutyltin (MBT) in liver and brain samples was carried out as described by Jiang et al. (2001) and Zhou et al. (2001). The quantification of butyltins involved extraction, derivatization, clean-up steps, and analysis by GC-FPD. The recoveries of TBT, DBT, and TBT were 108.3, 97.9, and 89.2%, respectively. The minimum detectable concentrations were 7.2 ng/g for TBT, 6.8 ng/g for DBT, and 7.8 ng/g for MBT, respectively. 2.5. Reverse-transcriptional real-time PCR (RT-PCR) The genes (NPY, POMC, ghrelin, CART-1, CART-2, CRH, apelin)
J. Zhang et al. / Chemosphere 152 (2016) 221e228
expression of 6 fish from each group was determined by quantitative real-time PCR using SYBR Green chemistry on a Rotor-Gene 3000 (Applied Biosystems, USA) using EFa as internal control according to the methods of our laboratory (Zhang et al., 2011). The GenBank accession numbers for the selected genes and primer sequences indicated in Table 1. 2.6. The oxygen consumption, ammonia excretion rate, and swimming activity Every acclimated goldfish was placed in a 5-L glass respiration chamber at 15 C. At the initial and final time, the oxygen concentrations were recorded with an oxygen electrode (WTW Oxi325 Oximeter, Weilheim, Germany) and the ammonia concentrations were determined using the salicylateehypochlorite assay at 650 nm (Verdouw et al., 1978). The oxygen consumption (QO, mg/ g$h) and ammonia excretion rate (QT, mg/g h) were calculated following the expression: QO ¼ V (A1eA2)/(W T) and QT ¼ V (NTeNO)/(W T). Where W is body weight (g), V is the volume of water (L), T is test time (h). A1 and A2 are the initial and final oxygen concentration (mg/L), respectively. NT and NO are the final and initial concentration of NH3eN (mg/L), respectively. Swimming activity was determined as described by Reyhanian et al. (2011). It was recorded as number of middle lines of a grid crossed, both horizontally and vertically, during 1 min, starting 30 s after start of the recording. 2.7. Thyroid hormone assay Plasma thyroid hormone levels of 6 fish from each group were measured by using a commercial radio-immunoassay kit (Furui Biological Engineering Co., Beijing, China). The intra- and interassay coefficients of variation were less than 10% and 15% for both T4 and T3 antibodies. Cross reactivity between T3 and T4 antibodies was less than 0.5%. 2.8. Statistical analysis All statistical analysis was done in R statistical platform, version 3.0 (2013). Data were analyzed using linear mixed-effects models through the nlme package (Pinheiro et al., 2013). The nlme integrated the exposures as fixed factors and the containers as random effect. Significant differences between exposures were checked by ANOVA followed by the Tukey post hoc multiple comparison test and a pre-specified significance level of 5% was used. 3. Results 3.1. Butyltins in the livers and brains No TBT and its metabolites (DBT and MBT) were found in both
223
livers and brains from the control, pair-fed, and fasted groups (Table 2). In the 2.44 ng/L of TBT group, the average of TBT, DBT and MBT was 7.30, 11.4 and 1.6 mg/g w.w, respectively, in the livers, and 3.12, 5.34 and 0.7 mg/g w.w, respectively, in the brains (Table 2). In the 24.4 ng/L of TBT group, the average of TBT, DBT and MBT was 31.54, 74.24 and 13.97 mg/g w.w, respectively, in the livers, and 10.76, 36.44 and 5.73 mg/g w.w, respectively, in the brains (Table 2). 3.2. Body weight and food intake The body weight was significantly increased in the 2.44 and 24.4 ng/L of TBT exposure groups and their pair-fed groups over the 54-d exposure (Fig. 1A). The groups exposed to 2.44 and 24.4 ng/L of TBT gained 9.25% and 8.73% body weight, respectively, while over the same period, control fish only gained 5.51% body weight. The fasted group showed a 6.97% weight loss which was significantly different from all other groups. No change between the 24.4 ng/L of TBT groups and its respective pair-fed group was observed. However, a lower increase in body weight was observed in fish exposed to 2.44 ng/L of TBT when compared to its pair-fed group (Fig. 1A). In addition to weight changes, daily food intake was measured over the 54-d experiment; pair-fed groups received the same food mass as their respective TBT-exposed groups (Fig. 1B). After 16d exposure, the food intake in both TBT exposure groups was increased compared with the control group. The average of daily food intake was 0.36 g/g body weight in the control group while it was 0.43 and 0.41 g/g body weight in the 2.44 and 24.4 ng/L of TBT exposure groups, respectively. 3.3. Neuropeptides expression After a 54-d exposure, the brain expression of NPY mRNA was significantly increased in a dose-dependent manner compared to the control (Fig. 2A), while the expression of POMC, ghrelin, CART1, CART2, CRF mRNAs was significantly reduced in a dose-dependent manner compared to the control (Fig. 2BeE). Tributyltin exposure also increased the expression of apelin in the brain in a dose dependent manner compared to the control. Exposure to 24.4 ng/L of TBT resulted in a significant increase in the expression of apelin compared to the control (Fig. 2F). 3.4. Energy metabolism indicators TBT exposure significantly increased the oxygen consumption in the 2.44 ng/L TBT group by 1.34-fold compared to the control. However, no significant change of oxygen consumption was observed in the 24.4 ng/L of TBT group compared to the control (Fig. 3A). The similar pattern was observed for ammonia excretion rate and swimming activity, where the significant increases were only found in the 2.44 ng/L of TBT group compared to the control (Fig. 3BeC).
Table 1 Sequences of forward and reverse primers used for real-time RT-PCR. Gene
Accession #
Forward primer
Reverse primer
Size (bp)
NPY POMC Ghrelin CART-1 CART-2 CRF apelin EFa
M87297 AJ431209 AF454390 AY033816 AY033817 AF098629 FJ755698 AB056104
AGATGCCGTTGAACAGATTG CCTTCTCACGCTCTTCAA CAGCCATTCAGAGTGTT ATTCAGGGTGCCGAGATG AAAGCGAACGAGTCAGA CTGCTCGTTGCCTTTCCAC GCCTGAAGAGTGATGTCC ATGCCCTCCTGGCTTTCAC
TGGAAGTGATAGAGTTGCCT CCTATCCACTTCTCCCATTA TGAGCAGGACTGAGGAAGC GATTCGGGTCCTTTGGGT CACTTGTCAGGTTTGGGTC TCCAAGCGACCGATGTTCC GATGAGTGGCTTGTCCTG GCAGGGTTGTAGCCGATT
291 86 157 85 91 275 86 151
224
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Table 2 Butyltins in the livers and brains of goldfish (Carassius auratus) from control, TBT (2.44 and 24.4 ng/L), pair-fed and fasted groups over the 54-d experiment. TBT (mg/g w.w)
Control 2.44 ng/L TBT Pair-fed with 2.44 ng/L TBT 24.4 ng/L TBT Pair-fed with 24.4 ng/L TBT Fasted group
DBT (mg/g w.w)
MBT (mg/g w.w)
Livers
Brains
Livers
Brains
Livers
Brains
N.D. 7.30 ± 1.27 N.D. 31.54 ± 5.28 N.D. N.D.
N.D. 3.12 ± 0.58 N.D. 10.76 ± 2.29 N.D. N.D.
N.D. 11.4 ± 1.64 N.D. 74.24 ± 9.80 N.D. N.D.
N.D. 5.34 ± 1.21 N.D. 36.44 ± 8.52 N.D. N.D.
N.D. 1.6 ± 0.24 N.D. 13.97 ± 2.05 N.D. N.D.
N.D. 0.7 ± 0.11 N.D. 5.73 ± 0.93 N.D. N.D.
The Data are presented as mean ± S.E. (n ¼ 6). N.D. indicates that the concentration was below the detection limits.
Fig. 1. (A) Percent weight gain or loss of goldfish (Carassius auratus) following a 54-d exposure to TBT (2.44 and 24.4 ng/L) compared with control (ad libitum feeding) and fasted groups. Data are presented as mean ± S.E. (n ¼ 12). Means of exposures not sharing a common letter are significantly different at p < 0.05. (B) Daily measurements of food intake of control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment.
3.5. T3 and T4 in the serum
4. Discussion
TBT exposure resulted in a significant increase of T3 level by 1.24-fold in the 2.44 ng/L of TBT group compared to the control, while the T3 level was significantly decreased by 0.67-fold in the 24.4 ng/L of TBT group compared to the control (Fig. 4A). In addition, exposure to 2.44 ng/L of TBT resulted in a significant increase (by 1.59-fold) of T4 level, whereas 24.4 ng/L of TBT did not significantly affect T4 level compared to the control (Fig. 4B).
In the present study, waterborne TBT at the concentrations used increased the weight gain of goldfish, which is consistent with the previous work (Meador et al., 2011) that TBT elicits obesogen responses in juvenile Chinook salmon. TBT is considered as a kind of obesogen, chiefly for its action on fat tissue inducing the differentiation of preadipocytes from adipocytes (Inadera and Shimomura, 2005; Kanayama et al., 2005). Our study demonstrated that TBT also act on feeding and energy metabolism in fish, which might promote obesogenic responses.
J. Zhang et al. / Chemosphere 152 (2016) 221e228
225
Fig. 2. The brain mRNA expression of NPY (A), POMC (B), ghrelin (C), CART (D), CRF (E) and apelin (F) in the goldfish (Carassius auratus) exposed to control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment. The Figures show the mRNA levels normalized to the levels of EFa (mean ± S.E., n ¼ 6). Means of exposures not sharing a common letter are significantly different at p < 0.05.
It is reported that TBT can be transported to the brains of fish by axonal transport (Rouleau et al., 2003). In the present study, TBT and its metabolites were detected from the brains exposed to TBT, while TBT and its metabolites were below the detection limit in the control, pair-fed, and fasted groups. Thus, the butyltin in the brains of the exposure groups should mostly relate to the amount of TBT administrated, not the water and food used. The enhanced accumulation of the butyltin in the brains might negatively impact the nervous system, such as neuropeptide. NPY has been implicated in the regulation of food intake as a powerful orexigenic neuropeptide in goldfish (Volkoff and Peter, 2001a). The observed increases of NPY mRNA in the brains of fish exposed to TBT are associated with the observed increases of food intake and weight gains. In the melanocortin system, POMC-derived peptides such as the family of melanocyte-stimulating hormones peptides, bind to melanocortin receptor, resulting in an anorexigenic effect (Bertile and Raclot, 2006). In addition, POMC expression can be inhibited by NPY, which would result in orexigenic effects (Garcia de Yebenes et al., 1995). In the present study, we observed that TBT exposure led to a significant decrease of POMC expression, which could also explain
the observed increases of food intake and weight gains in the fish exposed to TBT. In most fish species, ghrelin treatment appears to €nsson, promote food intake and a more positive energy balance (Jo 2013). However, it is reported that ghrelin may be a long-term indicator of energy status rather than a meal-related signal in fish (Fox et al., 2009). Thus, the decrease of ghrelin expression might be associated with the increase of weight gain after TBT exposure. Two forms of CART peptide precursors, CART1 and CART2 have been identified in goldfish (Volkoff and Peter, 2001b). CART appears to have a number of physiological functions including the inhibition of food intake, the stimulation of energy expenditure and the regulation of hypothalamicepituitary axes (Rogge et al., 2008). CRH is also implicated in the regulation of energy homeostasis. Studies of the effect of CRH on feeding behavior in goldfish have shown that it acts as a powerful anorexigenic peptide (Matsuda et al., 2008). The decrease of CART1, CART2, and CRH can contribute to the increases of food intake and weight gains of fish exposed to TBT. Apelin is upregulated in obese humans and mice (Dray et al., 2008) and dysregulation of apelin might be involved in the development of obesity (Rayalam et al., 2008). In goldfish, it is reported that apelin
226
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Fig. 4. The levels of T3 (A) and T4 (B) in the serum of goldfish (Carassius auratus) exposed to control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment. Data are presented as mean ± S.E. (n ¼ 6). Means of exposures not sharing a common letter are significantly different at p < 0.05.
Fig. 3. The oxygen consumption (A), ammonia excretion rate (B), and swimming activity (C) of goldfish (Carassius auratus) exposed to control and TBT (2.44 and 24.4 ng/L) groups over the 54-d experiment. Data are presented as mean ± S.E. (n ¼ 12). Means of exposures not sharing a common letter are significantly different at p < 0.05.
acts as an orexigenic factor (Volkoff and Wyatt, 2009). Thus, like NPY, the increases of apelin expression in the brains of fish exposed to TBT are associated with the observed increases of food intake and weight gains. It is possible to evaluate the energy spent during a certain period of time to maintain its vital processes based on the amount of oxygen consumed and ammonium excreted by an animal for the same period (Barbieri and Paes, 2011). It is reported that oxygen consumption in combination with measurements of ammonia
excretion can be used to assess the effects of environmental perturbations on the energy metabolism of fish (De Boeck et al., 1995). In the present study, at the 2.44 ng/L of TBT group, we observed an increasing oxygen uptake rate and ammonia excretion rate reflecting an increased metabolic rate. The locomotor performance is often attributed to changes in metabolic capacity. In the present study, the swimming activity was also increased at the 2.44 ng/L of TBT group. However, no changes of oxygen uptake rate, ammonia excretion rate, and swimming activity was found at the 24.4 ng/L of TBT group, which indicated a complex disrupting effect on energy metabolism of TBT. It is reported that the non-linear responses are remarkably common in studies of endocrine disruptors and many different mechanisms might be involved (Vandenberg et al., 2012). In the present study, the extra energy expenditure induced by 2.44 ng/L of TBT might be a stress response. In fish, mobilization of energy sources is an adaptive strategy adopted to avoid stress (Wendelaar Bonga, 1997). Energy is required to neutralize the effects of toxicants and maintain the animal homeostasis (Giesy and Graney, 1989). Exposure of wild organisms to pollutants has generally been reported to increase metabolic rate (McGeer et al., 2000; Campbell et al., 2002). No changes of these energy metabolism indicators at the 24.4 ng/L of TBT group might be due to the cytological damage of TBT. Interestingly, a lower increase in body weight was observed in fish exposed to 2.44 ng/L of TBT when compared to its pair-fed group, which might be associated with the increase of metabolic rate and swimming activity induced by TBT.
J. Zhang et al. / Chemosphere 152 (2016) 221e228
Thyroid hormone, including T3 and T4, is predominately recognized as a regulator of growth and development in fish (Tata, 2011), but there is growing evidence that thyroid hormone also stimulates metabolism in adult fish (Johnson and Lema, 2011; Little and Seebacher, 2013). In the present study, the serum T3 and T4 both increased at 2.44 ng/L of TBT group compared to the control, which is in accordance with the increases of energy metabolism indicators at 2.44 ng/L of TBT group. At the 24.4 ng/L of TBT group, no change of T4 and a decrease of T3 were found when compared to the control, which indicated that TBT at a higher level might have probably disrupted the synthesis or secretion of the circulating thyroid hormone and the conversion of T4 to T3. Environmental contaminants are thought to affect the synthesis, transport and metabolism of thyroid hormone by disrupting the thyroid system in fish (Coimbra et al., 2005; Morgado et al., 2009). In our previous study, a mild to severe damage of the thyroid gland were observed in fish exposed to 24.4 and 244 ng/L (10 and 100 ng/L as Sn) of TBT, but not in fish exposed to 2.44 ng/L (1 ng/L as Sn) of TBT (Zhang et al., 2009). Thus, no change of T4 and a decrease of T3 observed in the present study might due to the thyroid dysfunction induced by TBT exposure. In conclusion, waterborne TBT at environmentally relevant concentrations increased the weight gains of goldfish. TBT exposure also increased the food intake, which might be associated with the changes of brain neuropeptides expression. Moreover, TBT also disturbed the energy metabolism indicators, which might related to the disruption of thyroid hormone. These results suggest that the TBT might inappropriately alter feeding and energy metabolism to promote obesity in fish. Acknowledgments This work was supported by the National Natural Science Foundation (41301562 and U1304329) of China. References Antizar-Ladislao, B., 2008. Environmental levels, toxicity and human exposure to tributyltin (TBT)-contaminated marine environment. A review. Environ. Int. 34, 292e308. Barbieri, E., Paes, E.T., 2011. The use of oxygen consumption and ammonium excretion to evaluate the toxicity of cadmium on Farfantepenaeus paulensis with respect to salinity. Chemosphere 84, 9e16. Bertile, F., Raclot, T., 2006. The melanocortin system during fasting. Peptides 27, 291e300. Campbell, H.A., Handy, R.D., Sims, D.W., 2002. Increased metabolic cost of swimming and consequent alterations to circadian activity in rainbow trout (Oncorhynchus mykiss) exposed to dietary copper. Can. J. Fish. Aquat. Sci. 59, 768e777. Cao, D., Jiang, G., Zhou, Q., Yang, R., 2009. Organotin pollution in China: an overview of the current state and potential health risk. J. Environ. Manag. 90, S16eS24. Coimbra, A.M., Reis-Henriques, M.A., Darras, V.M., 2005. Circulating thyroid hormone levels and iodothyronine deiodinase activities in Nile tilapia (Oreochromis niloticus) following dietary exposure to Endosulfan and Aroclor 1254. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 141, 8e14. De Boeck, G., De Smet, H., Blust, R., 1995. The effect of sublethal levels of copper on oxygen consumption and ammonia excretion in the common carp, Cyprinus carpio. Aquat. Toxicol. 32, 127e141. on, M., Cani, P.D., Dray, C., Knauf, C., Daviaud, D., Waget, A., Boucher, J., Bule , C., Guigne , C., Carpe ne , C., Burcelin, R., Castan-Laurell, I., Valet, P., 2008. Attane Apelin stimulates glucose utilization in normal and obese insulin-resistant mice. Cell Metab. 8, 437e445. Fox, B.K., Breves, J.P., Hirano, T., Grau, E.G., 2009. Effects of short- and long-term fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Domest. Anim. Endocrinol. 37, 1e11. Garcia de Yebenes, E., Li, S., Fournier, A., St-Pierre, S., Pelletier, G., 1995. Regulation of proopiomelanocortin gene expression by neuropeptide Y in the rat arcuate nucleus. Brain Res. 674, 112e116. Giesy, J.P., Graney, R.L., 1989. Recent developments in the intercomparisons of acute and chronic bioassays and bioindicators. Hydrobiologia 188, 21e60. Grün, F., Watanabe, H., Zamanian, Z., Maeda, L., Arima, K., Chubacha, R., Gardiner, D.M., Iguchi, T., Kanno, J., Blumberg, B., 2006. Endocrine disrupting organotin compounds are potent inducers of adipogenesis in vertebrates. Mol.
227
Endocrinol. 20, 2141e2155. Harino, H., Fukushima, M., Kawai, S., 2000. Accumulation of butyltin and phenyltin compounds in various fish species. Arch. Environ. Contam. Toxicol. 39, 13e19. Harino, H., O'Hara, S.C.M., Burt, G.R., Pope, N.D., Chesman, B.S., Langston, W.J., 2002. Butyltin and phenyltin compounds in eels (Anguilla anguilla). J. Mar. Biol. Assoc. U. K. 82, 893e901. Inadera, H., Shimomura, A., 2005. Environmental chemical tributyltin augments adipocyte differentiation. Toxicol. Lett. 159, 226e234. Jiang, G.B., Zhou, Q.F., Liu, J.Y., Wu, D.J., 2001. Occurrence of butyltin compounds in the waters of selected lakes, rivers and coastal environments from China. Environ. Pollut. 115, 81e87. Johnson, K.M., Lema, S.C., 2011. Tissue-specific thyroid hormone regulation of gene transcripts encoding iodothyronine deiodinases and thyroid hormone receptors in striped parrotfish (Scarus iseri). Gen. Comp. Endocrinol. 172, 505e517. €nsson, E., 2013. The role of ghrelin in energy balance regulation in fish. Gen. Jo Comp. Endocrinol. 187, 79e85. Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., Nishikawa, J., 2005. Organotin compounds promote adipocyte differentiation as agonists of the peroxisome proliferator-activated receptor gamma/retinoid X receptor pathway. Mol. Pharmacol. 67, 766e774. Kang, K.S., Yahashi, S., Matsuda, K., 2011. The effects of ghrelin on energy balance and psychomotor activity in a goldfish model: an overview. Int. J. Pept. 2011, 171034. Little, A.G., Seebacher, F., 2013. Thyroid hormone regulates muscle function during cold acclimation in zebrafish (Danio rerio). J. Exp. Biol. 216, 3514e3521. Marchant, T.A., Peter, R.E., 1986. Seasonal variation in body growth rates and circulating levels of growth hormone in goldfish, Carassius auratus. J. Exp. Zool. 237, 231e239. Matsuda, K., 2009. Recent advances in the regulation of feeding behavior by neuropeptides in fish. Ann. N. Y. Acad. Sci. 1163, 241e250. Matsuda, K., Kojima, K., Shimakura, S., Wada, K., Maruyama, K., Uchiyama, M., Kikuyama, S., Shioda, S., 2008. Corticotropin-releasing hormone mediates alpha-melanocyte-stimulating hormone-induced anorexigenic action in goldfish. Peptides 29, 1930e1936. Matthiessen, P., 2008. An assessment of endocrine disruption in mollusks and the potential for developing internationally standardized mollusk life cycle test guidelines. Integr. Environ. Assess. Manag. 4, 274e284. McAllister, B.G., Kime, D.E., 2003. Early life exposure to environmental levels of the aromatase inhibitor tributyltin causes masculinisation and irreversible sperm damage in zebrafish (Danio rerio). Aquat. Toxicol. 65, 309e316. McGeer, J.C., Szebedinszky, C., McDonald, D.G., Wood, C.M., 2000. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout. 1: ionoregulatory disturbance and metabolic costs. Aquat. Toxicol. 50, 231e243. Meador, J.P., Sommers, F.C., Cooper, K.A., Yanagida, G., 2011. Tributyltin and the obesogen metabolic syndrome in a salmonid. Environ. Res. 111, 50e56. Mennigen, J.A., Sassine, J., Trudeau, V.L., Moon, T.W., 2010. Waterborne fluoxetine disrupts feeding and energy metabolism in the goldfish Carassius auratus. Aquat. Toxicol. 100, 128e137. Morgado, M.A., Campinho, R., Costa, R., Jacinto, D.M., 2009. Power disruption of the thyroid system by diethylstilbestrol and ioxynil in the sea bream (Sparus aurata). Aquat. Toxicol. 92, 271e280. Nakayama, K., Oshima, Y., Yamaguchi, T., Tsuruda, Y., Kang, I.J., Kobayashi, M., Mada, N., Honjo, T., 2004. Fertilization success and sexual behavior in male medaka, Oryzias latipes, exposed to tributyltin. Chemosphere 55, 1331e1337. Pinheiro, J., Bates, D., DebRoy, S., Sarkar, D., R Core Development Team, 2013. nlme: Linear and Nonlinear Mixed Effects Models. R Core Development Team. R Package Version 3.1, p. 109. Rayalam, S., Della-Fera, M.A., Krieg, P.A., Cox, C.M., Robins, A., Baile, C.A., 2008. A putative role for apelin in the etiology of obesity. Biochem. Biophys. Res. Commun. 368, 815e819. n, H., Reyhanian, N., Volkova, K., Hallgren, S., Bollner, T., Olsson, P.E., Olse €llstro €m, I.P., 2011. 17a-Ethinyl estradiol affects anxiety and shoaling behavior Ha in adult male zebra fish (Danio rerio). Aquat. Toxicol. 105, 41e48. Rogge, G., Jones, D., Hubert, G.W., Lin, Y., Kuhar, M.J., 2008. CART peptides: regulators of body weight, reward and other functions. Nat. Rev. Neurosci. 9, 747e758. Rouleau, C., Xiong, Z.H., Pacepavicius, G., Huang, G.L., 2003. Uptake of waterborne tributyltin in the brain of fish: axonal transport as a proposed mechanism. Environ. Sci. Technol. 37, 3298e3302. Shimasaki, Y., Kitano, T., Oshima, Y., Inoue, S., Imada, N., Honjo, T., 2003. Tributyltin causes masculinization in fish. Environ. Toxicol. Chem. 22, 141e144. Shue, M.F., Chen, T.C., Bellotindos, L.M., Lu, M.C., 2014. Tributyltin distribution and producing androgenic activity in water, sediment, and fish muscle. J. Environ. Sci. Health B 49, 432e438. Tata, J.R., 2011. Looking for the mechanism of action of thyroid hormone. J. Thyroid. Res. 2011, 730630. Vandenberg, L.N., Colborn, T., Hayes, T.B., Heindel, J.J., Jacobs Jr., D.R., Lee, D.H., Shioda, T., Soto, A.M., vom Saal, F.S., Welshons, W.V., Zoeller, R.T., Myers, J.P., 2012. Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr. Rev. 33, 378e455. Verdouw, H., van Echteld, C.J.A., Dekkers, E.M.J., 1978. Ammonia determination based on indophenol formation with sodium salicylate. Water Res. 12, 399e402. Volkoff, H., Peter, R.E., 2001a. Interactions between orexin A, NPY and galanin in the control of food intake of the goldfish, Carassius auratus. Regul. Pept. 101, 59e72. Volkoff, H., Peter, R.E., 2001b. Characterization of two forms of cocaine- and
228
J. Zhang et al. / Chemosphere 152 (2016) 221e228
amphetamine-regulated transcript (CART) peptide precursors in goldfish: molecular cloning and distribution, modulation of expression by nutritional status, and interactions with leptin. Endocrinology 142, 5076e5088. Volkoff, H., Wyatt, J.L., 2009. Apelin in goldfish (Carassius auratus): cloning, distribution and role in appetite regulation. Peptides 30, 1434e1440. Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591e625. Zhang, J., Sun, P., Kong, T., Yang, F., Guan, W., 2016. Tributyltin promoted hepatic steatosis in zebrafish (Danio rerio) and the molecular pathogenesis involved. Aquat. Toxicol. 170, 208e215. Zhang, J., Zuo, Z., Chen, Y., Zhao, Y., Hu, S., Wang, C., 2007. Effect of tributyltin on the development of ovary in female cuvier (Sebastiscus marmoratus). Aquat. Toxicol. 83, 174e179. Zhang, J., Zuo, Z., He, C., Wu, D., Chen, Y., Wang, C., 2009. Inhibition of thyroidal
status related to depression of testicular development in Sebastiscus marmoratus exposed to tributyltin. Aquat. Toxicol. 94, 62e67. Zhang, J., Zuo, Z., Wang, Y., Yu, A., Chen, Y., Wang, C., 2011. Tributyltin chloride results in dorsal curvature in embryo development of Sebastiscus marmoratus via apoptosis pathway. Chemosphere 82, 437e442. Zhang, K.G., Shi, J.B., He, B., Xu, W.H., Li, X.D., Jiang, G.B., 2013. Organotin compounds in surface sediments from selected fishing ports along he Chinese coast. China Sci. Bull. 58, 231e237. Zhou, Q.F., Jiang, G.B., Liu, J.Y., 2001. Small-scale survey on the contamination status of butyltin compounds in seafoods collected from seven Chinese cities. J. Agric. Food Chem. 49, 4287e4291. Zuo, Z., Chen, S., Wu, T., Zhang, J., Su, Y., Chen, Y., Wang, C., 2011. Tributyltin causes obesity and hepatic steatosis in male mice. Environ. Toxicol. 26, 79e85.